Investigation of human papillomavirus types in HER2/Neu breast cancer samples among women in Ardabil province

doi:10.21203/rs.3.rs-4681239/v1

Download PDF

Research Article

Investigation of human papillomavirus types in HER2/Neu breast cancer samples among women in Ardabil province

https://doi.org/10.21203/rs.3.rs-4681239/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

The potential role of human papillomavirus (HPV) in breast carcinogenesis has been a topic of ongoing debate and investigation. While some studies have reported detecting HPV DNA in breast cancer samples, others have failed to establish a clear association. This study aimed to examine the presence of HPV in breast cancer tissue samples from patients in Ardabil, Iran, to contribute to the understanding of this potential link.

Methods

A total of 100 tissue samples, comprising 50 breast cancer samples and 50 healthy control samples, were analyzed. Fresh-frozen samples were transported and stored appropriately until processing. DNA extraction was performed using a commercial kit, and specific primers targeting the HPV L1 gene were employed for PCR amplification. Conventional PCR, agarose gel electrophoresis, and real-time PCR were utilized for HPV detection.

Results

Despite employing highly sensitive PCR techniques, including real-time PCR, no HPV DNA sequences were detected in any breast cancer tissue samples analyzed.

Conclusion

While the role of HPV in breast carcinogenesis remains an area of ongoing investigation and debate, with conflicting evidence from recent studies, the present study did not detect HPV DNA in breast cancer samples from Ardabil, Iran

Breast Neoplasms

Adenofibroma

HPV

Real-Time PCR

Iran

Human papillomavirus (HPV) is a common sexually transmitted infection that has been associated with a variety of cancers, such as cervical, vulvar, vaginal, and penile cancer [1]. Recently, growing evidence suggests that HPV may also be a risk factor for breast cancer [2]. Breast cancer, which affects an estimated 2.3 million women worldwide, is the most common cancer among women [3]. While most breast cancers are sporadic, a small percentage are caused by inherited mutations in genes such as BRCA1 and BRCA2 [4]. The Papillomaviridae family comprises a large group of viruses recently classified into 16 genera, of which five include members that infect humans [5]. Papillomaviruses have a small size of 55 nanometers and a circular, double-stranded DNA genome of about 8 Kb [6]. They exhibit complex genome organization [6]. The papillomaviruses have significant diversity, and researchers have identified over 200 HPV types [7]. Researchers have detected various HPV types worldwide, including in Iran, concerning studies investigating the role of HPV in breast cancer [8]. These types include 6, 11, 15, 16, 18, 23, 33, 35, 45, 51, 52, 58, and 124, which have been identified in laboratory samples of breast cancer and HPV [9]. Although breast cancer is not a transmissible or infectious disease, given the conflicting studies globally and the high prevalence of breast cancer among women, The study aimed to examine the frequency of HPV types in breast cancer samples among women in Ardabil province, Iran, to determine the role of HPV in breast cancer in this population. Madadgar Omid and et al showed that Out of 200 breast cancer suspected tissue samples Based on the nested PCR method, the L1 gene of HPV was detected in 12% (24/200) of the BC-suspected tissue samples The high-risk HPV genotypes (which were the predominant types) were present in 75% of the samples.[51] Such these findings suggest that HPV may play a role in the development of breast cancer in this population. The study has several implications for breast cancer prevention and treatment. Firstly, the results suggest that HPV infection may be a risk factor for breast cancer, and this should be taken into account in breast cancer screening and prevention programs. Secondly, the identification of specific HPV types in breast cancer samples may aid in the development of targeted therapies for breast cancer patients. Finally, the study highlights the need for further research better to understand the role of HPV in breast cancer and to develop effective prevention and treatment strategies .Further research is needed better to understand the role of HPV in breast cancer and to develop effective prevention and treatment strategies.

This study analyzes tissue samples from cancerous and fibroadenoma patients to determine the presence of the human papillomavirus (HPV). The study examines 100 tissue samples of female patients of Imam Khomeini Hospital from Ardabil, Iran, from 2021 until 2022 which divided into two groups: neoplasmic (n = 50) and healthy (n = 50). To ensure the utmost accuracy of the results, the study meticulously selects samples with sufficient tumoral tissue, no necrosis, and no bleeding; The age range of the patients, the grade of malignancy, and the location of the cancer, which are inclusion factors in our research. The fresh-frozen samples were transported in cryovials containing RNA-ase and DNA-ase-free solution in portable nitrogen tanks and stored in a -70°C freezer until further processing. The DNA is then extracted using a kit (Roje company) and specific primers designed for HPV's L1 gene. forward:(AGGACACAAGCCAACGTTAA); Reverse:(AGTTGCTGTATGGTTCGTAG); Strict precautions are taken to prevent sample contamination during the DNA extraction and PCR processes, following the manufacturer's recommendations for high- and low-risk HPV infections. The extracted DNA is amplified using the polymerase chain reaction (PCR) technique and analyzed through agarose gel electrophoresis. Real-time PCR is also performed for more accuracy.

Real-time PCR Analysis:

The primers were designed with Primer3 software and checked with oligoanalyzer. The GAPDH gene was chosen as the internal control. The positive control for L1 gene was a gift from Dr. kaveh sadeghi from virology department of TUMS. The PCR reactions were set up in 10 µL volumes containing 10 µL SYBR Green PCR Master Mix (2×), 1 µL primer mix, 8 µL nuclease-free water, and 1 µL diluted DNA template (50 ng/µL). The thermal cycling conditions included a denaturation at 95°C for 10 minutes, followed by 40 cycles of 95°C for 15 seconds (denaturation) and 59°C for 30 seconds of annealing, and 72°C for 25 seconds of extension. all samples underwent gradual denaturation to generate melting curves, first 95°C for 10 seconds and 65°C for 1 minute .The realtime-PCR assays were performed using abi equipment, and the data were analyzed using the associated abi Series Software .In addition to the test samples, a negative control sample from an individual without the L1 HPV gene was included in all runs.

Out of 50 patients from whom samples were collected, we managed to review the files of 49 of them and record data such as age, body mass index (BMI), family history, and BI-RADS assessment for each person. Of this number, 48 people had their age mentioned in the file (one person did not wish to share all information), and the average age of these individuals, who were between the range of 32–76 years old, was 49.35 years. On the other hand, the BMI of 40 people was mentioned in the file, and their average from the range of 17.57 to 34 was 27.46. They were also questioned (face-to-face or by reviewing the patient's medical history at the hospital) about whether the patient had a family history of breast cancer or not, and were categorized into negative, first-degree positive (female) relatives, second-degree, and third-degree relatives. Out of 49 people, 42 were evaluated in this regard, and 33 had a negative family history, 2 had first-degree relatives affected, 4 had second-degree relatives affected, and 3 had third-degree relatives affected by breast cancer. Additionally, by examining the mammograms and ultrasounds of the patients, we categorized them according to their BI-RADS assessment, as shown in the Table 1.

Table 1

BI-RADS assessment patient by breast cancer in Ardebil province
BI-RADS: (Breast Imaging-Reporting and Data System)*	COUNT
II	1
III	2
IVA	5
IVB	3
IVC	9
V	22
VI	5
TOTAL	47

*: BI-RADS is a risk assessment and quality assurance tool developed by the American College of Radiology that provides a widely accepted lexicon and reporting schema for imaging of the breast. It applies to mammography, ultrasound, and MRI[29].

Additionally, ImmunoHistoChemistry data was found in the files of 9 individuals (Table two), IHC is a special staining process performed on fresh or frozen breast cancer tissue removed during biopsy. IHC is used to show whether or not the cancer cells have HER2 receptors and/or hormone receptors on their surface like (Estrogen receptor/progesterone receptor (ER/PR)). All biopsy types involve removing bodily tissue and taking it to a laboratory, where a pathologist who specializes in diagnosing diseases will examine the sample under a microscope. To determine whether or not the specimen is cancerous, the pathologist usually only needs to examine the cells and perform standard tests called stains, which use colored substances (dyes) to highlight cancer cells. It may be difficult to differentiate cancer cells from healthy ones based only on their appearance and routine tests. When these methods aren’t enough to make a diagnosis, the care team may turn to IHC.

Table 2

Immunohistochemistry data patient by breast cancer in Ardebil province
Patient:	one	two	three	four	five	six	seven	eight	nine
SMMH¹	neg	neg	neg	neg	ND	ND	neg	ND	ND
P63²	neg	ND	neg	neg	neg	ND	neg	ND	ND
ER	pos	pos	90%	80%	90%	90%	90%	90%	95%
PR	pos	pos	40%	80%	neg	10%	neg	neg	5–10%
HER2/Neu	1+	3+	neg	2+	1+	neg	1+	1+	neg
Ki-67³	Up to 20%	Up to 25%	Up to 35%	Up to 20%	Up to 3–5%	Up to 40%	ND	Up to 15%	Up to 35–40%

The IHC test gives a score of 0 to 3 + that measures the amount of HER2 receptor protein on the surface of cells in a breast cancer tissue sample. If the score is 0 to 1+, it’s called HER2 negative. If the score is 2+, it's called borderline. A score of 3 + is called HER2 positive.Most testing labs use the IHC test to see if there are hormone receptors on breast cancer cells. If hormone receptors are present, this means that the cancer cells’ growth is fueled by the hormones estrogen and/or progesterone. Not all labs use the same method for analyzing the results of the test, and they do not have to report the results in exactly the same way. So you may see any of the following results: a percentage that tells you how many cells out of 100 stain positive for hormone receptors. You will see a number between 0% (none have receptors) and 100% (all have receptors). The higher the score, the more receptors were found and the easier they were to see in the sample. This information is provided by https://www.breastcancer.org/ 1. Smooth muscle myosin heavy chain 2. p63 is a specific nuclear marker of myoepithelial cells in the breast and can, therefore, aid in distinguishing invasive ductal carcinoma from DCIS or rare questionable hyperplastic lesions [50]. 3. Ki-67 IHC is a biomarker widely used for assessments of tumor proliferation. However, its broad clinical adoption for breast carcinoma management has been limited by lack of standardization and established cutoffs [52].

All biopsy samples taken from breast cancer patients were tested using PCR methods, but none of them showed any positivity for HPV DNA sequences in conventional PCRs. Even after further testing these samples using real-time PCR, the presence of HPV DNA sequences could not be detected. Despite the high sensitivity of real-time PCR, the hypothesis that oncogenic HPV is involved in the pathogenesis of breast cancer in Ardabil women is not supported by the absence of HPV DNA in the collected tumor tissue of breast cancer patients.

The present study investigated the potential association between human papillomavirus (HPV) infection and breast carcinogenesis in female patients of Imam Khomeini Hospital from Ardabil, Iran, from 2021 until 2022. The results diverge from several earlier studies conducted in various geographical regions, which reported detecting HPV DNA in breast cancer specimens. Recent studies have continued to provide conflicting evidence regarding the association between HPV and breast cancer, further fueling the ongoing debate surrounding this topic [10–12]. Notable studies supporting a potential link on HPV prevalence in breast cancer cases across multiple studies [13]. Similarly, a study by Alok C Bharti & Bhudev C Das et al analyzed breast cancer samples from 228 biopsies from 252 Indian patients and found no precense of the most common high-risk HPV types 16 and 18 [14]. Additionally, in Egypt a study by Mohamed Elrefaei et al. (2021) reported detecting HPV in 14 of 16 (87.5%), 2 of 16 (12.5%), and 0 of 16 (0%) for genotypes 16, 18, and 31 in total of 72 BC cases which 16 of them were positive for HPV DNA viral load [15]. Conversely, several studies have failed to establish a clear association between HPV and breast cancer [16–18]. A study of 124 Japanese breast cancer patients by Tsai et al. found HPV DNA present in 21% of tumors, predominantly HPV-16 integrated at low viral loads, suggesting an unlikely etiological role for HPV in the breast carcinomas examined [19]. Similarly, another study in Shiraz, Iran, examining 150 breast cancer cases and 150 benign breast lesions found no evidence of human papillomavirus (HPV) or human cytomegalovirus (HCMV) DNA in either malignant or benign breast tumors, suggesting no association between these viral infections and breast cancer development, aligning with the results of the present study [20]. A study by Barem Rabenhorst et al. (2022) detected no HPV DNA in 75 of breast cancer samples from Brazilian(North-East) patients, with HPV-16 being the most prevalent genotype [21]. These conflicting results highlight the ongoing debate and the need for further research to clarify the potential role of HPV in breast carcinogenesis. Several factors may contribute to the discrepancies observed across different studies, including variations in study populations, sample sizes, methodological approaches, and the sensitivity of the techniques employed for HPV detection. The potential molecular mechanisms underlying a causative role of HPV in breast cancer development remain primarily speculative [24]. However, several hypotheses have been proposed based on the well-established oncogenic properties of high-risk HPV types in cervical and other anogenital cancers [24]. The expression of viral oncoproteins, such as E6 and E7, can disrupt critical cellular pathways involved in cell cycle regulation, apoptosis, and genomic instability. For instance, HPV-16 E6 and E7 oncoproteins independently induce numerical and structural chromosome instability, leading to mitotic abnormalities and DNA damage [25]. Additionally, E6 and E7 modulate DNA methylation and interact with the Ubiquitin Proteasome System, further disrupting cell cycle and apoptosis regulation [26].

It is crucial to interpret the current study's findings within the context of its limitations and the ongoing debate regarding the role of HPV in breast carcinogenesis. The sample size of 50 breast cancer specimens may be considered relatively minor, potentially limiting the statistical power to detect HPV DNA, particularly if present at low viral loads or in a subset of tumors.

One potential explanation for the absence of HPV DNA in the analyzed samples could be related to the sensitivity and specificity of the PCR techniques employed. While PCR is a sensitive method for detecting viral DNA, several factors can influence its performance and lead to false-negative results. Poorly designed primers can lead to inefficient annealing or non-specific amplification [30]. Degradation of primers, dNTPs, or the DNA polymerase enzyme due to improper storage or handling can affect the efficiency of the reaction [31]. Presence of PCR inhibitors: Certain substances, such as phenolic compounds, salts, or inhibitors co-purified from the sample, can interfere with the PCR reaction [32]. If the initial amount of template DNA is too low, the target sequence may not be amplified efficiently or at all [33]. Introduction of extraneous DNA from previous PCR products, laboratory equipment, or reagents can lead to false-positive results [34]. Primers can bind to non-target sequences, resulting in the amplification of undesired products [35]. Primers can anneal to each other, leading to the amplification of non-specific products [36]. The DNA polymerase enzyme can introduce mutations during the extension step, leading to sequence errors in the amplified product [37]. Specific sequences may be preferentially amplified over others, leading to an inaccurate representation of the original template compositionp [38]. Or the Plateau effect; As the PCR reaction progresses, the reagents become depleted, and the amplification efficiency decreases, leading to an underestimation of the target sequence abundance [39].

Gel electrophoresis is a widely used technique for separating and visualizing DNA, RNA, or protein molecules based on size and charge. The technique involves loading the samples onto a gel matrix (typically agarose or polyacrylamide) and applying an electric field. The negatively charged molecules migrate through the gel towards the positive electrode, with smaller molecules moving faster than larger ones, resulting in size-based separation [23].

Potential Errors in Gel Electrophoresis can be like Using an inappropriate agarose or polyacrylamide concentration, leading to poor resolution or inefficient separation of molecules [40]. Presence of air bubbles or uneven polymerization: Air bubbles or uneven polymerization can distort the gel matrix, resulting in irregular migration patterns [41]. Improper buffer composition or pH can affect the charge and migration of molecules [40]. Uneven loading of samples onto the gel wells can lead to distorted or smeared bands [42]. Inappropriate sample buffer composition or ionic strength can affect the migration of molecules [43]. Loading excessive amounts of sample can lead to band distortion or diffusion [40]. Using improper voltage or current settings can lead to poor resolution, band smearing, or overheating of the gel [44]. Insufficient running time can result in incomplete separation of molecules [45]. Uneven cooling or heating during the electrophoresis run can cause lane distortions or irregular migration patterns [46]. Incorrect staining or destaining procedures can lead to poor band visibility or high background staining [47]. Improper exposure settings during imaging can make it difficult to accurately analyze and interpret the results [48]. Errors in image analysis software or user mistakes during band size estimation can lead to inaccurate interpretations [49]. To minimize these potential errors and ensure accurate and reproducible results, it is essential to follow optimized protocols, employ stringent quality control measures, and maintain meticulous attention to detail throughout the experimental process.

Another potential factor contributing to the negative findings could be the heterogeneity of HPV distribution within the tumor tissue. HPV infection may be localized to specific Another potential factor contributing to the negative findings could be the heterogeneity of HPV distribution within the tumor tissue. HPV infection may be localized to specific tumor regions, and the selected tissue samples may not have contained HPV-positive cells, leading to false-negative results. Furthermore, the viral load or copy number of HPV in the samples could be below the detection limit of the PCR assays employed in this study. To address these limitations, future studies should aim to analyze larger cohorts and employ tissue sampling strategies that account for potential tumor heterogeneity, such as multiregional sampling or laser capture microdissection techniques. Additionally, incorporating more sensitive and specific HPV detection methods, such as next-generation sequencing (NGS) or droplet digital PCR (ddPCR), could enhance the ability to identify low-copy-number viral sequences. NGS has demonstrated superior sensitivity in detecting HPV in both plasma and oral rinse samples, making it a valuable tool for monitoring disease recurrence in HPV-positive cancers [22]. Additionally, ddPCR has been reported as an ultrasensitive and highly precise method for nucleic acid quantification, useful for detecting oncogenic HPV in various cancers [27]. Furthermore, exploring potential confounding factors, such as co-infections with other viruses or environmental exposures, may shed light on the complex interplay of risk factors in breast carcinogenesis. Additionally, investigating the potential mechanisms by which HPV could contribute to breast cancer development, if any, may yield valuable insights. Some hypotheses involve the expression of viral oncoproteins, chronic inflammation, or the deregulation of cellular pathways, but further mechanistic studies are warranted to elucidate these potential links [28].

In conclusion, while the present study did not detect HPV DNA in breast cancer tissue samples from Ardabil, Iran, the role of HPV in breast carcinogenesis remains an area of ongoing investigation and debate. Recent researchs from the past three years has continued to provide conflicting evidence, underscoring the need for more extensive, multicenter studies with standardized methodologies and rigorous quality control measures. Future research should also aim to explore potential confounding factors, mechanistic links, and address limitations related to sample size, tumor heterogeneity, and HPV detection sensitivity. Elucidating the potential involvement of HPV in breast cancer development could have profound implications for targeted prevention and therapeutic strategies, contributing to the ongoing efforts to combat this prevalent malignancy.

Ethical Considerations:

This project was allowed to operate by receiving the ethics code (IR.ARUMS.REC.1402.092) from the Ethics Committee of Ardabil University of Medical Sciences. Informed consent will be obtained from all participants in this research study. It is important to note that neither the investigators nor the participants will be subjected to any risks during the study. The investigator will treat all information obtained confidentially and securely.

Acknowledgment:

On behalf of the research team, we would like to extend our sincere gratitude to the staff of the Pathology Department at Imam Khomeini Hospital for their invaluable contributions to our research project. We particularly thank Dr. Sharifi for her unwavering support and assistance in sample preparation. Her expertise and dedication were instrumental in ensuring the success of our study. We also extend our appreciation to Mr. Akbari, the Head of the General Surgery Operating Room, for his cooperation in providing patient records and facilitating access to samples. His willingness to go the extra mile was greatly appreciated.

Author Contributions:

SH.HA. for his efforts in sample collection, primer design, laboratory work, and drafting the initial manuscript, I.F. Thoracic surgeon who played a pivotal role in obtaining patient samples, P.A. For his expertise in setting up the initial DNA extraction and gel electrophoresis procedures. SH.HO. For her assistance in setting up the real-time PCR assay, and CH.K. As the project designer, team leader, and supervisor who provided invaluable guidance and oversight throughout the entire project. She also served as the corresponding author of the article.

Declration of Interests:

The authors declare no competing interests.

Funding: This article financially supported by Ardabil University of Medical Sciences.

Zur Hausen H. Papillomaviruses in the causation of human cancers - a brief historical account. Virology. 2009;384(2):260-265.
Salman NA, Davies G, Majidy F, Shakir F, Akinrinade H, Perumal D, Ashrafi GH. Association of high risk human papillomavirus and breast cancer: a UK based study. Scientific reports. 2017 Feb 27;7(1):43591.
Sung H, Ferlay J, Siegel RL, et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin. 2021;71(3):209-249.
Shuen AY, Foulkes WD. Inherited mutations in breast cancer genes--risk and response. J Mammary Gland Biol Neoplasia. 2011;16(1):3-15.
Van Doorslaer K. Evolution of the papillomaviridae. Virology. 2013;445(1-2):11-20.
Zheng ZM, Baker CC. Papillomavirus genome structure, expression, and post-transcriptional regulation. Front Biosci. 2006;11:2286-2302.
de Villiers EM. Cross-roads in the classification of papillomaviruses. Virology. 2013;445(1-2):2-10.
Khodabandehlou N, Mostafaei S, Etemadi A, et al. Human papilloma virus and breast cancer: the role of inflammation and viral expressed proteins. BMC Cancer. 2019;19(1):61.
Blanco R, Carrillo-Beltrán D, Muñoz JP, Corvalán AH, Calaf GM, Aguayo F. Human papillomavirus in breast carcinogenesis: A passenger, a cofactor, or a causal agent?. Biology. 2021 Aug 20;10(8):804.
Piana AF, Sotgiu G, Muroni MR, Cossu-Rocca P, Castiglia P, De Miglio MR. HPV infection and triple-negative breast cancers: an Italian case-control study. Virology journal. 2014 Dec;11:1-5.
Choi YJ, Park JS. Clinical significance of human papilloma virus genotyping. J Gynecol Oncol. 2016;27(2):e21.
Bae JM, Kim EH. Human papillomavirus infection and risk of breast cancer: a meta-analysis of case-control studies. Infectious agents and cancer. 2016 Dec;11:1-8..
Association of breast cancer with human papillomavirus .... (2018). Scielo. Retrieved June 13, 2024, from https://www.scielo.br/j/clin/a/YrLQK9NTJSZ9ypM5XtpRw5z/?lang=en
Hedau, S., Kumar, U., Hussain, S. et al. Breast cancer and human papillomavirus infection: No evidence of HPV etiology of breast cancer in Indian women. BMC Cancer 11, 27 (2011). https://doi.org/10.1186/1471-2407-11-27
El-Sheikh N, Mousa NO, Tawfeik AM, Saleh AM, Elshikh I, Deyab M, Ragheb F, Moneer MM, Kawashti A, Osman A, Elrefaei M. Assessment of Human Papillomavirus Infection and Risk Factors in Egyptian Women With Breast Cancer. Breast Cancer (Auckl). 2021 Feb 25;15:1178223421996279. doi: 10.1177/1178223421996279. PMID: 33716506; PMCID: PMC7917427.
Hachana M, Ziadi S, Amara K, Toumi I, Korbi S, Trimeche M. No evidence of human papillomavirus DNA in breast carcinoma in Tunisian patients. The Breast. 2010 Dec 1;19(6):541-4.
Li J, Ding J, Zhai K. Detection of human papillomavirus DNA in patients with breast tumor in China. PLoS One. 2015 Aug 21;10(8):e0136050.
de Cremoux P, Thioux M, Lebigot I, Sigal-Zafrani B, Salmon R, Sastre-Garau X, Institut Curie Breast Group. No evidence of human papillomavirus DNA sequences in invasive breast carcinoma. Breast cancer research and treatment. 2008 May;109:55-8.
Khan NA, Castillo A, Koriyama C, Kijima Y, Umekita Y, Ohi Y, Higashi M, Sagara Y, Yoshinaka H, Tsuji T, Natsugoe S. Human papillomavirus detected in female breast carcinomas in Japan. British journal of cancer. 2008 Aug;99(3):408-14
Bakhtiyrizadeh S, Hosseini SY, Yaghobi R, Safaei A, Sarvari J. Almost complete lack of human cytomegalovirus and human papillomaviruses genome in benign and malignant breast lesions in Shiraz, Southwest of Iran. Asian Pacific journal of cancer prevention: APJCP. 2017;18(12):3319.
Oliveira ES, Ferreira MVP, Rahal P, Castelo Branco MB, Rabenhorst SHB. High Frequency of Epstein-Barr Virus and Absence of Papillomavirus in Breast Cancer Patients from Brazilian Northeast. Asian Pac J Cancer Prev. 2022 Jul 1;23(7):2351-2359. doi: 10.31557/APJCP.2022.23.7.2351. PMID: 35901341; PMCID: PMC9727371.
Mattox AK, D'Souza G, Khan Z, Allen H, Henson S, Seiwert TY, Koch W, Pardoll DM, Fakhry C. Comparison of next generation sequencing, droplet digital PCR, and quantitative real-time PCR for the earlier detection and quantification of HPV in HPV-positive oropharyngeal cancer. Oral oncology. 2022 May 1;128:105805.
Vesterberg O. A short history of electrophoretic methods. Electrophoresis. 1993;14(1):1243-9.
James, C. D., Morgan, I. M., & Bristol, M. L. The Relationship between Estrogen-Related Signaling and Human Papillomavirus Positive Cancers. Pathogens, 9(5), 403. https://doi.org/10.3390/pathogens905040.
Numerical II. The Human Papillomavirus Type 16 E6 and E7 Oncoproteins. CANCER RESEARCH. 2002 Dec 1;62:7075-82.
Đukić A, Lulić L, Thomas M, Skelin J, Bennett Saidu NE, Grce M, Banks L, Tomaić V. HPV oncoproteins and the ubiquitin proteasome system: a signature of malignancy?. Pathogens. 2020 Feb 18;9(2):133.
Williams J, Kostiuk M, Biron VL. Molecular detection methods in HPV-related cancers. Frontiers in Oncology. 2022 Apr 27;12:864820.
Lawson JS, Glenn WK, Salyakina D, Delprado W, Clay R, Antonsson A, Heng B, Miyauchi S, Tran DD, Ngan CC, Lutze-Mann L. Human papilloma viruses and breast cancer. Frontiers in oncology. 2015 Dec 16;5:277.
Weerakkody Y, Manning T, Lemos P, et al. Breast imaging-reporting and data system (BI-RADS). Reference article, Radiopaedia.org (Accessed on 16 May 2024) https://doi.org/10.53347/rID-10003
Dieffenbach CW, Lowe TM, Dveksler GS. General concepts for PCR primer design. PCR Methods Appl. 1993;3(3):S30-7.
Radstrom P, Knutsson R, Wolffs P, Lovenklev M, Lofstrom C. Pre-PCR processing: strategies to generate PCR-compatible samples. Mol Biotechnol. 2004;26(2):133-46.
Al-Soud WA, Radstrom P. Purification and characterization of PCR-inhibitory components in blood cells. J Clin Microbiol. 2001;39(2):485-93.
Ellison SL, English CA, Burns MJ, Keer JT. Routes for improving the reliability of low level DNA analysis using real-time PCR. BMC Biotechnol. 2006;6:33.
Schrader C, Schielke A, Ellerbroek L, Johne R. PCR inhibitors - occurrence, properties and removal. J Appl Microbiol. 2012;113(5):1014-26
Dieffenbach CW, Dveksler GS. PCR Primer: A Laboratory Manual. 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 2003.
Rychlik W. Selection of primers for polymerase chain reaction. Mol Biotechnol. 1995;3(2):129-34.
Tindall KR, Kunkel TA. Fidelity of DNA synthesis by the Thermus aquaticus DNA polymerase. Biochemistry. 1988;27(16):6008-13.
Polz MF, Cavanaugh CM. Bias in template-to-product ratios in multitemplate PCR. Appl Environ Microbiol. 1998;64(10):3724-30.
Cha RS, Thilly WG. Specificity, efficiency, and fidelity of PCR. PCR Methods Appl. 1993;3(3):S18-29.
Surzycki S. Basic techniques in molecular biology. Springer Science & Business Media; 2012 Dec 6.
Sambrook J, Russell DW. Molecular Cloning: A Laboratory Manual. 3rd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 2001.
Brody JR, Kern SE. Sodium boric acid: a Tris-free, cooler conductive medium for DNA electrophoresis. Biotechniques. 2004;36(2):214-6.
Smith CL. Separation and analysis of DNA by electrophoresis. Current Opinion in Biotechnology. 1991 Feb 1;2(1):86-91.
Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, et al. Current Protocols in Molecular Biology. New York: John Wiley & Sons; 2003.
Tan SC, Yiap BC. DNA, RNA, and protein extraction: the past and the present. J Biomed Biotechnol. 2009;2009:574398.
Maniatis T, Fritsch EF, Sambrook J. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1982.
née Gauci VJ, Noaman N, Coorssen JR. Gel-Staining Techniques–Dyeing to Know It All. eLS. 2016:1-0.
Landers JP. Handbook of Capillary and Microchip Electrophoresis and Associated Microtechniques. 3rd ed. Boca Raton, FL: CRC Press; 2007.
Https://www.thermofisher.com/de/de/home/life-science/cloning/cloning-learning-center/invitrogen-school-of-molecular-biology/na-electrophoresis-education/na-electrophoresis-troubleshooting.html.
Prabhu SD, Rai HS, Nayak R, Naik R, Jayasheelan S. Study of the Immunohistochemical Expression of p63 in Benign Lesions and Carcinoma of the Breast at a Tertiary Hospital in South India. Cureus. 2023 Nov 9;15(11):e48557. doi: 10.7759/cureus.48557. PMID: 38024052; PMCID: PMC10679958.
Khalilian M, Hosseini SM, Vahidi Emami H, Madadgar O. High Frequency of HPV Genotypes 16 and 18 Found in Breast Cancer Patients: Evidence for a More Comprehensive HPV Vaccination Program in Iran. JABS.2023; 13(2): 158-166.
Tan, PH., Bay, BH., Yip, G. et al. Immunohistochemical detection of Ki67 in breast cancer correlates with transcriptional regulation of genes related to apoptosis and cell death. Mod Pathol 18, 374–381 (2005). https://doi.org/10.1038/modpathol.3800254

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Investigation of human papillomavirus types in HER2/Neu breast cancer samples among women in Ardabil province

Status:

Version 1

Abstract

Background

Methods

Results

Conclusion

Introduction

Materials & Methods

Real-time PCR Analysis:

Results

Discussion

Conclusion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1