Insecticide resistance status and mechanisms in Aedes aegypti and Aedes albopictus from different dengue endemic regions of Panama

doi:10.21203/rs.3.rs-4682383/v1

Download PDF

Research Article

Insecticide resistance status and mechanisms in Aedes aegypti and Aedes albopictus from different dengue endemic regions of Panama

https://doi.org/10.21203/rs.3.rs-4682383/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Background

Dengue is a serious public health problem worldwide, including Panama. During the last years the number of dengue cases have increased, this may be due to the presence of mosquito populations resistant to insecticides. The aim of this study was to characterize the resistance status, its enzymatic mechanisms and Kdr mutations in wild populations of Aedes aegypti and Aedes albopictus.

Methods

Standard WHO bioassays were performed using insecticide-treated filter papers to determine resistance in populations Ae. aegypti and Ae. albopictus to pyrethroids insecticides, organophosphates, to the carbamate propoxur and to the organochlorine DDT. Biochemical assays were conducted to detect metabolic resistance mechanisms and real-time PCR was performed to determine the frequencies of the Kdr mutations Val1016IIe and F1534C.

Results

The strains Ae. aegypti El Coco showed confirmed resistance to deltamethrin (78.5% mortality) and lambda-cyhalothrin (81%), Aguadulce to deltamethrin (79.3%), David to deltamethrin (74.8%) and lambda-cyhalothrin (87.5%) and Puerto Armuelles to permethrin (83%). Aedes aegypti El Empalme showed confirmed resistance to pirimiphos-methyl (62.3% mortality), chlorpyrifos-methyl (55.5%) and propoxur (85.3%). All strains of Ae. albopictus showed possible resistance to PYs and five strains to DDT. Only Ae. albopictus Canto del Llano showed confirmed resistance to pirimiphos-methyl (70% mortality) and malathion (62%). Esterase activity was variable across sites with the most frequent expression of α-EST compared to β-EST in Ae. aegypti populations. In Ae. albopictus the expressed enzymes were β-EST and MFOs. The Kdr Val1016IIe mutation was detected in Ae. aegypti Aguadulce, El Coco and David.

Conclusion

The presence of a varied and generalized resistance, enzymatic mechanisms and the Val1016IIe mutation may be associated with the intensive use and possibly misuse of the different insecticides applied to control Aedes populations. These results highlight the need to develop a program for resistance management. Also, alternative approaches to mosquito control that do not involve insecticides should be explored.

Ae. aegypti

Ae. albopictus

insecticide

resistance

susceptibility

Kdr mutation

Dengue is a mosquito-borne disease that has the greatest epidemic potential in the world. The Ae. aegypti mosquito is the main vector of dengue in the Americas [1]. The Americas is one of the most affected regions [2], where dengue is considered one of the most important reemerging diseases [3]. The risk scenario of mosquito-borne diseases has changed dramatically in the last decades, due to the emergence and re-emergence of urban transmission cycles caused by Ae. aegypti and Ae. albopictus [4]. The current situation against dengue (DENV), Zika (ZIKV) and chikungunya (CHIKV) arboviruses transmitted by Ae. aegypti and Ae. albopictus is complex, because so far there is no vaccine with high effectiveness and no specific treatment, except the vaccine against yellow fever, therefore, mosquito vector control is the only solution to prevent these diseases. However, this remains a challenge, despite the existence of vector control programs that have been in place for several decades [5].

Historically, the main strategies used for the control of arbovirus vector mosquito populations, specifically Ae. aegypti [6]. relies heavily on the use of insecticides widely applied by vector control programs [7]. In recent years, resistance to the four major chemical groups of organochlorines (OC), organophosphates (OPs), carbamates (CA) and pyrethroids (PYs) insecticides has been detected in Ae. albopictus in the Americas, Africa and Asia [8]. Insecticide resistance in mosquitoes is caused by several mechanisms, with two in particular being the focus of most studies: metabolic resistance and target-site alterations modifications. Metabolic resistance involves large families of enzymes: cytochrome P450 monooxygenases (MFO), esterases (EST), glutathione S-transferases (GST) and carboxylesterases (CCE), moreover, increased activity levels of insecticide-degrading enzymes have been observed in resistant populations [9, 10].

Studies have suggested that mutations in the voltage-dependent sodium channel (NaV), the target site for PYs and OC, may play a role in PYs resistance [11]. To date, at least 10 NaV detected mutations associated with resistance in Ae. aegypti. Four of these, S989P, I1011M, V1016G and F1534C, have been functionally confirmed to confer resistance to PYs insecticides [10, 12]. The most common alleles in the Americas are 410L + 1016I + 1534C, 410L + 1534C and 1534C [13]. The mutations G923W, L982W, I1011M and V1016G were found in permethrin- and DDT-resistant Ae. aegypti populations from Asia and Brazil [14], while substitutions I1011V and V1016I were found in Ae. aegypti populations from Latin America [15]. In addition, the F1534C was discovered recently in Brazil [16], Venezuela [17] and Colombia [18]. In the Americas, the Val1016Ile mutation was found to coexist with F1534C in Venezuela [17] and Brazil [19].

In Panama, the main tool used by the vector control program against mosquito populations is the use of chemical insecticides. Aedes populations have been controlled since the beginning with the organochlorine DDT, later with OPs temephos, fenthion, malathion and fenitrothion, and more recently, the PYs insecticides deltamethrin and cyfluthrin [20, 21]. Aedes aegypti has shown resistance to the insecticides OPs temephos, pirimiphos-methyl and chlorpyrifos-methyl, the PYs insecticides deltamethrin, cyfluthrin and cypermethrin and to the organochlorine DDT. In more recent studies in bioassays with adult mosquitoes, resistance was recorded in two populations of Ae. aegypti to pirimiphos-methyl, fenitrothion, malathion and propoxur. Aedes populations were completely susceptible to pyrethroids [22–24]. Through biochemical assays, EST, MFOs and GST were observed as mechanisms of resistance to OPs insecticides [23, 24]. Regarding Kdr (Knockdown resistance) mutations, the mutations Ile1011Met and Val1016Gly were recently detected in a population of Ae. aegypti [25].

Despite the continuous use of insecticides against Aedes populations, few studies have been conducted on the resistance status in Ae. aegypti and Ae. albopictus populations in the different regions of the country, especially on the enzymatic mechanisms of resistance and Kdr mutations. The National Aedes Control Program (PNCA) of the Ministry of Health (MINSA) has continuously expressed the need to conduct studies to determine the resistance status in Aedes populations. The objective of this study was to evaluate the status of insecticide resistance, its enzymatic mechanisms and Kdr mutations in wild Ae. aegypti and Ae. albopictus populations from Panama.

Study sites

The PNCA raised the need to determine the resistance status of applied and alternative insecticides against Ae. aegypti and Ae. albopictus in sites of epidemiological importance considering the number of reported cases of dengue, and entomologically, due to the high infestation rates recorded and the frequent applications of insecticides. In conjunction with the PNCA, a total of 16 communities (urban and semi-urban) were selected, located in 16 municipalities of Panama. Table 1 shows the geographic coordinates of the selected sites and epidemiological data on reported dengue cases and Fig. 1 presents the map with the geographical location of the studied sites and mosquito species collected.

Table 1

Geographical and epidemiological data of dengue cases reported in the sites where *Ae. aegypti* and *Ae. albopictus* strains were collected to evaluate their insecticide resistance status. Panama, 2016–2022.
Province Comarca*	Municipality	Locality	Coordinates	Altitude (Meter)	DENV Accumulated Cases 2016 to 2020**
Bocas del Toro	Changuinola	El Empalme	9⁰24'42.53'' N	15 m	1,936
Bocas del Toro	Changuinola	El Empalme	82⁰31'16.88'' O	15 m	1,936
Coclé	Aguadulce	Aguadulce	8⁰14'01.40'' N	22 m	1,660
	Aguadulce	Aguadulce	80⁰32'11.87'' O	22 m
	Nata	Natá	8⁰20'14.08'' N	14 m
	Nata	Natá	80⁰31'06.02'' O	14 m
Colón	Colón	Sabanitas	9⁰21'04.14'' N	8 m	2,743
Colón	Colón	Sabanitas	79⁰47'58.34'' O	8 m	2,743
Chiriquí	David	David	8⁰22'59.76'' N	20 m	562
	David	David	82⁰25'34.37'' O	20 m
	Barú	Puerto Armuelles	8⁰15'37.91'' N	15 m
	Barú	Puerto Armuelles	82⁰52'03.38'' O	15 m
Darién	Chepigana	La Palma	8⁰24'19.16'' N	42 m	572
	Chepigana	La Palma	78⁰08'24.09'' O	42 m
	Pinogana	Meteti	8⁰30'19.16'' N	48 m
	Pinogana	Meteti	77⁰58'15.68'' O	48 m
Herrera	Chitre	Chitre	7⁰58'04.71'' N	34 m	1,172
Herrera	Chitre	Chitre	80⁰26'11.01'' O	34 m	1,172
Los Santos	Las Tablas	Las Tablas	7⁰45'57.98'' N	44 m	837
Los Santos	Las Tablas	Las Tablas	80⁰16'35.04'' O	44 m	837
Guna Yala *	Guna Yala	Ustupo	9⁰07'50.31'' N	5 m	300
Guna Yala *	Guna Yala	Ustupo	77⁰55'34.59'' O	5 m	300
Ngäbe Buglé *	San Félix	San Félix	8⁰17'34.73'' N	112 m	13
Ngäbe Buglé *	San Félix	San Félix	81⁰51'56.49'' O	112 m	13
Panamá	Panamá	24 de Diciembre	9⁰05'56.63'' N	23 m	10,572
	Panamá	24 de Diciembre	79⁰21'53.84'' O	23 m
	San Miguelito	San Isidro	9⁰04'02.71'' N	98 m
	San Miguelito	San Isidro	79⁰30'29.87'' O	98 m
Panama Oeste	La Chorrera	El Coco	8⁰52'13.74'' N	82 M	2,319
Panama Oeste	La Chorrera	El Coco	79⁰47'56.59'' O	82 M	2,319
Veraguas	Santiago	Canto del Llano	8⁰06'42.63'' N	94 M	570
Veraguas	Santiago	Canto del Llano	80⁰57'46.93'' O	94 M	570
Source: MINSA. *Comarca: The term "comarca" refers to the political division or territory assigned to a defined indigenous population within Panama.

Collection and mosquito rearing

Collections of Ae. aegypti and Ae. albopictus in immature stages (larvae and pupae) were carried out in the intra and peridomicile in different ecological environments located in urban and semi-urban areas. All biological material collected was placed in special containers previously coded and transported to the Department of Medical Entomology (DME) of the Instituto Conmemorativo Gorgas de Estudios de la Salud (ICGES) for identification to species level using taxonomic keys of mosquito larvae and pupae [26]. The biological material of adult females produced from larvae and pupae of Ae. aegypti and Ae. albopictus collected in the field was called the F₀ generation. The first generation (F₁) of the different strains of Ae. aegypti and Ae. albopictus was generated from the postures produced from the F₀ and used to raise colonies in laboratory conditions, with average temperature of 28.5°C to 30°C and relative humidity of 70–80% and with a photoperiod of 12:12 (day/night).

Susceptibility bioassays with adult mosquitoes

Resistance profiling of the different strains of Ae. aegypti and Ae. albopictus was performed using bioassays with papers impregnated with the organochlorine DDT (4%), the PYs deltamethrin (0.03%), lambda-cyhalothrin (0.03%), cyfluthrin (0. 15%) and permethrin (0.25%), the OPs fenitrothion (1%), malathion (5%), chlorpyriphos-methyl (0.4%) and pirimiphos-methyl (0.25%) and the CA propoxur (0.1%) with the diagnostic doses and exposure times established in the WHO standardized protocol [27]. Each test with the insecticides evaluated had three replicates and their respective controls. After the exposure period, the mosquitoes were transferred to the recovery chambers and a cotton moistened in 10% sucrose solution was placed as food during the recovery period. The percent mortality in the exposure and control tubes was recorded at 24 hours.

Biochemical assays

Thirty individual larvae from each field colony were assayed for α and β-EST [28], MFOs [29], GST [30] and AchE [31]. Each fourth-instar larvae were homogenized in 300 µL of 0.01M sodium phosphate buffer (pH 7.5) and 20 µL of the crude homogenate were transferred separately to a microtiter plate for each enzymatic assay, and two replicates of 10 µL were added to another plate for protein assay. Absorbance levels were measured spectrophotometrically on a TECAN Sunrise Basic Microplate Reader (TECAN Austria GmbH 5082 Grodig, Austria), at wavelengths indicated for each enzyme, and the mean absorbance per larvae calculated based on data for the two replicate wells.

Detection of Val1016Ile and F1534C sodium channel mutations

The mosquito strains were exposed to deltamethrin and 30 surviving individuals F1 from each strain were taken to detect both sodium channel gene mutation at positions 1016 and 1534 from genomic DNA by allele-specific PCR (AS-PCR). Primer sequences for both mutations are shown in Table 2 [15, 32]. The total DNA from 30 Ae. aegypti mosquitoes was extracted using the Livak method [33, 34].

Table 2

Sequence of primers for detection of *Kdr* mutations (Val1016Ile and F1534C) in *Ae. aegypti* populations. This sequence primers is associated with resistance to pyrethroid insecticides.
Phenotype	Primers Name	Primer Sequence (5’ -> 3’)	bp
V10I6I^a	V1016f	[GCGGGCAGGGCGGCGGGGGCGGGGCC]ACAAATTGTTTCCCACCCGCACCGG	51
	I1016f	[GCGGGC]ACAAATTGTTTCCCACCCGCACTGA	31
	Iso1011r^c	TGATGAACCSGAATTGGACAAAAGC	25
F1534C^b	AaEx31P	5'TCGCGGGAGGTAAGTTATTG3'	19
	AaEx31Q	5'GTTGATGTGCGATGGAAATG3'	20
	AaEx31wt	5'CCTCTACTTTGTGTTCTTCATCATCTT3	27
	AAEX31MUT	5´GCGTGAACGACCCGC3	18
Primers feature base pair mismatches introduced at the third base from 3’ end to increase allele specificity (italics); the diagnostic differential nucleotide is in bold, underlined. For Val1016 to Ile (Iso) the diagnostic nucleotide is the first in the codon (GTA to ATA) while for F1534C is the second nucleotide of the codon (TTC or TTT to TGA or TGC).
^aSaavedra-Rodriguez et al. [15]
^bYanola et al. [34]
^cPinto et al. [35]

Table 2

Sequence of primers for detection of *Kdr* mutations (V1016I and F1534C) in *Ae. aegypti* populations. This sequence primers is associated with resistance to pyrethroid insecticides.
Phenotype	Primers Name	Primer Sequence (5’ -> 3’)	bp
V10I6I^a	V1016f	[GCGGGCAGGGCGGCGGGGGCGGGGCC]ACAAATTGTTTCCCACCCGCACCGG	51
	I1016f	[GCGGGC]ACAAATTGTTTCCCACCCGCACTGA	31
	Iso1011r^c	TGATGAACCSGAATTGGACAAAAGC	25
F1534C^b	AaEx31P	5'TCGCGGGAGGTAAGTTATTG3'	19
	AaEx31Q	5'GTTGATGTGCGATGGAAATG3'	20
	AaEx31wt	5'CCTCTACTTTGTGTTCTTCATCATCTT3	27
	AAEX31MUT	5´GCGTGAACGACCCGC3	18
Primers feature base pair mismatches introduced at the third base from 3’ end to increase allele specificity (italics); the diagnostic differential nucleotide is in bold, underlined. For Val1016 to Ile (Iso) the diagnostic nucleotide is the first in the codon (GTA to ATA) while for F1534C is the second nucleotide of the codon (TTC or TTT to TGA or TGC).
^aSaavedra-Rodriguez et al. [15]
^bYanola et al. [34]
^cPinto et al. [35]

The amplification of the 1016 site was performed following the protocol described by Saavedra-Rodriguez et al. [15], with the exception of using an improved common reverse primer from Pinto et al. [35]. Melting curve analyses for the F1534C were as eported by Yanola et al. [36]. The concentrations of the PCR reagents were calculated for a volume of 25 µL. Each reaction contained a final concentration of 5X Green Gotaq Flexi Buffer (Promega), 2.5 mM of MgCl2, 0.4 mM of each dNTPs, 0.5 µM of each primer, 2.5 U of GoTaq G2 Flexi DNA polymerase (Promega) and 2 µL of genomic DNA previously extracted from a mosquito as a mold and subjected to a thermocycler under the following conditions 95°C for 5 min, followed by 35 cycles of 95°C for 30 sec, 63°C for 1 min and 72°C for 30 sec and its final extension step 72°C for 10 min. The amplification products were observed in an agarose gel, LMP, Analytical Grade (Promega) at 2% low melting point due to the small difference between the amplicons.

The PCR reaction for the detection of the F1534C allele was calculated for a volume of 25 µL following the method described by Harris et al. [32] the final concentrations of the reagents contained 5X Gotaq Flexi Green PCR buffer (Promega), 2.5 mM of MgCl2, 0.4 mM of each dNTPs, 0.5 µM of each primer, 2.5 U of GoTaq G2 Flexi DNA polymerase (Promega) and 2 µL of genomic DNA previously extracted from a mosquito as a template and subjected to a thermocycler (T-100, Bio-Rad) under the following conditions 95°C for 5 min followed by 35 cycles of 94°C for 30 sec, 63°C for 30 sec and 72°C for 30 sec, and a final extension step of 72°C for 10 min. The PCR products were visualized on an agarose gel, LE, Analytical Grade (Promega) at 2%.

Statistical analysis

Mortality rates recorded during bioassays were analyzed according to the WHO criteria. The populations of Aedes were classified as “confirmed resistance” if less than 90% mortality was observed, as “possible resistance” if mortality rates were between 90% and 98% and “susceptible” for more than a 98% mortality rate [27]. If the control mortality is ≥ 5% and < 20%, the mortality should be corrected by Abbott's formula [37]. In biochemical tests, total protein was measured for each mosquito using the method of Bradford [38]. Enzyme activity was classified as "unaltered" between 0–15%, "incipient altered" between 15–50% and "altered" between 50–100% [39]. Data for each biochemical assay were evaluated via analysis of variance (ANOVA). Differences were considered significant at p < 0.05. Tukey's test was conducted after significant differences had been identified by ANOVA to establish which means differed from reference strains. The genotype frequencies were calculated by dividing the number of individuals with a given genotype (position of the bands in agarose gel electrophoresis) by the total number of analyzed mosquitoes as follows: Fg = Quantity AA/N (%). The Chi-square test (X²) was used to determine the association between V1016I and F1534C sodium channel mutations and the resistance phenotype. This statistical test was carried out using EPIDAT version 3.1. AA: a. homozygous wild genotype frequency (V1016/V1016 or F1534/F1534), b. homozygous mutant genotype frequency (I1016/I1016 or 1534C/1534C), c. heterozygote genotype frequency, (V1016/I1016 or F1534/C1534).

Susceptibility bioassays with adult mosquitoes

Considering the resistance threshold according to the WHO protocol, it was found that a total of 12 strains of Ae. aegypti presented variable resistance to the insecticides PY and two to DDT. In bioassays, strains Ae. aegypti 24 Diciembre with 60.2% and San Isidro with 75.7% mortality showed confirmed resistance to DDT, Ae. aegypti El Coco to deltamethrin (78.5%) and lambda-cyhalothrin (81%), Ae. aegypti Aguadulce to deltamethrin (79.3%) and possible resistance to lambda-cyhalothrin (95.3%), Ae. aegypti David to deltamethrin (74.8%) and lambda-cyhalothrin (87.5%) and Ae. aegypti Puerto Armuelles to permethrin (83%). The rest of the strains had possible resistance to at least one insecticide. Aedes aegypti La Palma and Ae. aegypti Ustupo strains showed no resistance to any insecticide. Figure 2 show the resistance status of the different Ae. aegypti populations to PYs insecticides and the organochlorine DDT.

Bioassays with OPs insecticides showed a higher number of Ae. aegypti strains with possible resistance, only Ae. aegypti El Empalme showed confirmed resistance to pirimiphos-methyl (62.3%), chlorpyrifos-methyl (55.5%) and propoxur (85.3%). Aedes aegypti strains 24 Diciembre and Ustupo failed to register any resistance to OPs and CA insecticides. Figure 3 show the resistance status of the different Ae. aegypti populations to OPs insecticides and CA propoxur.

Aedes albopictus was collected in 13 urbans communities and semi-urbans; only nine strains of Ae. albopictus showed possible resistance to the PYs insecticides evaluated, while the strains of Ae. albopictus Sabanitas, Canto del Llano, San Félix, Las Tablas and David showed possible resistance to DDT. It should be noted that Ae. albopictus Sabanitas showed possible resistance to all the PYs evaluated and to DDT; resistance to DDT may be due to a possible cross-resistance with deltamethrin. Figure 4 show the resistance status of the different populations of Ae. albopictus to PYs insecticides and to the organochlorine DDT. With OPs insecticides, 13 strains of Ae. albopictus showed possible resistance, only Ae. albopictus Canto del Llano showed confirmed resistance to pirimiphos-methyl (70%) and malathion (62%), while Ae. albopictus Sabanitas, San Félix and David showed possible resistance to propoxur. Figure 5 shows the resistance status of the different Ae. albopictus populations to OPs insecticides and CA propoxur. The percentages of mortality registered in the controls in the field strains of Ae. aegypti and Ae. albopictus was less than 4%.

Biochemical assays

α and β Esterases

Esterase activity was variable across sites with the most frequent detection of α-EST compared to β-EST in Ae. aegypti populations. The strains Ae. aegypti San Isidro (89.3%), Ae. aegypti El Coco (91.6%), Ae. aegypti Aguadulce (92.8%), Ae. aegypti David (91.1%), Puerto Armuelles (88.8%) and Ae. aegypti El Empalme (55.1%) showed altered activity level of α-EST. While, altered activity level of β-EST was only observed in the Ae. aegypti Puerto Armuelles (93.0%). The strains and Ae. aegypti San Isidro (45%), Ae. aegypti El Empalme (41%) and Ae. aegypti La Palma (49.6%) showed incipient activity level of β-EST (Fig. 6). Aedes albopictus, only showed altered activity level of α-EST in Ae. albopictus San Isidro (51.6%), Ae. albopictus Aguadulce (55.2%) and Ae. albopictus Canto del Llano (77.6%). The strains Ae. albopictus Meteti (26.4%) and Ae. albopictus Sabanitas (20%) showed incipient activity level of α-EST. Only the strain Ae. albopictus Canto del Llano (67%) showed altered activity levels of β-EST (Fig. 7). Overall, Ae. aegypti and Ae. albopictus populations showed a higher degree of both α-EST and β-EST activity compared to the susceptible Rock strain, suggesting the presence of this OPs insecticide resistance mechanism.

Mixed function oxidases

Determination of MFOs activity is an important factor in addressing metabolic resistance studies. The Ae. aegypti Sabanitas (46.3%), Ae. aegypti strains Chitré (44.7%) and Ae. aegypti Las Tablas (33.2%) was the only strain that showed incipient activity level of MFO (Fig. 6). Aedes albopictus El Coco (46.7%), Ae. albopictus Chitre (45.7%) and Ae. albopictus Sabanitas (20%) showed incipient activity level of MFOs. (Fig. 7).

Glutathione-S-transferase

Altered GST activity was only detected in Ae. aegypti 24 Diciembre (76.6%) and San Isidro (85.6%), this activity may be associated with the possible resistance recorded in this mosquito strains to DDT. This possible resistance to DDT may be due to the presence of cross-resistance with PYs insecticides (Fig. 6). No GST enzymatic activity was detected in the Ae. albopictus strains (Fig. 7).

Acetylcholinesterase

Acetylcholinesterase activity was not detected in any of the Ae. aegypti strains (Fig. 6). Incipient activity level of AchE was recorded only in Ae. albopictus Sabanitas of 26.4% (Fig. 7).

Through ANOVA, significant differences were established in the levels of enzymatic activity of α- and β-EST, MFOs and GST, with p˂0.001 in the Ae. aegypti and Ae. albopictus. Using the Tukey test, significant differences were also shown in the enzyme levels between strains of Ae. aegypti and Ae. Albopictus with p˂0.001. Alpha esterase showed significant differences between most strains, except for the α-EST that did not show significant differences between the Ae. aegypti El Coco and Aguadulce, between Ae. aegypti El Coco and David, and between Ae. aegypti San Isidro and David.

Detection of Val1016Ile and F1534C sodium channel mutations

A total of 62 mosquitoes corresponding to Ae. aegypti Aguadulce, El Coco and David were examined for detection and identification of Val1016Ile and F1534C sodium channel mutations. We detected the Val1016Ile mutation in the VGSC gene. The F1534C mutation was not detected. In general, the presence of the kdr mutation was observed in the three populations evaluated, and the results showed that the total frequency was significantly higher in the resistant population Ae. aegypti El Coco with 94.4%, a mean of 63.3%, median of 59.1% and range of 36.4% − 94.4% for the three populations (X^{2 − test}, P < 0.05; Table 3). The odds ratio for the Val1016Ile mutation ranged from 0.8 to 20.8 in resistant mosquitoes, indicating the association between pyrethroid phenotypic resistance and the kdr mutation (Table 3). The frequency of the homozygous wild genotype (V/V) was significant, a higher frequency was observed in Ae. aegypti David (Fg = 47.4%), the homozygous mutant genotype (I/I) was significant with a higher frequency in Ae. aegypti Aguadulce (Fg = 54.6) and the heterozygous genotype (V/I) was also significant, showing a higher frequency Ae. aegypti El Coco (Fg = 42.9%) (Table 4). All three genotypes at position 1016 were represented. This study makes the first records of the Val1016Ile mutation in these studied sites.

Table 3

*Kdr* mutation frequency relationship to pyrethroid resistance in different *Aedes aegypti* populations.
Ae. aegypti populations	Phenotype	Sample Size	Allele Frequency %		Odds ratio (95% CI)
Ae. aegypti populations	Phenotype	Sample Size	Wildtype	Val1016Ile	Val1016Ile
David	R	22	14 (63.6)	8 (36.4)	0.8 (0.2–2.9)^NS
Aguadulce	R	22	9 (40.9)	13 (59.1)	NA
El Coco	R	18	1 (5.6)	17 (94.4)	20.8 (3.3–411.9)^***
*** p˂0.001 NS: No Significance NA: Not Applicable

Table 4

Genotyping for 1016 result
Ae. aegypti Strains	N	Genotype frequency (%)			X²	df	p-value
		1016 (V/V)	1016 (V/I)	1016 (I/I)
David	19	47.4%	31.6%	21.1%	12.3	4	0.015
Aguadulce	22	13.6%	54.6%	31.8%
El Coco	21	4.8%	52.4%	42.9%
N: Sample size. Genotype frequency: Wild Homozygous (V/V), Heterozygous (V/I) and Mutant Homozygous (I/I). Statistical values: X²: Chi-square, df: degree of freedom, p-value: significant differences (p < 0.05).

Susceptibility bioassays

The heterogeneity of insecticide resistance patterns shown by Aedes populations suggests that several mechanisms may be contributing to the development of resistance. Despite the use of PYs insecticides for the past 25 years, little work has been done to determine the state of the susceptibility in Aedes populations in the main regions of dengue transmission in Panama. The resistant detected to deltamethrin and lambada-cyhalothrin in Ae. aegypti El Coco, David and Aguadulce, respectively, represents a technical problem for the PNCA. Previous studies detected possible resistance in Ae. aegypti Puerto Armuelles to deltamethrin, lambda-cyhalothrin and cyfluthrin, Ae. aegypti David to deltamethrin and lambda-cyhalothrin, Ae. aegypti Aguadulce and El Empalme to lambda-cyhalothrin and cyfluthrin, Ae. aegypti 24 Diciembre to cypermethrin, cyfluthrin and chlorpyriphos-methyl and DDT [22, 24]. The resistance of Ae. aegypti to PY, has been reported in several countries in South America, Central America and North America; some African countries, several in Asia and Oceania [10]. In the Americas, deltamethrin and permethrin resistance has been reported in Ae. aegypti in Mexico [40], in El Salvador to deltamethrin and cypermethrin [41], in Costa Rica to cypermethrin [42], in Colombia to lambda-cyhalothrin and permethrin [43], in Cuba to lambda-cyhalothrin and deltamethrin [44, 45] and in Brazil to deltamethrin is found in almost all states [46, 47]. Although the PNCA only uses deltamethrin and cyfluthrin, the recorded possible resistance to lambda-cyhalothrin and permethrin may be due to the presence of cross-resistance. The resistance detected to DDT in the strains of Ae. aegypti 24 Diciembre (60.2% mortality) and Ae. aegypti San Isidro (75.7% mortality), may also be due to cross resistance with deltamethrin. The manifestation of cross-resistance conferred to pyrethroids limits the number of suitable alternatives for vector control [48]. Previous work has detected cross-resistance of deltamethrin with permethrin in Ae. aegypti [49, 50], as well as of lambda-cyhalothrin with permethrin [51]. Resistance may also be due to the intensified use of domestic commercial insecticides, those used by pest control companies and public health activities during each new outbreak [52–54].

Aedes albopictus Canto del Llano only registered resistant to pirimiphos-methyl (70% mortality) and malathion (62% mortality). Studies conducted in Mexico with Ae. albopictus showed similar results with resistance to chlorpyriphos-methyl, malathion, permethrin and deltamethrin [40]. On the other hand, in a study conducted in Cuba, resistance to temephos and deltamethrin was detected in Ae. albopictus Mulgoba, while in Ae. albopictus Plaza was observed only resistance to lambda-cyhalothrin [55]. A separate study indicated that Ae. albopictus rapidly generated high resistance to the most used insecticides for adult mosquitoes (deltamethrin and permethrin) and to the larvicide temephos [56]. A study carried out in Pakistan indicated that the resistance detected in Ae. albopictus could be related to its presence in crop areas and its indirect exposure to different agrochemicals [57]. It can be assumed that resistance to malathion may be due to cross-resistance with pirimiphos-methyl, since this insecticide is frequently used by pest control companies. Other study showed in Ae. albopictus in Malaysia cross-resistance between four organophosphates, as well as cross-resistance between one organochlorine and two organophosphates [58]. On the other hand, the susceptibility or resistance status of temephos against Ae. albopictus may vary due to significant differences in the weekly levels of EST, MFOs, GST, and insensitive AchE [59]. In Panama, little is known about the susceptibility of Ae. albopictus to insecticides and the influence of coexistence with Ae. aegypti.

In general, all Ae. aegypti and Ae. albopictus populations showed varied behavior of resistance status to the insecticides evaluated, resistance levels varied among study sites and with different insecticides. This may be due to differences in insecticide use at the local level. This may suggest that variable susceptibility behavior may be because the underlying mechanisms causing resistant phenotypes in these populations may not be shared [60]. Therefore, the resistance phenotype can be generated by a large number of different mechanisms that result in mosquito populations that differ in the spectrum and level of resistance to different insecticides. Furthermore, resistance can vary temporally and spatially between insecticides and mosquito species within and outside the country [61]. Consequently, the mechanisms of resistance need to be further investigated. Likewise, enzymatic mechanisms present at the study sites need to be considered [62].

Biochemical assays

Esterases

Evaluation of metabolic resistance was achieved with biochemical tests quantifying the activity of the main classes of detoxifying enzymes. The esterases are strongly associated with resistance in mosquitoes to OPs, CA and to a lesser extent PYs insecticides [62, 63–65]. The increased activity of esterases in Ae. aegypti and Ae. albopictus populations especially α-EST suggests an important role of this enzyme in the metabolic mechanisms conferring resistance to the insecticides evaluated. In Ae. aegypti, altered activity levels of α-EST were detected in six populations (Ae. aegypti San Isidro, El Coco, Aguadulce, David, Puerto Armuelles and El Empalme), in three strains it was associated with confirmed resistant to deltamethrin and lambda-cyhalothrin (Ae. aegypti Aguadulce, El Coco and David). The altered activity levels of α-EST may also be due to the resistance detected to DDT in the strain Ae. aegypti San Isidro, as a result of cross resistance with deltamethrin. In addition, this altered activity level of α-EST may probably be involved in the possible resistance detected mainly to PYs in the studied localities, this needs to be confirmed through enzymatic studies. Only Ae. albopictus San Isidro (51.6%), Aguadulce (55.2%) and Canto del Llano (77.6%) recorded altered activity level of α-EST. Altered activity levels of β-EST were detected only in Ae. aegypti Puerto Armuelles (93%) and Ae. aegypti San Isidro (45%), El Empalme (41%) and La Palma (49.6%) recorded incipient altered activity level and Ae. albopictus Canto del Llano recorded altered activity level of β-EST. In studies conducted in Colombia with Ae. aegypti, incipient activity of α-EST was detected where resistance profiles were highly correlated with permethrin and lambda-cyhalothrin followed by deltamethrin and cyfluthrin, showing susceptibility to the OPs tested [66], studies to date have reported overexpression of β-EST in OPs and PYs resistant populations [67–69]. In more recent study, highly altered activity of α-EST and β-EST was detected in one population and incipient activity in three Ae. aegypti populations [43]. In a study conducted with Ae. aegypti, EST and GST were found to be among the most strongly involved metabolic resistance mechanisms throughout Brazil. They were also closely corelated with resistance to OPs and PYs in Brazilian samples [70].

Mixed function oxidases

In this study, Ae. aegypti Sabanitas (46.3%), Chitre (44.7%) and Las Tablas (33.2%) showed incipient activity level of MFOs, also Ae. albopictus El Coco (46.7%) and Chitre (45.7%) showed incipient activity level. These levels of incipient activity of MFOs may be associated with the possible resistance detected to PYs. It can be said from the results obtained in this study that metabolic mechanisms are playing an important and potential role in the development of resistance in Ae. aegypti and Ae. albopictus populations and, among these mechanisms, MFOs. Mixed function oxidases are often implicated in resistance to PYs and, to a lesser extent, to OPs insecticides [30, 43]. On the other hand, MFOs have been described as important in the detection of resistance to OPs insecticides in Latin American samples [30, 71]. Most studies conducted with Ae. aegypti from different regions of Colombia have detected altered activity mainly of MFOs and EST, associating this activity with resistance to PYs [43]. In other countries, alterations of α-EST, β-EST and MFOs have been reported in Ae. aegypti resistant to organophosphates, carbamates and pyrethroids [72–74]. In a study conducted in Brazil, changes in MFO activity were less prominent, with only about 30% and less than 20% of adult and larval samples, respectively, exhibiting changes in MFO activity [70]. This heterogeneity of resistance patterns within the pyrethroid class suggests that diverse mechanisms are contributing to these phenotypes.

Glutathione S-transferase

This enzyme system is generally involved in insect resistance to OPs insecticides and provides the most important form of metabolic resistance to DDT through dehydrochlorination to DDE and pyrethroid resistance [75, 76]. In this study, the DDT confirmed resistance detected in the Ae. aegypti 24 Diciembre (60.2% mortality) and San Isidro (75.7% mortality), can be induced by cross resistance with PYs insecticides, this resistance may be associated with the alteration of the level of GST altered activity detected in strains Ae. aegypti 24 de Diciembre (76.6%) and San Isidro (85.6%), respectively. On the other hand, the low levels of GST activity detected in Ae. aegypti and Ae. albopictus, can be interpreted as an initial enzymatic activity that should be followed up in future studies to determine its involvement in the development of resistance to OC and/or PYs insecticides. In Colombia, the GST-based mechanism was associated with DDT resistance in Ae. aegypti [66] and it was suggested that it may also play a role in resistance to PYs [66, 77]. The activity of α-EST and GST are important mechanisms in PYs resistance in Ae. aegypti [78], on the other hand, GST activity is associated with resistance to permethrin and deltamethrin [60]. The detection of altered ESTs and GST activity seen in our study suggests the presence of multiple resistance mechanisms involved in Ae. aegypti populations. Although DDT was used from 1962 until almost the end of the 1980s for malaria eradication, its use was stopped in 1988 [20] Few studies have shown whether the DDT-resistant phenotype may still be present in Ae. aegypti [79]. Furthermore, DDT and pyrethroids share the same mode of action on voltage-dependent sodium channels and the observed resistance may be due to the extensive use of pyrethroids in pest control and public health activities. There is the possibility of the occurrence of cross-resistance between PYs and DDT [53].

Acetylcholinesterase

Structural changes at this site have resulted in the development of resistance in many insect vectors [80]. Mutations in the AchE enzyme can prevent OPs binding to the active sites, thus decreasing or eliminating the efficacy of these insecticides [81]. In this study, in the 13 strains of Ae. aegypti evaluated by biochemical tests, no AchE activity was detected. The Ae. albopictus Sabanitas population was the only one that showed differences in medians with statistical significance compared to the Ae. aegypti Rock strain (p < 0.05), with record of incipient AchE activity (> 15% and < 50%). This suggests that the target site is still sensitive and that this enzyme does not show so far that it represents an important enzymatic mechanism of resistance to OPs and CA insecticides, however, further studies are needed to confirm this hypothesis. In a previous study with Ae. aegypti 24 Diciembre, no altered AchE activity was detected [24], confirming with this study a similar enzymatic behavior in this mosquito strain. In studies conducted in Brazil, similar values of AchE (> 15% and < 50%) were observed in three populations of Ae. aegypti, only Ae. aegypti Mossoró strain presenting resistance to OPs temephos, which was associated with altered AchE activity [82]. In comparison, with another work with Ae. aegypti Rio, no altered AchE activity was detected [83]. In a similar study, very high AchE activity was found in all Ae. aegypti field populations and it was suggested that this represented another potential mechanism for resistance to OPs insecticides [84]. In Bangladesh, two Ae. aegypti populations were detected with elevated levels of AchE that was associated with malathion resistance [60]. In general, there are few studies on Aedes populations where altered AchE activity and its association as a mechanism of insecticide resistance has been detected in Aedes populations. Considering that this study represents the first report of the profile of the enzymes associated with insecticide resistance mechanisms in Ae. aegypti and Ae. albopictus populations, it is necessary that more studies like this are carried out in the future.

Genotyping of Kdr mutations

In this study we report for the first time the detection of the Val1016Ile mutation in three strains of Ae. aegypti (El Coco, Aguadulce and David) and provide strong evidence that this mutation may be contributing to the PYs resistance deltamethrin and lambda-cyhalothrin. In the only previous study conducted on the Kdr gene, the Val1016Gly mutation was detected in an Ae. aegypti population from central Panama [25]. These results show a high frequency of homozygous mutant (Ile/Ile) genotype in Panamanian Ae. aegypti population from Aguadulce and El Coco. This finding is consistent with those reported by other studies that obtained similar results in Caribbean Ae. aegypti populations [32]. The intensive use of insecticides exerts a strong selection pressure on mosquitoes, favoring the increase of resistance alleles in natural populations. For example, in Mexico, after 6 to 8 years of excessive permethrin use, a significant increase in a mutation at position AaNaV 1016 was observed, reducing the efficacy of chemical control over time [85]. There are two mutations described in Latin America, the Val1016Gly and Val1016Ile allele, respectively [15, 32, 86] and in Southeast Asia [87]. The Val1016IIe mutation associated with PYs resistance in Ae. aegypti, have been repeatedly detected in resistant populations in the Americas. The Val1016Ile allele has been detected in Ae. aegypti populations in Mexico associated with resistance to permethrin and deltamethrin [88], in Brazil to PYs insecticides [86], in Cuba to deltamethrin [89], in Peru to PYs [34] and in Colombia it was associated with resistance to lambda-cyhalothrin [90]. It is important to characterize these mutations before new adaptive alleles can be selected to lessen the negative effects of the Kdr gene [91]. It is possible that there are regional differences in Ae. aegypti collection sites related to Kdr mutations [92], however, this hypothesis requires further research work. In this study, it was not possible to test all populations of Ae. aegypti and Ae. albopictus. This study shows F1534C mutation is absent in Ae. aegypti populations from Panama. However, several studies report how F1534C mutation has been detected in pyrethroid-resistant Ae. aegypti populations from Cuba [89], Grand Cayman [32] Mexico [93–95], Venezuela [17], Brazil [96], Puerto Rico [97], Colombia [18], China [92], Vietnam [98], Laos [99], Peru [34], India [100], Portugal [101], Saudi Arabia [102], Burkina Faso [103].

This study serves to establish a baseline on the state of resistance in Ae. aegypti and Ae. albopictus, and further studies should be carried out to see how the behavior of resistance and/or susceptibility of these mosquito populations develops in different sites of epidemiological and entomological importance. The relevance of these results from a technical/operational perspective is that they will substantially guide the PNCA in the selection of effective alternative insecticides for the control of Aedes populations. As for the detection of confirmed resistant to the pyrethroids deltamethrin and lambda-cyhalothrin, it requires the replacement of these insecticides by alternative insecticides, previously evaluated for their effectiveness. The use of insecticides with synergistic agents such as PBO may be an alternative to mitigate the negative effects of resistance caused by the pyrethroid insecticides applied. Finally, based on the results of this study and previous works [21–25], we can indicate that insecticide resistance in the populations mainly of Ae. aegypti and Ae. albopictus have increased in recent years in the different endemic regions of the country. This raises several implications that should be considered by the NACP: 1) the selection of insecticides should be made based on previous susceptibility and/or resistance studies that indicate the efficacy and effectiveness of the insecticide molecule to be used, 2) within the vector control strategies carried out at the level of the health regions, the surveillance and management of insecticide resistance should be highlighted, 3) the application of insecticides should be based on a strategy of appropriate use of insecticides to reduce the risks of the resistance development, slow down its evolution or reverse it to a level compatible with the efficient use of insecticides for vector control (7) and; 4). Vector control management should be carried out with the support of scientific evidence to increase the effectiveness of interventions against disease-transmitting mosquito populations.

Limitations

One of the limitations of the study was that it was not possible to detect allelic variants of the Kdr gene in all the Ae. aegypti populations under study, and the same analysis could not be performed with the Ae. albopictus populations. However, the three Ae. aegypti populations evaluated were very similar in terms of environmental, ecological and operational aspects to the other populations located in the same regions studied.

The presence of a varied and generalized resistance to insecticides, the Val1016IIe mutation in Ae. aegypti and Ae. albopictus in different geographic regions may be associated with the intensive use and possibly misuse of the different insecticides applied to control Aedes populations. It is necessary to develop a program for monitoring, surveillance and resistance management. Also, alternative approaches to mosquito control that do not involve insecticides should be explored.

Ache: acetylcholinesterase, CA: Carbamate, CCE: Carboxylesterases, CHIKV: chikungunya virus, CL50: Lethal concentrations 50%, CYPs: Cytochrome P450 Monooxygenases, DDT: Dichlorodiphenyltrichloroethane, DE: Epidemiological Department, DENV: Virus dengue, DME: Department of Medical Entomology, EST: esterase, RR: Resistance ratio, GST: Glutathione S-transferases, ICGES: Instituto Conmemorativo Gorgas de Estudios de la Salud, LC: lethal concentrations, MFOs: Mixed function oxidases, MINSA: Ministerio de Salud, NaV: voltage gated sodium channel, NSEs: Nonspecific esterases, OC: Organochlorines, OPs: Organophosphates, PAHO: Pan American Health Organization, PBO: Piperonyl butoxide, PCR: Polymerase chain reaction, PNCA: Programa Nacional de Control de Aedes, PYs: Pyrethroids, Rock: Rockefeller, SENACYT: National Secretariat of Science, Technology and Innovation, SIN: National Research System, ULV: Ultra-low volume, WHO: World Health Organization, ZIKV: Zika virus.

Ethics approval and consent to participate: This study did not need the approval of the ICGES Bioethics Committee, because no sample or information was obtained from the people responsible for the homes. The capture of biological material from Aedes mosquitoes was carried out after each head or person in charge of the selected homes received a complete explanation in relation to the work that would be carried out, pointing out the objective of the study and its relevance. Only after receiving verbal consent from the home owners, the work of collecting Aedes biological material began.

Consent for publication: Not applicable.

Availability of data and materials: The data sets analyzed during the current study are available from the corresponding author on reasonable request.

Competing interests: All authors declare they have no competing interests. LCC is member of the National Research System (SNI), National Secretariat of Science, Technology and Innovation (SENACYT). JLR. Any opinions, findings, conclusions or recommendations expressed in this publication are those of the author(s) and do not necessarily reflect the view of the U.S. Department of Agriculture. The mention of firm names or trade products does not imply that they are endorsed or recommended by the U.S. Department of Agriculture over other firms or similar products not mentioned; the USDA is an equal opportunity employer.

Funding: This research was financed with economic funds from the National Secretariat of Science, Technology and Innovation of Panama through contract 63-2016-4-IDDS15-092.

Authors contributions: LCC conceived and designed the project, the acquisition of funds and project management, participated in the field and laboratory work, as well as in the development of this study, analyzed data and interpreted the results, wrote the first version of the manuscript and the final review of the manuscript. LP, LCC, AMC, JLR, JAB, AB, DM and RT-C participated in the laboratory and field work and analyzed the data, interpreted the results and final version of the manuscript. All authors read and approved the final manuscript.

Acknowledgments: We are grateful to all regional health directors and vector control coordinators of Bocas del Toro, Ngäbe-Buglé, Chiriquí, Veraguas, Los Santos, Herrera, Coclé, Panamá Oeste, Panamá, Colón, Darién and Guna Yala, to technician José Lasso, head of the Vector Control Department, and to all vector control technicians who participated in the field collection of Aedes biological material. Special thanks to the local traditional authorities of the Indigenous Congress of Guna Yala and to all those responsible or homeowners where the Aedes collections were made, without their participation this research work would not have been possible. Thanks to Alberto Cumbrera for the assistance in preparing the maps used in this study. Finally, a posthumous thanks to María Magdalena Rodríguez for her contribution to the development of this study.

World Health Organization. Sustaining the drive to overcome the global impact of neglected tropical diseases: second WHO report on neglected diseases. World Health Organization. 2013. https://apps.who.int/iris/handle/10665/77950. Accessed 7 January 2024.
Salles TS, da Encarnação Sá-Guimarães T, de Alvarenga ESL, Guimarães-Ribeiro V, de Meneses MDF, de Castro-Salles PF, et al. History, epidemiology and diagnostics of dengue in the American and Brazilian contexts: a review. Parasit Vectors. 2018;11(1):264. doi:10.1186/s13071-018-2830-8
Liang G, Gao X, Gould EA. Factors responsible for the emergence of arboviruses; strategies, challenges and limitations for their control. Emerg Microbes Infect. 2015;4(3):e18. doi:10.1038/emi.2015.18.
Weaver SC, Reisen WK. Present and Future Arboviral Threats. 2010;85:328-45. doi:10.1016/j.antiviral.2009.10.008.
Paixão ES, Teixeira MG, Rodrigues LC. Zika, chikungunya and dengue: the causes and threats of new and re-emerging arboviral diseases. BMJ Glob Health. 2018;4;3(Suppl 1):e000530. doi:10.1136/bmjgh-2017-000530.
Floore TG. Mosquito larval control practices: past and present. J Am Mosq Control Assoc. 2006;22(3):527-33. doi:10.2987/8756-971X(2006)22[527:MLCPPA]2.0.CO;2.
Dusfour I, Vontas J, David JP, Weetman D, Fonseca DM, Corbel V, et al. Management of insecticide resistance in the major Aedes vectors of arboviruses: Advances and challenges. PLoS Negl Trop Dis. 2019;13(10):e0007615. doi:10.1371/journal.pntd.0007615.
Corbel V, Fonseca DM, Weetman D, Pinto J, AchEe NL, Chandre F et al. International workshop on insecticide resistance in vectors of arboviruses, December 2016, Rio de Janeiro, Brazil. Parasit Vectors. 2017;2;10(1):278. doi:10.1186/s13071-017-2224-3
Ngoagouni C, Kamgang B, Brengues C, Yahouedo G, Paupy C, Nakouné E, et al. Susceptibility profile and metabolic mechanisms involved in Aedes aegypti and Aedes albopictus resistant to DDT and deltamethrin in the Central African Republic. Parasit Vectors. 2016;24;9(1):599. doi:10.1186/s13071-016-1887-5
Moyes CL, Vontas J, Martins AJ, Ng LC, Koou SY, Dusfour I, et al. Contemporary status of insecticide resistance in the major Aedes vectors of arboviruses infecting humans. PLoS Negl Trop Dis. 2017;20;11(7):e0005625. doi:10.1371/journal.pntd.0005625
Insecticide Resistance Action Committee (IRAC). Prevention and management of insecticide resistance in vectors of public health importance. Atlanta. 2011;70p. https://croplife.org/wp-content/uploads/pdf_files/IRAC-Prevention-management-of-insecticide-resistance-in-vectors-pests-of-public-health-importance.pdf. Accessed 7 January 2024.
Du Y, Nomura Y, Zhorov BS, Dong K. Sodium channel mutations and pyrethroid resistance in Aedes aegypti. Insects. 2016;(4):60. doi:10.3390/insects7040060.
Fan Y, Scott JG. The F1534C voltage sensitive sodium channel mutation confers 7- to 16-fold resistance to pyrethroid insecticides in Aedes aegypti. Pest Man Sci 2020;6:2251-59. doi:10.1002/ps.5763.
Brengues C, Hawkes NJ, Chandre F, McCarroll L, Duchon S, Guillet P, et al. Pyrethroid and DDT cross-resistance in Aedes aegypti is correlated with novel mutations in the voltage-gated sodium channel gene. Med. Vet. Entomol. 2003;17(1):87-94. doi:10.1046/j.1365-2915.2003.00412.x.
Saavedra-Rodriguez K, Urdaneta-Marquez L, Rajatileka S, Moulton M, Flores AE, Fernandez-Salas I, et al. A mutation in the voltage-gated sodium channel gene associated with pyrethroid resistance in Latin American Aedes aegypti. Insect Mol. Biol. 2007;16(6):785-98. doi:10.1111/j.1365-2583.2007.00774.x.
Aguirre-Obando OA, Martins AJ, Navarro-Silva MA. First report of the Phe1534Cys Kdr mutation in natural populations of Aedes albopictus from Brazil. Parasit Vectors. 2017;27;10(1):160. doi:10.1186/s13071-017-2089-5.
Alvarez LC, Ponce G, Saavedra-Rodriguez K, Lopez B, Flores AE. Frequency of V1016I and F1534C mutations in the voltage-gated sodium channel gene in Aedes aegypti in Venezuela. Pest Manag Sci. 2015;71(6):863-9. doi:10.1002/ps.3846.
Atencia MC, Pérez MDJ, Jaramillo MC, Caldera SM, Cochero S, Bejarano EE. First report of the F1534C mutation associated with cross-resistance to DDT and pyrethroids in Aedes aegypti from Colombia. Biomedica. 2016;1;36(3):432-37. doi:10.7705/biomedica.v36i3.2834.
Collet ML, Frizzo C, Orlandin E, Rona LDP, Nascimento JC, Montano MAE, et al. Frequency of the Val1016Ile mutation on the Kdr gene in Aedes aegypti (Diptera: Culicidae) in south Brazil. Genet. Mol. Res. 2016;21;15(4). doi:10.4238/gmr15048940.
Cáceres L. La lucha antimalárica en Panamá. Primera edición. Panamá: Poligrafía, S.A; 1999. p. 63.
Bisset JA, Rodríguez MM, Cáceres L. Levels of resistance to insecticides and their mechanisms in 2 strains of Aedes aegypti from Panama. Rev Cubana Med Trop. 2003;55:191-5.
Cáceres L, Rovira J, García A, Torres R, De La Cruz M. Determinación de la sensibilidad a insecticidas OP, CA y PY en poblaciones de Aedes aegypti Linneaus, 1762 (Díptera: Culicidae) de Panamá. Biomédica. 2013;33:70-81.
Tuñón A. Determinación de la resistencia a insecticidas y sus mecanismos bioquímicos en poblaciones de Aedes aegypti y Aedes albopictus procedentes del distrito de Panamá, República de Panamá. 2021. Universidad de Panamá. Vicerrectoría de Investigación y Postgrado. Programa Centroamericano de Maestría en Entomología. 88 pag. http://up-rid.up.ac.pa/5037/3/anyi_tunon.pdf. [Accessed 7 January 2024].
Cáceres Carrera L. Determinación de la resistencia a insecticidas y sus mecanismos en poblaciones de Aedes aegypti (Diptera: Culicidae) de tres países de América Central. 2013. Repositorio de tesis en Ciencias Biomédicas y de la Salud de Cuba. Tesis doctoral en Ciencias de la Salud. Instituto de Medicina Tropical “Pedro Kourí”. https://tesis.sld.cu/index.php/index.php?P=FullRecord&ID=209. Accessed 23 June 2024.
Murcia O, Henríquez B, Castro A, Koo S, Young J, Márquez R, et al. Presence of the point mutations Val1016Gly in the voltage-gated sodium channel detected in a single mosquito from Panama. Parasit Vectors. 2019;28;12(1):62. doi:10.1186/s13071-019-3309-y.
Rueda L. Pictorial keys for the identification of mosquitoes (Diptera: Culicidae) associated with Dengue Virus Transmission. Zootaxa. 2004;589(1):1-60.
World Health Organization. Monitoring and managing insecticide resistance in Aedes mosquito populations. 2016. https://apps.who.int/iris/bitstream/handle/10665/204588/WHO_ZIKV_VC_16.1_eng.pdf;jsessionid=D1212B5F8101885C5C81FA61A8EFF5BD?sequence=2. Accessed 7 June 2024.
Rodríguez MM, Bisset J, de Fernandez DM, Lauzán L, Soca A. Detection of insecticide resistance in Aedes aegypti (Diptera: Culicidae) from Cuba and Venezuela. J Med Entomol. 2001;38(5):623-8. doi:10.1603/0022-2585-38.5.623.
Brogdon WG, McAllister JC, Vulule J. Heme peroxidase activity measured in single mosquitoes identifies individuals expressing an elevated oxidase for insecticide resistance. J Am Mosq Control Assoc. 1997;13(3):233-7.
Polson KA, Rawlins SC, Brogdon WG, Chadee DD. Characterization of DDT and pyrethroid resistance in Trinidad and Tobago populations of Aedes aegypti. Bull Entomol Res. 2011;101(4):435-41. doi:10.1017/S0007485310000702.
Rodriguez MM, Bisset JA, Fernandez D. Levels of insecticide resistance and resistance mechanisms in Aedes aegypti from some Latin American countries. J Am Mosq Control Assoc. 2007;23(4):420-9. doi:10.2987/5588.1.
Harris AF, Rajatileka S, Ranson H. Pyrethroid resistance in Aedes aegypti from Grand Cayman. Am J Trop Med Hyg. 2010;83(2):277-84. doi:10.4269/ajtmh.2010.09-0623
Collins FH, Mendez MA, Rasmussen MO, Mehaffey PC, Besansky NJ, Finnerty V. A ribosomal RNA gene probe differentiates member species of the Anopheles gambiae complex. Am J Trop Med Hyg. 1987;37(1):37-41. doi:10.4269/ajtmh.1987.37.37.
Livak KJ. Organization and mapping of a sequence on the Drosophila melanogaster X and Y chromosomes that is transcribed during spermatogenesis. Genetics. 1984;107(4):611-34. doi:10.1093/genetics/107.4.611
Pinto J, Palomino M, Mendoza-Uribe L, Sinti C, Liebman KA, Lenhart A. Susceptibility to insecticides and resistance mechanisms in three populations of Aedes aegypti from Peru. Parasit Vectors. 2019;22;12(1):494. doi:10.1186/s13071-019-3739-6.
Yanola J, Somboon P, Walton C, Nachaiwieng W, Somwang P, Prapanthadara LA. High-throughput assays for detection of the F1534C mutation in the voltage-gated sodium channel gene in permethrin[1]resistant Aedes aegypti and the distribution of this mutation throughout Thailand. Trop Med Int Health. 2011; 16(4):501–9. https://doi.org/10.1111/j.1365-3156.2011.02725.x
Abbott WS. A method for computing the effectiveness of an insecticide. J Econ Entomol. 1925;18:265-7.
Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72:248-54. doi:10.1016/0003-2697(76)90527-3.
Montella IR, Martins AJ, Viana-Medeiros PF, Lima JB, Braga IA, Valle D. Insecticide resistance mechanisms of Brazilian Aedes aegypti populations from 2001 to 2004. Am J Trop Med Hyg. 2007;77(3):467-77.
López-Solís AD, Castillo-Vera A, Cisneros J, Solís-Santoyo F, Penilla-Navarro RP, Black Iv WC, et al. Resistencia a insecticidas en Aedes aegypti y Aedes albopictus (Diptera: Culicidae) de Tapachula, Chiapas, México. Salud Publica Mex. 2020;62(4):439-46. doi:10.21149/10131.
Bisset JA, Rodríguez MM, San Martín JL, Romero JE, Montoya R. Evaluación de la resistencia a insecticidas de una cepa de Aedes aegypti de El Salvador. Rev Pan Salud Pub. 2009;26:229-34.
Vargas-Miranda K, Troyo A, Calderón-Arguedas O. Resistance of Aedes aegypti (Diptera: Culicidae) to organophosphate and pyrethroid insecticides in Orotina, Alajuela, Costa Rica. Rev Costarric Salud Pública [online]. 2019;28(1):15-24.
Pareja-Loaiza PX, Santacoloma Varon L, Rey Vega G, Gómez-Camargo D, Maestre-Serrano R, Lenhart A. Mechanisms associated with pyrethroid resistance in populations of Aedes aegypti (Diptera: Culicidae) from the Caribbean coast of Colombia. PLoS One. 2020;6;15(10):e0228695. doi:10.1371/journal.pone.0228695.
Bisset JA, Marín R, Rodríguez MM, Severson DW, Ricardo Y, French L, et al. Insecticide resistance in two Aedes aegypti (Diptera: Culicidae) strains from Costa Rica. J Med Entomol. 2013;50(2):352-61. doi:10.1603/ME12064.
Rodríguez MM, Crespo A, Hurtado D, Fuentes I, Rey J, Bisset JA. Diagnostic doses of insecticides for adult Aedes aegypti to assess insecticide resistance in Cuba. J Am Mosq Control Assoc. 2017;33:142-4. doi:10.2987/16-6593.1.
Bellinato DF, Viana-Medeiros PF, Araújo SC, Martins AJ, Lima JBP, Valle D. Resistance status to the insecticides temephos, deltamethrin, and diflubenzuron in Brazilian Aedes aegypti populations. BioMed Res. Int. 2016;2016:8603263. doi:10.1155/2016/8603263.
Linss JG, Brito LP, Garcia GA, Araki AS, Bruno RV, Lima JB, et al. Distribution and dissemination of the Val1016Ile and Phe1534Cys Kdr mutations in Aedes aegypti Brazilian natural populations. Parasit Vectors. 2014;15;7:25. doi:10.1186/1756-3305-7-25.
Kumar S, Thomas A, Pillai M. Deltamethrin: Promising mosquito control agent against adult stage of Aedes aegypti L. Asian Pac J Trop Med. 2011;4:430-5. doi:10.1016/S1995-7645(11)60120-X.
Urmila J, Vijayan VA, Ganesh KN, Gopalan N, Prakash S. Deltamethrin tolerance & associated cross resistance in Aedes aegypti from Mysore. Indian J Med Res. 2001;113:103-7.
Paeporn P, Supaphathom K, Srisawat R, Komalamisra N, Deesin V, Ya-umphan P, et al. Biochemical detection of pyrethroid resistance mechanism in Aedes aegypti in Ratchaburi province, Thailand. Trop Biomed. 2004;21(2):145-51.
Chaverra-Rodríguez D, Jaramillo-Ocampo N, Fonseca-Gonzalez I. Selección artificial de resistencia a lambda-cihalotrina en Aedes aegypti y resistencia cruzada a otros insecticidas. Rev Colomb Entomol. 2012;38:100-7.
Loroño-Pino MA, Chan-Dzul YN, Zapata-Gil R, Carrillo-Solís C, Uitz-Mena A, García-Rejón JE, et al. Household use of insecticide consumer products in a dengue-endemic area in México. Trop Med & Int Health. 2014;19(10):1267-75. doi:10.1111/tmi.12364.
Davies T, Field L, Usherwood P, Williamson M. DDT, pyrethrins, pyrethroids and insect sodium channels. IUBMB Life. 2007;59(3):151-62. doi:10.1080/15216540701352042.
Garcia GA, David MR, Martins AJ, Maciel-de-Freitas R, Linss JGB, Araújo SC, et al. The impact of insecticide applications on the dynamics of resistance: The case of four Aedes aegypti populations from different Brazilian regions. PLoS Negl Trop Dis. 2018;12;12(2):e0006227. doi:10.1371/journal.pntd.0006227.
Piedra LA, Rodriguez MM, Lopez I, Ruiz A, Martinez LC, Garcia I, et al. Insecticide resistance status of Aedes albopictus (Diptera: Culicidae) populations from Cuba. J Med Entomol. 2023;12;60(3):487-93. doi:10.1093/jme/tjac189.
Su X, Guo Y, Deng J, Xu J, Zhou G, Zhou T, et al. Fast emerging insecticide resistance in Aedes albopictus in Guangzhou, China: Alarm to the dengue epidemic. PLoS Negl Trop Dis. 2019;16;13(9):e0007665. doi:10.1371/journal.pntd.0007665.
Khan HAA, Akram W, Shehzad K, Shaalan EA. First report of field evolved resistance to agrochemicals in dengue mosquito, Aedes albopictus (Diptera: Culicidae), from Pakistan. Parasites Vectors. 2011;4:146. doi:10.1186/1756-3305-4-146.
Wan-Norafikah O, Chen CD, Sofian-Azirun M. Organochlorines and organophosphates susceptibility of Aedes albopictus Skuse larvae from agricultural and non-agricultural localities in Peninsular Malaysia. Saudi J Biol Sci. 2021;28(1):1010-16. doi:10.1016/j.sjbs.2020.11.040.
Chen CD, Nazni WA, Lee HL, Norma-Rashid Y, Lardizabal ML, Sofian-Azirun M. Temephos resistance in field Aedes (Stegomyia) albopictus (Skuse) from Selangor, Malaysia. Trop Biomed. 2013;30(2):220-30.
Al-Amin HM, Johora FT, Irish SR, Hossainey MRH, Vizcaino L, Paul KK, et al. Insecticide resistance status of Aedes aegypti in Bangladesh. Parasit Vectors. 2020;14;13(1):622. doi:10.1186/s13071-020-04503-6.
Hancock PA, Wiebe A, Gleave KA, Bhatt S, Cameron E, Trett A, et al. Associated patterns of insecticide resistance in field populations of malaria vectors across Africa. Proc Natl Acad Sci USA. 2018;115(23):5938-43. doi:10.1073/pnas.1801826115.
Hemingway J, Hawkes NJ, McCarroll L, Ranson H. The molecular basis of insecticide resistance in mosquitoes. Insect Biochem Mol Biol. 2004;34:653-65. doi: 10.1016/j.ibmb.2004.03.018.
Poupardin R, Srisukontarat W, Yunta C, and Ranson H. Identification of carboxylesterase genes implicated in temephos resistance in the dengue vector Aedes aegypti. PLoS Negl. Trop. Dis. 2014;8:e2743. doi:10.1371/journal.pntd.0002743.
Hemingway J and Ranson H. Insecticide resistance in insect vectors of human disease. Annu. Rev. Entomol. 2000;45:371-91. doi:10.1146/annurev.ento.45.1.371.
Sogorb MA and Vilanova E. Enzymes involved in the detoxification of organophosphorus, carbamate and pyrethroid insecticides through hydrolysis. Toxicol. Lett. 2002;128:215-28. doi:10.1016/S0378-4274(01)00543-4.
Maestre-Serrano R, Gomez-Camargo D, Ponce-Garcia G, Flores AE. Susceptibility to insecticides and resistance mechanisms in Aedes aegypti from the Colombian Caribbean Region. Pestic Biochem Physiol. 2014;116,63-73. doi:10.1016/j.pestbp.2014.09.014.
Fonseca-González I, Quiñones ML, Lenhart A, Brogdon WG. Insecticide resistance status of Aedes aegypti (L.) from Colombia. Pest Manag Sci. 2011;67(4):430-7. doi:10.1002/ps.2081.
Santacoloma L, Chaves B, Brochero H. Susceptibilidad de Aedes aegypti a DDT, deltamethrin y lambda-cyhalothrin en Colombia. Rev Panam Salud Publica/Pan Am J Public Heal. 2010;27(1):66-73.
Ocampo CB, Salazar-Terreros MJ, Mina NJ, McAllister J, Brogdon W. Insecticide resistance status of Aedes aegypti in 10 localities in Colombia. Acta Trop. 2011;118(1):37-44. doi:10.1016/j.actatropica.2011.01.007.
Valle D, Bellinato DF, Viana-Medeiros PF, Lima JBP, Martins Junior AJ. Resistance to temephos and deltamethrin in Aedes aegypti from Brazil between 1985 and 2017. Mem Inst Oswaldo Cruz. 2019;114:e180544. doi:10.1590/0074-02760180544.
Strode C, Melo-Santos M, Magalhaes T, Araujo A, Ayres C. Expression profile of genes during resistance reversal in a temephos selected strain of the dengue vector, Aedes aegypti. PLoS One. 2012;7(8):e39439. doi:10.1371/journal.pone.0039439.
Flores AE, Albeldaño-Vazquez W, Salas IF, Badii MH, Becerra HL, García GP, et al. Elevated α-esterase levels associated with permethrin tolerance in Aedes aegypti (L.) from Baja California, Mexico. Pestic Biochem Physiol. 2005;82(1):66-78. doi:10.1016/j.pestbp.2004.12.007.
Rodríguez MM, Bisset JA, Ricardo Y, Pérez O, Montada D, Figueredo D, et al. Resistencia a insecticidas organofosforados en Aedes aegypti (Diptera: Culicidae) de Santiago de Cuba, 1997–2009. Rev Cubana Med Trop [online]. 2010;62(3):217-23. Available from: http://scielo.sld.cu/scielo.php?script= sci_arttext&pid=S0375-07602010000300009&lng=es&nrm=iso&tlng=es. Accessed 17 January 2024.
Polson KA, Brogdon WG, Rawlins SC, Chadee DD. Characterization of insecticide resistance in Trinidadian strains of Aedes aegypti mosquitoes. Acta Trop [online]. 2011;117(1):31-8. Available from: doi:10.1016/j.actatropica.2010.09.005. Accessed 17 January 2024.
Bisset JA, Rodriguez MM, French L, Severson DW, Gutierrez G, Hurtado D, et al. Insecticide resistance and metabolic mechanisms involved in larval and adult stages of Aedes aegypti insecticide resistant reference strains from Cuba. J Am Mosq Control Assoc. 2014;30:298-304. doi:10.2987/14-6431.1.
Ortelli F, Rossiter LC, Vontas J, Ranson H, Hemingway J. Heterologous expression of four glutathione transferase genes genetically linked to a major insecticide-resistance locus from the malaria vector Anopheles gambiae. Biochem J. 2003;373(Pt 3):957-63. doi:10.1042/bj20030169.
Lumjuan N, Rajatileka S, Changsom D, Wicheer J, Leelapat P, Prapanthadara L. et al. The role of the Aedes aegypti Epsilon glutathione transferases in conferring resistance to DDT and pyrethroid insecticides. Insect Biochem Mol. Biol. 2011;41,203-9. doi:10.1016/j.ibmb.2010.12.005.
Aponte A, Penilla RP, Rodriguez AD, Ocampo CB. Mechanisms of pyrethroid resistance in Aedes (Stegomyia) aegypti from Colombia. Acta Trop. 2019;191:146-54. doi:10.1016/j.actatropica.2018.12.021.
Nazni W, Selvi S, Lee H, Sadiyah I, Azahari H, Derric N, et al. Susceptibility status of transgenic Aedes aegypti (L.) against insecticides. WHO Regional Office for South-East Asia. Den Bull. 2009;33:124-9.
Coleman M, Hemingway J. Insecticide resistance monitoring and evaluation in disease transmitting mosquitoes. J Pestic Sci. 2007;2(32):69-76.
doi:10.1584/jpestics.R07-01.
Fukuto TR. Mechanism of action of organophosphorus and carbamate insecticides. Environ Health Perspect. 1990;87:245-54. doi:10.1289/ehp.908724.
Nunes RF, Souza MA, Oliveira JC, Grangeiro RF, Marinho MJ, Pereira WO. Characterization of enzymatic profiles of Aedes aegypti strains from the State of Rio Grande do Norte, Brazil. Cien Saude Colet. 2016;21(1):285-92. doi:10.1590/1413-81232015211.15052014.
Dos Santos CR, de Melo Rodovalho C, Jablonka W, Martins AJ, Lima JBP, Dos Santos Dias L, et al. Insecticide resistance, fitness and susceptibility to Zika infection of an interbred Aedes aegypti population from Rio de Janeiro, Brazil. Parasit Vectors. 2020;8;13(1):293. doi:10.1186/s13071-020-04166-3.
Yang F, Schildhauer S, Billeter SA, Hardstone Yoshimizu M, Payne R, Pakingan MJ, et al. Insecticide resistance status of Aedes aegypti (Diptera: Culicidae) in California by biochemical assays. J Med Entomol. 2020;4;57(4):1176-83. doi:10.1093/jme/tjaa031.
García GP, Flores AE, Fernández-Salas I, Saavedra-Rodríguez K, Reyes-Solis G, Lozano-Fuentes S, et al. Recent rapid rise of a permethrin knock down resistance allele in Aedes aegypti in México. PLoS Negl Trop Dis. 2009;13;3(10):e531. doi:10.1371/journal.pntd.0000531.
Martins AJ, Lima JB, Peixoto AA, Valle D. Frequency of Val1016Ile mutation in the voltage-gated sodium channel gene of Aedes aegypti Brazilian populations. Trop Med Int Health. 2009;14(11):1351-5. doi:10.1111/j.1365-3156.2009.02378.x.
Kawada H, Higa Y, Komagata O, Kasai S, Tomita T, Thi Yen N, et al. Widespread distribution of a newly found point mutation in voltage-gated sodium channel in pyrethroid-resistant Aedes aegypti populations in Vietnam. PLoS Negl Trop Dis. 2009;6;3(10):e527. doi:10.1371/journal.pntd.0000527.
Deming R, Manrique-Saide P, Medina Barreiro A, Cardeña EU, Che-Mendoza A, Jones B, et al. Spatial variation of insecticide resistance in the dengue vector Aedes aegypti presents unique vector control challenges. Parasit Vectors. 2016;4;9:67. doi:10.1186/s13071-016-1346-3.
Rodríguez MM, Ruiz A, Piedra L, Gutierrez G, Rey J, Cruz M, et al. Multiple insecticide resistance in Aedes aegypti (Diptera: Culicidae) from Boyeros municipality, Cuba and associated mechanisms. Acta Trop. 2020;212:105680. doi:10.1016/j.actatropica.2020.105680.
Granada Y, Mejía-Jaramillo A, Strode C, Triana-Chavez O. A point mutation V419L in the sodium channel gene from natural populations of Aedes aegypti is involved in resistance to λ-cyhalothrin in Colombia. Insects. 2018;14;9(1):23. doi:10.3390/insects9010023.
Brito LP, Linss JGB, Lima-Camara TN, Belinato TA, Peixoto AA, Lima JBP, et al. Assessing the effects of Aedes aegypti Kdr mutations on pyrethroid resistance and its fitness cost. Plos One. 2013;8(4):e60878. doi: 10.1371/journal.pone.0060878.
Li CX, Kaufman PE, Xue RD, Zhao MH, Wang G, Yan T, et al. Relationship between insecticide resistance and Kdr mutations in the dengue vector Aedes aegypti in Southern China. Parasit Vectors. 2015;12;8:325. doi:10.1186/s13071-015-0933-z.
Villanueva-Segura K, Ponce-Garcia B, Lopez-Monroy B, Mora-Jasso E, Perales L, Ponce-Garcia G, et al. Multiplex PCR for simultaneous genotyping of kdr mutations V410L, V1016I and F1534C in Aedes aegypti (L.). Parasit Vectors. 2020;13(1):325. doi:10.1186/s13071-020-04193-0.
Kandel Y, Vulcan J, Rodriguez SD, Moore E, Chung HN, Mitra S, et al. Widespread insecticide resistance in Aedes aegypti L. from New Mexico, USA. PloS One. 2019;14(2):e0212693. doi:10.1371/journal.pone.0212693.
Grossman MK, Rodriguez J, Barreiro AM, Lenhart A, Manrique-Saide P & Vazquez-Prokopec GM. Fine-scale spatial and temporal dynamics of kdr haplotypes in Aedes aegypti from Mexico. Parasit Vectors. 2019;12(1):20. doi:10.1186/s13071-018-3275-9.
Macoris MD, Martins AJ, Andrighetti MTM, Lima JBP, & Valle D. Pyrethroid resistance persists after ten years without usage against Aedes aegypti in governmental campaigns: Lessons from Sao Paulo State, Brazil. PLoS Negl Trop Dis. 2018;12(3):e0006390. doi:10.1371/journal.pntd.0006390.
Ponce-García G, Del Río-Galvan S, Barrera R, Saavedra-Rodriguez K, Villanueva-Segura K, Felix G, et al. Knockdown resistance mutations in Aedes aegypti (Diptera: Culicidae) from Puerto Rico. J Med Entomol. 2016;53(6):1410-14. doi:10.1093/jme/tjw115.
Lien NTK, Ngoc NTH, Hien NT, Hoang NH, & Binh NTH. Two novel mutations in the voltage-gated sodium channel associated with knockdown resistance (Kdr) in the dengue vector Aedes aegypti in Vietnam. J Vector Ecol. 2018;43(1):184-9. doi:10.1111/jvec.12298.
Marcombe S, Fustec B, Cattel J, Chonephetsarath S, Thammavong P, Phommavanh N, et al. Distribution of insecticide resistance and mechanisms involved in the arbovirus vector Aedes aegypti in Laos and implication for vector control. PLoS Negl Trop Dis. 2019;13(12):e0007852. doi:10.1371/journal.pntd.0007852.
Kushwah RB, Dykes CL, Kapoor N, Adak T & Singh OP. Pyrethroid-resistance and presence of two knockdown resistance (Kdr) mutations, F1534C and a novel mutation T1520I, in Indian Aedes aegypti. PLoS Negl Trop Dis. 2015;9(1):e3332. doi:10.1371/journal.pntd.0003332.
Seixas G, Grigoraki L, Weetman D, Vicente JL, Silva AC, Pinto J, Sousa CA. Insecticide resistance is mediated by multiple mechanisms in recently introduced Aedes aegypti from Madeira Island (Portugal). PLoS Negl Trop Dis. 2017;11(7):e0005799. doi:10.1371/journal.pntd.0005799.
Dafalla O, Alsheikh A, Mohammed W, Shrwani K, Alsheikh F, Hobani Y, et al. Knockdown resistance mutations contributing to pyrethroid resistance in Aedes aegypti population, Saudi Arabia. East Mediterr Health J. 2019;25(12):905-13. doi:10.26719/emhj.19.081
Sombié A, Saiki E, Yaméogo F, Sakurai T, Shirozu T, Fukumoto S, Badolo A. High frequencies of F1534C and V1016I Kdr mutations and association with pyrethroid resistance in Aedes aegypti from Somgandé (Ouagadougou), Burkina Faso. Trop Med Health. 2019;47:2. doi:10.1186/s41182-018-0134-5.

Download PDF

Editorial decision: Major revision
25 Jul, 2024
Reviewers agreed at journal
07 Jul, 2024
Reviewers invited by journal
06 Jul, 2024
Editor assigned by journal
04 Jul, 2024
First submitted to journal
03 Jul, 2024

You are reading this latest preprint version

Insecticide resistance status and mechanisms in Aedes aegypti and Aedes albopictus from different dengue endemic regions of Panama

Status:

Version 1

Abstract

Background

Methods

Results

Conclusion

Figures

Introduction

Materials and Methods

Study sites

Collection and mosquito rearing

Susceptibility bioassays with adult mosquitoes

Biochemical assays

Detection of Val1016Ile and F1534C sodium channel mutations

Statistical analysis

Results

Susceptibility bioassays with adult mosquitoes

Biochemical assays

α and β Esterases

Mixed function oxidases

Glutathione-S-transferase

Acetylcholinesterase

Detection of Val1016Ile and F1534C sodium channel mutations

Discussion

Susceptibility bioassays

Biochemical assays

Esterases

Mixed function oxidases

Glutathione S-transferase

Acetylcholinesterase

Limitations

Conclusion

Abbreviations

Declarations

References

Status:

Version 1