2.1 Reagents and cell lines
HGC-27 and HCT116 were provided by Wuhan Procell Biotechnology Co., Ltd. (Wuhan, China) and cultured in medium (1640, RPMI) containing 10% FBS (Gibco, USA) and 1% penicillin-streptomycin (Biosharp, China). The cells were incubated at 37°C under 5% CO2. All cells used were under logarithmic growth and each experiment had three replicates.
TQ and APA were provided by Shanghai Yuanye Biotechnology Co., Ltd. and Aladdin Co., Ltd. (Shanghai, China), respectively. TQ and APA were dissolved in absolute ethanol and dimethyl sulfoxide (DMSO), respectively, and both were stored at -80°C. Antibodies were obtained from Cell Signaling Technology (USA); MMP2, MMP9, and Cyclin D1 were purchased from Abcam (USA); Lamin A/C, GAPDH, Alpha tubulin, and IgG were obtained from ABclonal (China).
2.2 Cell Proliferation Assay
After digestion and resuspension, the two cell lines were seeded in 96-well plates at a concentration of 5×103 per well. Concentrations of TQ (0, 4, 8, and 12 µg/ml) and APA (10 µg/ml) were tuned. After treatment for 12, 24, and 48 h, respectively, 10 µL of the CCK8 reagent (Biosharp, BS360A) was dropped to each well, followed by incubation for 2 h.
2.3 qRT-PCR
The two cell lines were seeded in 6-well plates and divided into the blank group (control, CON), the 10 µg/mL APA group, the 10 µg/mL APA + 4 µg/mL TQ group, the 10 µg/mL APA + 8 µg/mL TQ group, and the 10 µg/mL APA + 12 µg/mL TQ group. After treatment for 24 h, RNA was extracted sequentially by utilizing TRIzol, chloroform, isopropanol, and 75% ethanol after cell collection, followed by dissolution in RNase-free water. Also, reverse transcription and amplification were executed by utilizing a reverse transcription kit (Vazyme R312, China) and a PCR kit (Vazyme Q712, China), respectively. Table 1 summarizes the primer sequences. Gene expressions were quantified by utilizing the 2-△△Ct method, wherein Ct values were converted into relative values, and the levels of gene products were compared with each other based on the internal reference.
Table 1
| Primer Name | Sequences |
| JAK2-F | GGCCTTCTTTCAGAGCCATCA |
| JAK2-R | TTTTACAGCGACCACCTCCC |
| STAT3-F | GCCCTTTGGAACGAAGGGTA |
| STAT3-R | TGGTATTGCTGCAGGTCGTT |
| BAX-F | CGGGTTGTCGCCCTTTTCTA |
| BAX-R | GAGGAAGTCCAATGTCCAGCC |
| BCL2-F | ATCGCCCTGTGGATGACTGA |
| BCL2-R | GAGACAGCCAGGAGAAATCAAAC |
| MMP2-F | AGTGGATGATGCCTTTGCTCG |
| MMP2-R | CAAGGTCCATAGCTCATCGTCAT |
| MMP9-F | CCAGTCCACCCTTGTGCTCTT |
| MMP9-R | TGCCACCCGAGTGTAACCAT |
| E-cadherin-F | GGGTGTCGAGGGAAAAATAGG |
| E-cadherin-R | CGAGAGCTACACGTTCACGG |
| N-cadherin-F | CCCGCCGTTTCATCCATACCAC |
| N-cadherin-R | CGCCATCATCGCTATCCTTCTGTG |
| Vimentin-F | AGGCGGCCAATAGTGTCTTG |
| Vimentin-R | TGCCCTTAAAGGAACCAATGAG |
| cyclinD1-F | GCTGCGAAGTGGAAACCATC |
| cyclinD1-R | CCTCCTTCTGCACACATTTGAA |
| GAPDH-F | TTTGGTATCGTGGAAGGAC |
| GAPDH-R | GTGGAGGAGTGGGTGTCGC |
2.4 FITC Annexin V Apoptosis Detection with 7-AAD
HGC-27 and HCT116 were treated with different drugs. After treatment for 24 h, cells were stained with 10 µL of fluorescein isothiocyante (FITC) Annexin V and 20 µL of 7-AAD (FITC Annexin V/7-AAD kit, Vazyme A211-02, China). After 15-min incubation in dark, the cells were investigated by flow cytometry (Beckman B75442). Flowing software was used to determine the percentages of early apoptosis, late apoptosis, and necrotic cells. The results were represented by dot plots.
2.5 Cell Cycle Experiments
Thet two cell lines were treated with drugs with different concentrations. The attached and detached cells were collected and then incubated in 70% ethanol overnight at 4°C, resuspended in RNAse A-containing PBS, and incubated at 37°C for 30 min. 5 µL of staining solution was added, and the cells were exposed to 15-min incubation in dark. Cell cycle analysis was achieved by utilizing a commercial kit (Kaiji Biology KGA512, China). Flow cytometry (Beckman B75442) was used for analysis, and DNA content was measured by using Flowing software. Cell cycle distribution was displayed by histograms.
2.6 Scratch Assay
The two cell lines were seeded and cultured until a confluence of ~ 90%. A pipette tip was used to scratch a straight line across each well. After the detached cells were removed with PBS, drugs were added accordingly, and cells culture was continued. The scratches were monitored under a microscope before and after treatment.
2.7 Transwell Invasion Assay
200 µL of resuspended HGC-27 and HCT116 were added to the upper chamber (Corning 3422, USA), respectively. The lower chamber, which was coated with Matrigel, was filled with drug-containing culture medium. The samples were incubated for 24 h. After fixation with 4% paraformaldehyde and rinsing with PBS, HGC-27 and HCT116 were stained by utilizing crystal violet (Biosharp BL802A, China). Additionally, he cells were removed from the upper chamber by using a cotton swab, and the sample was observed under a microscope.
2.8 Protein Immunoblotting
HGC-27 and HCT116 were cultured until a confluence of 80%. Drugs were added accordingly, followed by incubation for 24 h. After rinsing with PBS, cells were collected and lysed with RIPA lysis buffer. Proteins separation and transfer to PVDF membranes (Immobilon, USA) were completed. Blocking of PVDF membranes with 5% skim milk was conducted, followed by incubation with primary antibodies overnight at 4°C. After that, membranes rinsing with TBST was repeated for three times, followed by incubation with secondary antibodies for 60 min. Finally, membrane visualization and quantification were achieved by using the ECL system (Bio-Rad, USA).
2.9 Hematoxylin and Eosin (HE) Staining for Tumor Pathological Morphology Evaluation
The fixed tumor tissue was dehydrated, trimmed and paraffin embedded. 5-µm-thick tissue sections were cut at the tumor center, followed by routine deparaffinization and HE staining. The tumor morphology was monitored under a light microscope.
2.10 Immunohistochemistry Experiment
The tumor tissues were subjected to routine dehydration and embedding to prepare paraffin sections (5 µm). The sections were deparaffinized, followed by antigen retrieval and rinsing with PBS. The tissues were incubated with hydrogen peroxide, and then blocking solution for one hour. Primary antibodies were added and the solution was left untouched overnight. DAB staining was performed, followed by counterstaining with hematoxylin, dehydration, clearing, and mounting with neutral resin. The sections were then checked by using microscope.
2.11 Animal and Xenograft Mouse Model
Nude mice (BALB/c-nu, SPF grade) used in this study were purchased from Hubei Silaike Jingda Co., Ltd. (SCXK 2019-0004). All experiments had been approved by the authority (SYXK 2018-0071) and performed in accordance with local and international guidelines for animal care and use. Male nude mice were acclimatized for seven days in an SPF-grade sterile animal facility. HGC-27 and HCT116 cells were digested, centrifuged and resuspended, with the final cell concentration adjusted to 5×106 cells/µL. Subcutaneous xenograft tumor models were established by injecting the cell suspension into the dorsal region of nude mice. Once the average tumor volume reached 50 mm3, the mice were categorized as a blank control group, an APA treatment group, a TQ treatment group, and an APA-TQ combined treatment group. Tumor size was measured every three days after subcutaneous injection, and mice were euthanized 21 days later, after which tumors were excised and the volumes were measured.
2.12 Statistical Analysis
GraphPad Prism 8.0and SPSS 22.0 were employed for data analysis. Inter-group comparisons were achieved by Student’s t-test, while multi-group comparison was achieved by one-way ANOVA. p < 0.05 denoted statistical significance.