GWSF-EuSWAP70 gene expression to enhance gray mold resistance in Arabidopsis thaliana

doi:10.21203/rs.3.rs-4683991/v1

Download PDF

Research Article

GWSF-EuSWAP70 gene expression to enhance gray mold resistance in Arabidopsis thaliana

https://doi.org/10.21203/rs.3.rs-4683991/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Background

Eucalyptus, a widely cultivated woody plant, is susceptible to a diverse array of pests and diseases, leading to reduced yields and economic losses. Traditional breeding methods are very time-consuming; therefore, plant genetic engineering has emerged as a promising approach for plant pathogen management. However, the genetic transformation system of eucalyptus is still in its early stages of development, while studies on transgenic eucalyptus and its disease-resistance genes are limited. The SWAP70 gene has been shown to play a crucial role in the defense response of Arabidopsis thaliana and rice. In this study, the model plant A. thalianawas selected for genetic transformation. The aim was to enhance the expression of the EuSWAP70 gene derived from Eucalyptus grandis, and other disease-resistance genes, by utilizing an artificial GWSF promoter.

Results

The results showed that the EuSWAP70 gene was successfully transformed into A. thaliana, and the PCR assay confirmed the presence of the EuSWAP70 gene in transgenic Arabidopsis plants. The gray mold resistance of the EuSWAP70 transgenic Arabidopsis plants under GWSF and CaMV35S promoters was evaluated against Botrytis cinerea infection. After gray mold infection, Arabidopsisplants were ranked by leaf pore area percentage: wild-type > CaMV35S-EuSWAP70 > GWSF-EuSWAP70. The transgenic plants showed stronger gray mold resistance, and the GWSF-EuSWAP70 transgenic plants were stronger than the CaMV35S-EuSWAP70 transgenic plants.

In two transgenic Arabidopsis plants treated with different inducers, the expression levels of ten disease-resistant genes were compared, and there was a significant difference between them. The expression levels of disease-resistance genes, particularly NPR1 and ChiB, were found to be higher in GWSF-EuSWAP70 transgenic Arabidopsis plants than those in CaMV35S-EuSWAP70transgenic plants. GWSF-EuSWAP70 transgenic Arabidopsis plants have stronger disease-resistance gene activity than CaMV35S-EuSWAP70plants under various inducers. The GWSF-EuSWAP70transgenic plants have minimal background expression and a wide range of plant inducer responses. Different inducer treatments had different effects on gene expression levels, B. cinerea treatment resulted in a significant increase in the expression levels of NPR1 and ChiB genes, whereas ethylene and salicylic acid (SA) pre-treatment reduced the expression levels of ChiB genes under B. cinerea treatment.

Conclusions

The EuSWAP70 gene can be effectively introduced into Arabidopsis plants, induced by two promoters, and potentially improve their B. cinerearesistance.

eucalyptus

transgenic Arabidopsis plants

SWAP70

GWSF promoter

Botrytis cinerea

disease-resistance gene

Eucalyptus, a woody plant with multiple economic values, is native to Australia, New Guinea, and other tropical regions [1]. The eucalyptus tree is also one of the most widely planted trees in the world, with more than 20 million hectares planted globally [2]. In China eucalyptus planting area exceeds 4.5 million hectares [3]. Therefore, the development of eucalyptus plantation forests is the current global trend of eucalyptus plantation. It is also the general consensus and common action for global climate and ecological governance [2]. However, eucalyptus plantations are vulnerable to different pests and pathogens and cause eucalyptus yield reduction in the process of management [4, 5]. Ceratocystis wilt and fungal damage from Corymbia spp. reduce volume growth, increase wood consumption, and reduce yield in eucalyptus pulp production [6, 7]. So diseases and insect damage are now considered to be one of the most important constraints to the long-term sustainability of eucalypt plantations. Breeding and selecting disease- and insect-resistant varieties and hybrids have shown great promise for reducing damage [5]. Traditional breeding is time-consuming and labor-intensive, and plant genetic engineering is one of the most effective and sustainable ways to manage plant pathogens [8, 9].

The research work on eucalyptus transgenics is still at the beginning stage. Some transgenic studies conducted on eucalyptus include the introduction of herbicide resistance genes, such as the Cry3A gene and the Bar gene [10]. Other research has focused on genes like cinnamate 4-hydroxylase (C4H) and HAL2, which aim to enhance salt stress tolerance [11]. However, the exploration of eucalyptus disease-resistant genes is limited, and commercially available transgenic eucalyptus varieties have yet to be developed [12].

The conventional method of transgenesis involves the random integration of DNA-encoding proteins associated with agronomical characteristics at random positions into the genome [13]. Disease resistance of plant can be enhanced by transferring disease-resistance genes and utilizing promoters to enhance their expression. Transgenic eucalyptus with the aiiA gene, has been developed to confer disease-resistance against Ralstonia solanacearum. In traditional transgenic methods, the successful expression of these genes primarily depends on the activity of disease resistance genes. Therefore, the selection of disease-resistant particular genes of interest [14] and the utilization of promoters with strong expression activity [15] play a crucial role in improving plant disease resistance.

In the world, Botrytis cinerea is one of the most important necrotrophic plant pathogens, causing devastating diseases on more than 500 plant species, including many important crops, resulting in economic losses that range from $10 billion to $100 billion [16]. This fungal pathogen B. cinerea invades nearly all parts of plants including stems, leaves, flowers, fruits, and seeds at both pre-harvest and post-harvest stages [16], and causes serious damage to their growth, development, and quality [17]. gray mold caused by B. cinerea also posed a threat to eucalyptus nurseries and plantations in South China [18].

In animals and plants, small GTPases act as important signals by cycling between inactive and active forms based on guanosine diphosphate (GDP) binding [19]. Guanine nucleotide exchange factors (GEFs), GTPase-activating proteins (GAPs), and guanine nucleotide dissociation inhibitors (GDIs) are the primary regulatory proteins that control the switch between GTP- and GDP-bound forms. SWAP70 (switch-associated protein 70), a GEF regulatory protein of size 70 kDa, was first identified in mouse B cells [20].

SWAP70 acts as a GEF for Rac( a member of the Rho family of GTPases), mediating signaling pathways that lead to cytoskeletal rearrangement and membrane ruffling, independent of Ras (another subfamily of small GTPases) [21]. SWAP70 has been extensively studied in B cell signaling. It has been shown to play a crucial role in B cell development, activation, and immune response [22–24].

However, there are limited studies on the role of SWAP70 in plants. AtSWAP70 from Arabidopsis plays a role in both PAMP- and effector-triggered immunity in Arabidopsis, regulating defense gene expression and pathogen growth [25]. Rice Rac1, one of seven Rac/Rop GTPases in rice, mediates a variety of immunological responses, including cell death, formation of reactive oxygen species (ROS), activation of pathogenesis-related genes, lignification, and synthesis of phytoalexin [26, 27]. In rice, OsSWAP70A and OsSWAP70B proteins containing the DH domain, regulate immune responses by activating the Rho GTPase OsRac1, which plays a crucial role in defense responses against chitin elicitors [28]. Effectors of potato Phytophthora infestans utilize host susceptibility factor NRL1 to degrade the immune regulator SWAP70 [29]. The above studies suggested that SWAP70 genes are involved in plant defense systems and have the capability of improving disease resistance. The function and molecular mechanisms of SWAP70 genes in plants have not been thoroughly researched, particularly in woody plants. To improve plant resistance to multiple adversities and achieve broad-spectrum disease-resistance to pathogens, GWSF as an ideal artificial promoter, was used to enhance the expression of the EuSWAP70 gene from E. grandis as well as related disease-resistance genes in our study.

The genetic transformation of eucalyptus has a low success rate due to its high heterozygosity, incompatible barriers, and the deficiency of a highly efficient and stable genetic transformation system [30]. While A. thaliana represents a model plant with a short growth cycle, fruiting, and easy cultivation, and its transgenic technology is mature and has shown high success rates. Due to the immaturity of the eucalyptus transformation system and the untested expression activity of the GWSF-EuSWAP70 expression vector, in this study, A. thaliana will be employed as the recipient plant of EuSWAP70, and the expression activity of EuSWAP70 and related regulated genes induced by two promoters were investigated under the induction of gray mold, ethylene (Eth) and salicylic acid(SA) gene expression. The regulatory mechanism and function of the EuSWAP70 will be identified.

Materials,gene and vector construction

The plants of A. thaliana were grown in a growth cabinet at an irradiance of 300 µmol(photon) /m²/s during a 12 h photoperiod and day/night temperatures of 26/20°C, and relative humidities of 70/80%.

The EuSWAP70, a E. grandis switch-associated protein 70 (XM_010055660) was synthesized and cloned into pUC57 with clone RE site EcoRI/BstEII by Sangon Biotech (Shanghai China). The GWSF promoter were cloned in pUC19 by our lab [31]. The nucleic acid fragments GWSF- EuSWAP70 and CaMV35S- EuSWAP70 were constructed with enzymatic cleavage and ligation. And the fragments were used to replace CaMV35S- gus in pCAMBIA1301, respectively. The recombinant plasmids were transformed into Agrobacterium tumefaciens strain GV3101 as described Chen et al. [32].

Transformation and screen

Transformation of A. thaliana (Col-0) plants was performed via A. tumefaciens strain GV3101 by the floral dip method [33]. Ten to twenty independent T0 plants were selected by sowing seeds on a half-strength Murashige and Skoog (MS) medium with 50 µg /cm³ kanamycin. The four-week-old putative transgenic plants were confirmed by PCR of EuSWAP70 or GWSF. The primers for PCR were as follows: EuSWAP70 forward/reverse (5'-3'), ACATTGGGACTCCGACAAAG/CTCTCCTCAGCCCTGACAAC; GWSF forward/reverse (5'-3'), TTGAAGATA ATCCAGCCACCA/AGCGTGTCCTCTCCAAATGA. The T₂ lines and T₃ lines were confirmed by kanamycin resistance and PCR as mentioned above. At last, the T3 homozygous lines were identified when the rate of green seedlings of each T₃ line, selected by kanamycin, was higher than 99%.

Disease resistance

The strains of B. cinerea stored at 4°C were cultured on a PDA medium for 3 to 5 days to activate at 26°C; The 5-week-old wild-type and T3 homozygous transgenic lines were randomly selected for resistance testing. The rosette leaves were sprayed with sterile water and attached a consistent-sized cake of gray mold on upper epidermis. High humidity was maintained during infection treatment in a plastic bag. After 2, 4, and 6h of infection treatment, three pieces of leaf were randomly removed from each line to record the results with photographs. And the leaves were stained with trypan blue according to the Saskia method [34].

Induction treatment and qPCR analyse

The 5-week-old wild-type and T3 homozygous transgenic GWSF-EuSWAP70 and CaMV35S-EuSWAP70 lines were randomly selected for induction treatment. The treatments are as follows: 200 µmol/L ethylene for 3 h, 75 µmol/L SA for 3 h, attachment of gray mold cake for 3 h after 200 µmol/L ethylene induction for 3 h, attachment of gray mold cake for 3 h after 75 µmol/L SA induction for 3 h. Then, one piece of rosette leaf of each lines in all 15 lines was cut off randomly to extract total RNA.

Five pieces of leaves from five individual lines (30 to 40 mg) were ground in liquid nitrogen for total RNA isolation by using a UNIQ-10 Column Trizol total RNA isolation kit (Sangon Biotech). The quality and concentration of the total RNA were determined with a NanoDrop 2000C (Thermo Scientific, Waltham, MA, USA) spectrophotometer. Reverse transcription was performed according to the manufacturer’s protocol (a PrimeScript RT reagent kit with gDNA eraser, TaKaRa, Dalian, China) and the cDNA was used for quantitative PCR (qPCR). The cDNA from five individual lines of the wild type and transgenic lines was mixed to use as a reference to evaluate the transcription levels of disease resistance genes. The plant materials of each treatment were in triplicates.

Transcription of the disease resistance gene was evaluated by qPCR using a CFX 96 (Bio-Rad, Hercules, USA) and SYBR Premix Ex Taq^™ II (TaKaRa). The relative expression level was calculated using the EF1-α (AT5G60390) gene and actin 2 (NM_001338359.1) as two internal controls. The ten disease genes are as follows: ChiB(At3g12500, A. thaliana basic endochitinase), WRKY33(818429, A. thaliana WRKY DNA-binding protein 33), MPK6(A. thaliana mitogen-activated protein kinase 6), MPK3(A. thaliana mitogen-activated protein kinase 3), WRKY15(A. thaliana WRKY DNA-binding protein 15), ERF5(A. thaliana ethylene responsive element binding factor 5), WRKY28(A. thaliana WRKY DNA-binding protein 28), NPR1(A. thaliana nonexpressor of pathogenesis-related genes1), EDS4(A. thaliana ADC synthase superfamily protein 4), EuSWAP70(E. ucalyptus grandis switch-associated protein 70, LOC104442285). The primers used are listed in Table 1. The thermal cycling conditions were as follows: initial denaturation step at 95°C for 30 s, 40 cycles at 94°C for 10 s, at 55°C for 10 s, and at 72°C for 15 s. The specificity of the primer pairs was verified by melting curve analysis from 65 to 90°C. Quantification of relative changes in gene expression was performed using the 2^−ΔΔCt method as described by Livak and Schmittgen 2001 and Bio-Rad CFX Manager software v.3.1. Values from three independent experiments were calculated based on the transcription of the corresponding gene in wild type, which was normalized to 1.

Table 1

The primer sequences of gene and reference genes
Genes	Upstream primer (5´→3)´	Downstream primers (5´→3´)
EF1-α	TGAGCACGCTCTTCTTGCTTTCA	GGTGGTGGCATCCATCTTGTTAC
Actin2	CTTGCACCAAGCAGCATGAA	CCGATCCAGACACTGTACTTCCTT
ChiB	ATCAGCGCTGCAAAGTCCTTC	GTGCTGTAGCCCATCCACCTG
WRKY33	TGGAGAGAGCATCACACGAC	GTGCTCTGTTTGTGGCGTAA
MPK6	TCCATCAAATCATTCGGTCA	AGTTTGCGTTCAGGAGGAGA
MPK3	ACGTTTGACCCCAACAGAAG	TTCCTCATCCAGAGGCTGTT
WRKY15	AACTCAAAGCCTCTCCACGA	TTCTTCGAGCAATGACAACG
ERF5	ACGTTAACGGTGGAGAGACG	GAGATAACGGCGACAGAAGC
WRKY28	TACGAGGGTCAACACAACCA	CATGTGCAAAGCTTCTTGGA
NPR1	TCGCAAAACAAGCCACTATG	GGCCTTTGAGAGAATGCTTG
EDS4	GGCGGTATCGATGATTCAGT	CGGTTATCACCACCAGCTTT
EuSWAP70	CGAGAAGTGGGTGGAAACAT	CTCTCCTCAGCCCTGACAAC

Measurement of perforation area of leaves inoculated with gray mold treatment

The areas of regions of interest (ROI) of the Arabidopsis leaf images were measured using ImageJ software (Version 1.54g, the National Institutes of Health, USA). Specifically, the leaf image was converted to 8-bit format, and then the threshold 30% was set to measure the area of ROI.

Screening for kanamycin resistance

Kanamycin normally suppresses protein synthesis in plants by binding to the ribosomal complex resulting in bleaching of the plant [35].In plant genetic engineering, one of the most widely used selectable markers is NPT II. Transgenic plants contain NPT II, which catalyzes the phosphorylation of kanamycin and confers resistance to the antibiotic kanamycin [36]. Therefore, kanamycin antibiotic selection was used for the transformation of plants.

The wild-type A. thaliana was transformed by the Agrobacterium-mediated floral dip method. T0 generation seeds were collected, dried, and sterilized. After a 3 d stratification period, seeds were plated on 1/2 MS solid medium containing 50 mg/L kanamycin. Kanamycin-resistant seedlings were easily distinguished from non-resistant seedlings, and the results are shown in Fig.1.

The negative seedlings were inhibited by kanamycin, the plants appeared yellowing and no rosette leaves appeared, and their growth was slow or even stopped; whereas the positive seedlings were able to grow normally on the medium and were healthy; the leaves appeared green and had true leaves, and the plants had developed root systems(Fig.1). A ratio of 729:38 was found between yellowing and green seedlings; Although some wild-type Arabidopsis plants were successfully transformed, there was a low proportion of positive plants. In the same test method, we conducted a resistance screening test for kanamycin screening T1 generation seedlings and found that the proportion of positive plants increased substantially. The ratio of yellowing to green seedlings was 1625:904.

PCR results of A. thaliana transgenic to EuSWAP70 gene induced by two promoters

The DNA of eight 4-week-old T0-generation Arabidopsis leaves was extracted using the Ezup plant genomic DNA extraction kit, and the GWSF fragment was amplified by PCR and analyzed by electrophoresis using wild-type Arabidopsis as the negative control.

The results are shown in Fig.2, total Arabidopsis DNA was extracted from twelve transgenic plants, and the EuSWAP70 fragment was amplified by PCR. The wild-type plants were used as the negative control, and the results are shown in Fig.2(a): all twelve transgenic plants were electrophoresed and isolated a 706 bp EuSWAP70 fragment of uniform size, which was located between 500 bp and 750 bp Marker. This indicates that EuSWAP70 had been successfully transformed into the Arabidopsis genome. In the same experimental method, twelve samples of transplants induced GWSF promoter were electrophoresed in Fig.2(b), and a 200 bp GWSF promoter fragment had separated, which located between 100 bp and 250 bp, indicating that the GWSF promoter in the pCAMBIA1301 vector had been successfully transferred to the Arabidopsis genome.

Fig.2 demonstrated at the molecular level that the GWSF-EuSWAP70 gene had been successfully transformed into T0 generation Arabidopsis.

Gray mold resistance test in A. thaliana with EuSWAP70 transgene

Trypan Blue is a vital stain used to selectively color dead tissues or cells blue in biosciences [37]. A gray mold test was performed on the transgenic plant leaves, and the leaves were stained with trypan blue according to the Saskia method [34].

The incidence of wild-type and transgenic plants after 2, 4, and 6 h of gray mold (B. cinerea) treatment on the rosette leaves of 5-week-old wild-type plants and T3-generation transgenic plants, respectively. The results are shown in Fig.3 and Fig.4.

As can be seen from Fig.3, after 2 h of inoculation with gray mold, the leaves of transgenic plants were infested to a low degree, with no leaf infestation or slight waterlogging; while wild-type Arabidopsis plants was infested to a high degree, with waterlogging and perforation on the leaves.

After 4 h, gray mold further infested the leaves of wild-type plants and the leaf perforations gradually became larger; while the transgenic strain showed a waterlogging phenomenon and the perforations were not obvious. After 6 h, the leaf perforations of the wild-type plants were further enlarged and gradually rotted, while the symptoms of the transgenic plants were similar to those of the wild-type A. thaliana at 4 h. In contrast to wild-type plants, transgenic plants exhibit greater resistance to gray mold, and the occurrence of gray mold is delayed by 2-3 hours.

Furthermore, trypan blue staining was performed on the leaves of different plants with different inoculation treatments. The results are shown in Fig.4. As can be seen in Fig.4, there was no perforation in different plants at 2 h of gray mold inoculation, but at 4 h and 6 h of gray mold treatment, wild-type Arabidopsis plants showed significant perforation symptoms. GWSF-EuSWAP70 transgenic Arabidopsis plants showed almost no perforation symptoms during two periods, whereas in CaMV35S-EuSWAP70 transgenic Arabidopsis plants, about 1/3 of the leaves displayed showed perforation symptoms at 4 h treatment, and almost all of the leaves at 6 h treatment.

The perforation area of the leaves under each treatment was further measured, and a two-way comparison of variances was made by the ratio of perforation area to total leaf area. Fig.5 shows that the differences in perforation area percentage between various plants at different treatment times were very significant, reaching differences at the 0.05 level, and the different Arabidopsis plants were ranked according to the percentage of perforation area as follows: wild-type plants > CaMV35S-EuSWAP70 transgenic plants > GWSF-EuSWAP70 transgenic plants.

The above results indicated that GWSF could regulate the expression of EuSWAP70 after gray mold infestation of transgenic plants, then EuSWAP70 protein initiated the expression of downstream disease-resistance genes to improve gray mold resistance in Arabidopsis.

Transcriptional activity of disease-resistance genes in two transgenic Arabidopsis plants treated with different inducers

The relative expression levels of ten disease-resistance genes in GWSF-EuSWAP70 and CaMV35S-EuSWAP70 transgenic Arabidopsis plants were studied comparatively under different inducers. There was a wide range of expression levels for these genes, ranging from 0.23 to 3.81 without inducer treatment, and their average expression level was 1.32. In GWSF-EuSWAP70 transgenic Arabidopsis plants, their expression levels were higher than in CaMV35S-EuSWAP70 transgenic Arabidopsis plants, especially in NPR1 (nonexpressor of pathogenesis-related gene 1) and ChiB. Both EuSWAP and ChiB genes have high expression levels in two transgenic Arabidopsis plants compared with wild-type plants.

The results in Fig.6 show that the GWSF promoter has a lower background expression than the CaMV35S promoter. Furthermore, both the CaMV35S and GWSF promoter were found to be induced by ethylene, salicylic acid, and B. cinerea. However, it was observed that the GWSF promoter demonstrated a higher level of activity upon induction. These results are consistent with the previous results that GWSF promoter has a low background expression level and a wide range of plant inducers [31].

The expression levels of these disease-resistance genes varied after different inducer treatments (Fig.6). B. cinerea (BC) treatment resulted in a substantial increase in the expression levels of the NPR1 gene and the ChiB gene in GWSF-EuSWAP70 transgenic plants. Similarly, both Eth treatment and Eth+BC treatment resulted in increased expression levels of the ChiB gene. In CaMV35S-EuSWAP70 transgenic plants, only SA+BC treatment resulted in a significant increase in the expression level of the ChiB gene, while BC and Eth treatments only resulted in a small increase in the expression level of the ChiB gene.

For the EuSWAP70 gene in Arabidopsis in Fig.6, the expression levels of EuSWAP70 varied from 2.02 to 6.75 with an average of 15.71 under different inducer treatments. Except for SA treatment, all the other inducer treatments (BC, SA+BC, Eth, and Eth+BC) revealed that the gene expression levels of EuSWAP70 in the CaMV35S-EuSWAP70 transgene Arabidopsis were higher than those of EuSWAP70 in the GWSF-EuSWAP70 transgenic plants.

The cluster analysis results based on these genes' expression levels showed that the disease-resistance genes could be divided into three categories. The ChiB gene significantly distinguished from the other genes and was classified as a separate category; NPR1, EuSWAP70, and EDS4 (enhanced disease susceptibility 4) genes all showed a small increase in gene expression levels and were therefore classified as one category, and the other genes could be divided into two subcategories and finally combined into one category.

A fully factorial randomized block design with three factors, namely two transgenic plants (Factor A-plants), ten disease-resistance genes (Factor B-genes), and six inducer treatments (Factor C-inducers), was employed in this study. Each treatment combination was replicated four times in qPCR analysis. The ANOVA was then analyzed using a two-factor interaction model. The results in Table 2 reveal that the model F-value of 91.85 implies that the obtained model with a coefficient of determination of 0.943 is statistically significant at the 0.001 level. In addition, the p-values of A, B, C, A×B, A×C, and B×C are all less than 0.0001, indicating that these model terms are highly significant. The order of F-values in Factor A, B, and C model terms from high to low is B(493.54)>C(187.85)>A(41.95), so Factor B has the largest effect followed by Factor C, and Factor A has the smallest effect.

Table 2 ANOVA for selected factorial model analysis of variance table

Source	Sum of Squares	Df	Mean	F-value	p-value
Model	394.55	95	4.15	91.85	<0.001
A-plants	1.90	1	1.90	41.95	<0.001
B-genes	267.80	12	22.32	493.54	<0.001
C-inducers	42.47	5	8.49	187.85	<0.001
A×B	2.92	12	0.24	5.39	<0.001
A×C	22.86	5	4.57	101.11	<0.001
B×C	56.59	60	0.94	20.86	<0.001
Residual	23.87	528	0.05

Table 3 The top 15 treatment combinations with the largest relative expression levels based on the obtained models

Number	Plants	Genes	Inducers	Relative expression level	Probability
1	GWSF-EuSWAP70	NPR1	BC	101.06	0.95
2	GWSF-EuSWAP70	ChiB	BC	86.80	0.94
3	GWSF-EuSWAP70	ChiB	Eth	83.30	0.94
4	CaMV35S-EuSWAP70	NPR1	BC	44.34	0.89
5	CaMV35S-EuSWAP70	ChiB	BC	30.89	0.87
6	GWSF-EuSWAP70	ChiB	Eth+BC	28.88	0.86
7	GWSF-EuSWAP70	NPR1	Eth+BC	23.63	0.85
8	CaMV35S-EuSWAP70	ChiB	Eth	22.38	0.84
9	CaMV35S-EuSWAP70	EDS4	SA	20.29	0.84
10	GWSF-EuSWAP70	EDS4	SA+BC	18.08	0.83
11	GWSF-EuSWAP70	EuSWAP70	BC	15.60	0.82
12	GWSF-EuSWAP70	EuSWAP70	Eth	12.84	0.80
13	CaMV35S-EuSWAP70	EDS4	SA+BC	10.28	0.79
14	GWSF-EuSWAP70	WRKY28	Eth+BC	9.25	0.78
15	CaMV35S-EuSWAP70	EuSWAP70	BC	8.78	0.78

Based on the obtained model, various combinations of factors were assessed by maximizing the relative expression level. The results of the top 15 combinations are presented in Table 3. Among these combinations, the highest-ranking one featured the NPR1 gene in the GWSF-EuSWAP70 transgene under BC treatment. According to the model's predictions, this combination had a maximum relative expression level of 101.06, with a corresponding probability of 0.95. The second highest-ranking combination was the GWSF-EuSWAP70 transgene with the ChiB gene under BC treatment. Following that, the GWSF-EuSWAP70 transgene with the ChiB gene under Eth treatment was ranked third.

A comparative analysis of the relative expression levels of the various inducer treatments revealed that the BC treatment exhibited the highest level of gene expression activity. It was followed by the Eth+BC treatment, while the SA+BC treatment ranked fourth, and the SA treatment exhibited the lowest gene expression activity. Notably, when transgenic plants were treated with Eth or SA inducer for 3 hours before BC treatment, a reduction in the expression of disease-resistance genes, particularly NPR1 and CHiB genes, was observed.

In Fig.7, the heat map related to the expression levels of disease-resistance genes in two transgenic Arabidopsis plants under five inducer treatments. In CaMV35S-EuSWAP70 transgenic Arabidopsis plants, there were significant correlations between CK and all the inducer treatments except for the SA inducer treatment. There were also significant correlations between BC and Eth, BC and Eth+BC, SA and SA+BC inducer treatments. Compared with CaMV35S-EuSWAP70 transgenic Arabidopsis plants, significant correlations existed only between the CK and Eth inducer treatments in GWSF-EuSWAP70 transgenic Arabidopsis plants; There were also four groups of inducer treatments (BC and Eth, BC and Eth+BC, SA and SA+BC, Eth and Eth+BC), all of which had significant correlations; except for the BC and Eth inducer group, the correlation coefficients were almost substantially increased.

In comparison to CaMV35S-EuSWAP70 transgenic plants, the GWSF-EuSWAP70 transgenic plants demonstrated decreased background expression and a more efficient activation of disease-resistance genes when exposed to an inducer. Furthermore, treating transgenic plants with SA and Eth resulted in a reduction in their BC-induced disease-resistance gene expression.

EuSWAP70 transgenic Arabidopsis plants and their disease resistance

In this study, the EuSWAP70 gene from E.grandis is used to genetically alter A. thaliana to increase its resistance to pathogens, specifically B. cinerea. We investigated the expression activity and regulation of the EuSWAP70 gene using two promoters, in response to gray mold, ethylene, and salicylic acid. A. thaliana was chosen as the model plant due to the challenges associated with genetically modifying eucalyptus. The study findings suggested that the EuSWAP70 gene, controlled by the GWSF promoter, effectively enhances disease-resistance in Arabidopsis, with potential implications for future eucalyptus applications.

The findings of this study are consistent with previous research on the role of small GTPases and their regulatory proteins in plant immunity. Previous studies have shown that SWAP70 is involved in immune responses in both Arabidopsis and rice. Notably, AtSWAP70 has been shown to contribute to PAMP- and effector-triggered immunity in Arabidopsis [25], while OsSWAP70A and OsSWAP70B are responsible for immune responses in rice through the activation of OsRac1 [28]. However, how does SWAP70 exert its role in woody plants? especially eucalyptus has not been thoroughly investigated.

Antibiotics are widely used as selectable markers in plant transformation systems, and their sensitivity should be determined during the initial stages [38]. The transgenic plants with the kanamycin-resistant NPT II gene were found to be well adapted to the environment containing kanamycin resistance, showing normal leaf development and healthy growth. The percentage of positive plants of transgenic plants in the T1 generation was higher than that of positive plants in the T0 generation after the screening of transgenic plants for resistance to kanamycin. Due to the possibility of false positives associated with antibiotic screening [39], numerous negative plants were identified in the T1 generation.

In T0 transgenic Arabidopsis plants, a qPCR assay for the GWSF-EuSWAP70 gene detected 200 bp fragments of the GWSF promoter, and 706 bp fragments of the EuSWAP70 gene, respectively. These indicated that the GWSF-EuSWAP70 gene had been successfully transformed into T0 generation Arabidopsis. The T3 generation of A. thaliana was tested for gray mold resistance, and all wild-type plants and T3 generation of transgenic plants after inoculation with the gray mold fungus were infested with symptoms of infection with pathogens from low to high levels, i.e., from no leaf infestation or slight waterlogging at the beginning to severe levels of waterlogged, and perforated leaves. The transgenic plants were less infested than the wild-type Arabidopsis (control), had a lower index of waterlogged, perforated leaves, and the onset of gray mold was delayed by 2-3 hours compared to the wild-type plants. Overall, the transgenic Arabidopsis plants showed reduced levels of infection, delayed onset of gray mold symptoms, and reduced severity of gray mold symptoms compared to wild-type plants.

Differential expression of disease-resistance response genes in two Arabidopsis transgenic plants

We further analyzed the expression levels of ten disease-resistance genes in two transgenic Arabidopsis plants, GWSF-EuSWAP70 and CaMV35S-EuSWAP70, to determine if there were any differences between the two transgenic plants and to understand how different inducers affect the expression of these genes. The results show that the expression levels of disease-resistance genes varied under different inducer treatments. The GWSF-EuSWAP70 transgenic plants exhibited higher expression levels of these genes compared to the CaMV35S-EuSWAP70 transgenic plants, especially in the case of NPR1 and ChiB genes. As compared with CaMV35S, the GWSF promoter expressed lower background levels and showed higher levels of activity upon induction. Cluster analysis revealed that the disease-resistance genes could be divided into three categories based on their expression levels. NPR1, SWAP, and EDS4 genes were classified together, while ChiB was categorized separately. Additionally, BC treatment was found to exhibit the highest level of gene expression activity under a variety of inducer treatments, followed by Eth+BC treatment. Treatment of transgenic plants with SA and Eth inducers before BC treatment resulted in lower expression of disease-resistance genes. Based on the findings of our study, it is noteworthy that four out of the thirteen disease-resistance genes, namely ChiB, NPR1, SWAP, and EDS4, exhibited prominent expression levels(Fig.6). This indicates that these genes may play a crucial role in the plant's defense response against diseases.

Chitin, being a primary constituent of the cell wall, plays a crucial role in the growth and development of fungal pathogens, as well as in defense against external stress [40]. Moreover, chitin is recognized as a key signal that triggers natural immunity in plants against pathogen invasion [41]. Chitin, a plant-defense elicitor, activates 118 transcription factor genes and 30 ubiquitin-ligase genes in A. thaliana [42]. The recognition of chitin has been shown to enhance disease-resistance in rice and Arabidopsis [43, 44]. Chitinase is of utmost importance in plant defense against pathogens due to its critical role in breaking down chitin, a major structural component of fungal cell walls [45]. The ChiB gene encodes a chitinase enzyme that is essential for chitin degradation, environmental adaptation, and specific biological processes in various organisms [46]. Our study revealed that the expression level of the ChiB gene exhibited the highest significance among the disease-resistance genes under various inducer treatments. These results suggested that the ChiB gene expression was involved in the recognition of fungal elicitors, which triggered a defense response in the plant, leading to the production of defense-related compounds and the activation of defense genes.

Salicylic acid is a crucial plant hormone that plays a significant role in orchestrating host responses during pathogen infection. Its involvement in activating plant defense mechanisms is well-documented and widely recognized [47]. The NPR1 gene, a key regulator of systemic acquired resistance in plants, plays a crucial role in plant immunity [48]. The NPR1 gene is widely considered to be the primary cellular target or receptor of SA [49], as evidenced by its consistent discovery in genetic screens as a crucial element for SA-induced gene expression and resistance [50, 51]. However, in the presence of abiotic stress or pathogen invasion, plants undergo an accumulation of elevated SA levels [52]. This increased SA triggers the monomerization of the NPR1 protein and subsequently activates the expression of SA-responsive genes through direct interaction with the TGA2 (TGACG cis-element-binding protein 2 ) transcription factor [53].In addition to its role in SA signaling, NPR1 has been found to interact with other hormones, such as ethylene and auxin, to regulate plant growth and development [54, 55].

The EDS4 gene in plants, specifically A. thaliana, contributes to the SA accumulation in response to pathogen attack and plays a crucial role in the SA-induced activation of defense responses [56]. Mutations in the EDS4 gene lead to enhanced susceptibility to infection by bacterial pathogens like Pseudomonas syringae [56]. The responses mediated by the genes EDS4, EIN2, JAR1, PAD2, and PAD3 on primary infected leaves influenced the rate of development of B. cinerea disease symptoms [57].EDS4 plays a key role in regulating defense responses, possibly through its effects on SA and the jasmonic acid (JA) signaling pathways [56, 58].

Based on the aforementioned research, it is evident that both NPR1 and EDS4 genes play a role in the SA signaling system. Our research findings revealed a noteworthy increase in the expression levels of both NPR1 and EDS4 genes following BC treatment. Furthermore, the expression of these genes was closely associated with the promoters of the transgenes. In comparison to the CK without any inducer treatment in the same transgenic plants, the SA treatment resulted in a slight increase in the expression of NPR1 and EDS4 genes in both transgenic plants. However, the SA+BC treatment resulted in a more substantial increase in the expression of NPR1 and EDS4 genes. The SA treatment had a substantial impact on reducing the expression levels of NPR1 and EDS4 genes in the transgenics under BC treatment. Our results were consistent with previous findings that exogenously applied SA reduced gray mold fungal damage through an NPR1-dependent mechanism [57]. Additionally, SA, Eth, JA, and several other regulatory genes play a role in controlling the plant response to pathogen infection [59]. Arabidopsis's local resistance to B. cinerea requires Eth-, JA-, and SA-mediated signaling [57].

The relationship between ethylene and salicylic acid in the disease-resistance defense system is complex and involves antagonistic interactions [60, 61]. Ethylene modulates the role of NPR1 in the SA-JA signal interaction, rendering SA/NPR1-dependent defense responses NPR1-independent [62].

Our findings revealed that the expression of the ChiB gene was significantly and substantially increased in both transgenic plants treated with Eth, compared to the CK transgenic plants. Additionally, the expression levels of the EuSWAP70 and EDS4 genes were also significantly and marginally increased in these transgenic plants. Conversely, the expression levels of ChiB, SWAP, EDS4, and NPR1 were substantially reduced under Eth treatment, as compared to BC treatment. In the CaMV35S-EuSWAP70 transgenic Arabidopsis, Eth+BC treatments resulted in an expression reduction of ChiB, SWAP, and EDS1, as compared to Eth treatment. Moreover, the expression levels of ChiB, SWAP, EDS4, and NPR1 were greatly reduced in both transgenic plants under Eth treatment, when compared to the BC treatment. Finally, in CaMV35S-EuSWAP70 transgenic Arabidopsis plants, the Eth+BC treatment led to a reduction in the expression levels of ChiB, SWAP, and EDS4, as compared to the Eth treatment. In both transgenic plants, except the ERF5 gene under Eth treatment, the expression levels of nearly ten disease-resistance genes were found to be higher in GWSF-EuSWAP70 transgenic Arabidopsis plants compared to CaMV35S-EuSWAP70 transgenic Arabidopsis plants, both under Eth treatment and Eth+BC treatment. Based on our results of the gray mold resistance test, we could conclude that SA and Eth, along with their regulatory genes, play a significant role in regulating the response of GWSF-EuSWAP70 transgenic Arabidopsis plants to gray mold infection.

Comparing the two transgenic plants, we observed distinct expression patterns. In CaMV35S-EuSWAP70 transgenic Arabidopsis plants, the expression levels of ChiB, SWAP, and EDS4 were significantly reduced by the Eth+BC treatment compared to the SA+BC treatment. However, in GWSF-EuSWAP70 transgenic Arabidopsis plants, only the SWAP and EDS4 genes exhibited substantial reduction. Notably, the NPR1 gene showed higher expression in both transgenic plants under the Eth+BC treatment compared to the SA+BC treatment. This suggested that the NPR1 gene behaved differently from the other three genes, ChiB, SWAP, and EDS4, indicating its potential involvement in the SA-JA/Eh signaling interaction.

Due to the influence of factors such as treatment concentration, treatment time, and the mechanism of resistance to BC, it is challenging to determine which of the SA or Eth treatment has a greater impact on the resistance of BC.

Response of EuSWAP70 transgenic Arabidopsis plants to BC treatment

Plant innate immunity is comprised of two main defensive mechanisms: pathogen-associated molecular pattern-triggered immunity (PTI) and effector-triggered immunity (ETI). Signal exchange and recognition occur through the interaction of messenger and hormone molecules, which then initiate plant defensive responses [63].In the resistant host-pathogenic microbe system, cell-surface-localized PRR(pattern-recognition receptor) directly recognizes PAMPs(pathogen-generated pathogen-associated molecular pattern), such as calcium (Ca²⁺) input, ROS production, and MAPK activation. Subsequent activation of SA or JA/Eth signaling pathways leads to the expression of resistance-related genes and the activation of plant resistance [63].

Rho proteins, small GTP-binding proteins in plants regulate cytoskeletal dynamics, affecting cell division, growth, morphogenesis, and pathogen defense, with unique structures and functions [64]. Rho GTPases, particularly ROPs(Rho-related GTPases from plants) trigger hydrogen peroxide production, which is a key component of the oxidative burst associated with cell death and defense against pathogens [64, 65]. These molecular switches are involved in signaling pathways that modulate the plant's cytoskeleton, oxidative burst, and other defense mechanisms. There is accumulating evidence that ROP signaling is positively controlled by plant receptor kinases, through the Rho guanine nucleotide exchange factor proteins [66].

SWAP70 is a GEF known for its involvement in regulating membrane ruffling signaling [21]. In Arabidopsis, SWAP70 has been identified as a regulatory protein that plays a crucial role in controlling immune responses [25]. SWAP70A and SWAP70B from rice involved in chitin elicitor-induced defense gene expression and ROS production [28].

We cloned a new EuSWAP70 gene from E. grandis and used the two promoters to analyze the function of the EuSWAP70 gene in transgenic Arabidopsis plants. Both transgenic Arabidopsis plants exhibited good resistance to gray mold infection. These results indicated EuSWAP70 gene plays a role in modulating the plant's defense mechanisms. Differential expression of disease-resistance genes was observed in the two Arabidopsis transgenic plants when subjected to various inducer treatments. These differences in disease-resistance can be attributed to the variations in promoter activity between the two transgenic plants. The distinct activities of the promoters influenced the expression levels of disease-resistance genes, ultimately leading to variations in the plant's response to disease. The GWSF promoter displays a low level of basal expression and can be effectively induced by salicylic acid, ethylene, and gray mold. Notably, the induction by gray mold exerts the most prominent impact, thereby serving as the primary driver of enhanced disease-resistance in GWSF transgenic Arabidopsis plants when compared to CaMV35S transgenic Arabidopsis plants.

Despite the resemblance between AtSWAP70 and human SWAP70 Rho GEF in terms of characteristics, there exist differences in their amino acid sequences(NM 015055.4 B cell and NM 001297714.2 B cell in Fig.8), which consequently affect the similarity of their structural domains [25]. Regarding the EuSWAP70 gene under investigation, its amino acid sequence significantly deviates from that of A. thaliana, with an identity and similarity of 80% and 60% respectively. From the SWAP70 molecular Phylogenetic tree(Fig.8), E.grandis (XM 010037630.3 and XM 018876261.2) showed the highest similarity with those from Rhodamnia argentea(XM 030662914.2) and Syzygium oleosum( XM 030607091.2), and A. thaliana (NM 179824.4) clustered into one subgroup, while those from rice ( XM 015775316.2 Oryza sativa and XM 052294296.1 Oryza glaberrima ) clustered with A. thaliana (NM 179824.4 Arabidopsis thaliana), and woody plants such as poplar. Based on the results that EuSWAP70 transgenic Arabidopsis plants are more resistant to gray mold than wild-type Arabidopsis plants, we hypothesized that EuSWAP70 had a SWAP70 function that is different from that of other plants such as Arabidopsis.

SWAP70 is involved in mitochondrial redox signaling, which alters in response to changes in reactive oxygen species (ROS) or the redox state of a responsive group. SWAP70, like other proteins involved in redox signaling, likely participates in redox reactions through the modification of cysteine residues. However, the specific role of EuSWAP70 in redox reaction signaling systems, relative to other SWAP70 proteins, is currently unclear.

Our experiment has demonstrated that the GWSF-EuSWAP70 gene has the potential to enhance gray mold resistance in herbaceous plants, specifically A. thaliana, and shows promise for application in transgenic disease-resistance breeding. However, further investigation is required to determine whether the expression of this disease-resistance gene in eucalyptus plants, can be induced by different inducer treatments including gray mold. Pathogens belonging to the Phytophthora genus are known to cause diseases in a wide range of host plants. The pathogens of the genus phytophthora are capable of producing phytophthora and infecting a plant host to cause disease, and have a wide range of host plants. In addition to gray mold, eucalyptus pathogens such as Ralstonia solanacearum, Sclerotinia sclerotiorum, Phytophthora., etc.

Although the GWSF promoter used in this study exhibits a broad inducer range and can be activated by various pathogenic bacteria, the transgenic GWSF-EuSWAP70 plants in this study also showed a response to SA and Eth inducers. However, it remains unclear whether these plants possess robust resistance against other pathogenic bacteria such as Ralstonia solanacearum, Penicillium, or Phytophthora. Although the GWSF promoter we used has a wide range of inducers and can be induced by a variety of pathogenic bacteria, the GWSF-EuSWAP70 transgenic plants in this study also showed response to salicylic acid and ethylene inducers, but it is still unknown whether they have strong resistance to other pathogens such as Penicillium, or Phytophthora.

The homologous sequence was from the NCBI website. The tree was generated using MEGA 11 software using the maximum likelihood method. The blue background in the plot shows the B cells of Homo sapiens.

The objective of this study is to examine the function of the EuSWAP70 gene in improving the ability of eucalyptus plants to resist diseases. We successfully transformed Arabidopsis plants with the EuSWAP70 gene induced by the two promoters. The results provide preliminary evidence that the EuSWAP70 gene can be effectively introduced into plants and potentially improve their B. cinerea resistance. This work makes a substantial contribution to our understanding of the molecular mechanisms that are involved in plant defense systems and the function of SWAP70 genes in disease-resistance in woody plants. Future studies could explore the effectiveness of the EuSWAP70 gene in enhancing disease-resistance in eucalyptus trees and evaluate its impact on plant growth, development, and quality.

Actin 2: a gene encoding actin

ANOVA: analysis of variance

AtSWAP70: A. thaliana SWAP70

BC: Botrytis cinerea treatment

C4H: cinnamate 4-hydroxylase

CaMV35S: the Cauliflower Mosaic Virus 35S (CaMV 35S) promoter

cDNA: complementary DNA

ChiB: basic endochitinase

Cry3A: an insect-resistant gene from Bacillus thuringiensis encodes a δ-endotoxin

Df: degree of freedom

EDS4: ADC synthase superfamily protein 4

EF1-α: elongation factor 1-alpha

ERF5: ethylene responsive element binding factor 5

Eth: ethylene

ETI: effector-triggered immunity

EuSWAP70 : a SWAP70 gene derived from E. grandis

GAPs:GTPase-activating proteins

GDIs: guanine nucleotide dissociation inhibitors

GDP:guanosine diphosphate

GEF: guanine nucleotide exchange factor

GTP: guanosine triphosphate

GTPases: a superfamily of enzymes that function as molecular switches in various cellular processes

GWSF: an ideal artificial promoter contains four pathogen-inducible cis-elements

HAL2: halotolerant gene 2

JA: jasmonic acid

MAPK: mitogen-activated protein kinase

MPK3: mitogen-activated protein kinase 3

MPK6: mitogen-activated protein kinase 6

MS medium: Murashige and Skoog medium

NPR1: nonexpressor of pathogenesis-related genes1

NPTII: neomycin phosphotransferase II

NRL1:a host susceptibility factor( NPH3/RPT2-Like Protein 1)

OsRac1: Oryza sativa Rac1

OsSWAP70: Oryza sativa SWAP70

PAMPs: pathogen-associated molecular patterns

PRR: pattern-recognition receptor

PTI: pathogen-associated molecular pattern-triggered immunity

qPCR: quantitative polymerase chain reaction

Rac: a unique subfamily of Rho GTPases

Rac1: one of the seven Rac/Rop GTPases found in rice

Ras: a guanosine-nucleotide-binding protein.

Rho: a family of small (~21 kDa) signaling G proteins, and is a subfamily of the Ras superfamily

Rho:Ras homologous protein

RNA: ribonucleic acid

ROI: Region of Interest

ROPs: Rho-related GTPases from plants

ROS: reactive oxygen species

SA: salicylic acid

Rho:a family of Small GTP-binding proteins

SWAP70: Switch-associated protein 70

WRKY15: WRKY DNA-binding protein 15

WRKY28: WRKY DNA-binding protein 28

WRKY 33: WRKY DNA-binding protein 33

Authors’ contributions:

Zhenchi Huang & Shengjian Ma: conceived and designed the experiments, performed the experiments, analyzed the data, and wrote the paper; Fenglian Cai, Lichun Li, and Xiaoming Li: performed the experiments; Zhihua Wu: analyzed the data; wrote the paper, authored or reviewed drafts of the paper, and approved the final draft. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Natural Science Foundation of Guangdong Province, China (No. 2024A1515010649).

Declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Data Availability Statement

Not applicable

Acknowledgments

We would like to thank the editors and anonymous reviewers for their constructive comments and suggestions that contributed to the quality of this article.

Stanturf JA, Vance ED, Fox TR, Kirst M. Eucalyptus beyond its native range: Environmental issues in exotic bioenergy plantations. Int J For Res. 2013;(2013):1-5.
Seng Hua L, Wei Chen L, Antov P, Kristak L, Md Tahir P. Engineering Wood Products from Eucalyptus spp. Adv Mater Sci Eng. 2022;2022:e8000780.
Yaojian Xie, ARNOLD RJ, Zhihua Wu, Shuaifei Chen, Apeng Du. Advances in eucalypt research in China. Front Agric Sci Eng. 2017;4(4): 380–390.
Alves AA, Rosado CCG, Faria DA, Guimarães LM da S, Lau D, Brommonschenkel SH, et al. Genetic mapping provides evidence for the role of additive and non-additive QTLs in the response of inter-specific hybrids of Eucalyptus to Puccinia psidii rust infection. Euphytica. 2012;183:27–38.
Wingfield MJ, Roux J, Slippers B, Hurley BP, Garnas J, Myburg AA, et al. Established and new technologies reduce increasing pest and pathogen threats to eucalypt plantations. For Ecol Manag. 2013;301:35–42.
Carnegie AJ. Forest health condition in New South Wales, Australia, 1996–2005. I. Fungi recorded from eucalypt plantations during forest health surveys. Australas Plant Pathol. 2007;36:213–24.
Mafia RG, Ferreira MA, Zauza EAV, Silva JF, Colodette JL, Alfenas AC. Impact of Ceratocystis wilt on eucalyptus tree growth and cellulose pulp yield. For Pathol. 2013;43:379–85.
Dong OX, Ronald PC. Genetic engineering for disease resistance in plants: recent progress and future perspectives. Plant Physiol. 2019;180:26–38.
van Esse HP, Reuber TL, van der Does D. Genetic modification to improve disease resistance in crops. New Phytol. 2020;225:70–86.
Harcourt RL, Kyozuka J, Floyd RB, Bateman KS, Tanaka H, Decroocq V, et al. Insect- and herbicide-resistant transgenic eucalypts. Mol Breed. 2000;6:307–15.
Thanananta N, Vuttipongchaikij S, Apisitwanich S. Agrobacterium-mediated transformation of a Eucalyptus camaldulensis × E. tereticornis hybrid using peeled nodal-stem segments with yeast HAL2 for improving salt tolerance. New For. 2018;49:311–27.
Mendonça EG, Stein VC, Balieiro FP, Lima CDF, Santos BR, Paiva LV. Genetic transformation of Eucalyptus camaldulensis by agrobalistic method. Rev Árvore. 2013;37:419–29.
Lorence A, Verpoorte R. Gene transfer and expression in plants. Methods Mol Biol. 2004; 267:329-50.
Ali Q, Yu C, Hussain A, Ali M, Ahmar S, Sohail MA, et al. Genome engineering technology for durable disease resistance: recent progress and future outlooks for sustainable agriculture. Front Plant Sci. 2022;17;13:860281.
Dietz-Pfeilstetter A. Stability of transgene expression as a challenge for genetic engineering. Plant Sci. 2010;179:164–7.
Hua L, Yong C, Zhanquan Z, Boqiang L, Guozheng Q, Shiping T. Pathogenic mechanisms and control strategies of Botrytis cinerea causing post-harvest decay in fruits and vegetables. Food Qual Saf. 2018;2:111–9.
Seyb A. Botrytis cinerea inoculum sources in the vineyard system. PhD Thesis. Lincoln University; 2004.
Liu Q, Li G, Li J, Chen S. Botrytis eucalypti, a novel species isolated from diseased eucalyptus seedlings in South China. Mycol Prog. 2016;15:1057–79.
Etienne-Manneville S, Hall A. Rho GTPases in cell biology. Nature. 2002;420:629–35.
Baranov MV, Revelo NH, Dingjan I, Maraspini R, Ter Beest M, Honigmann A, et al. SWAP70 organizes the actin cytoskeleton and is essential for phagocytosis. Cell Rep. 2016;17:1518–31.
Shinohara M, Terada Y, Iwamatsu A, Shinohara A, Mochizuki N, Higuchi M, et al. SWAP-70 is a guanine-nucleotide-exchange factor that mediates signalling of membrane ruffling. Nature. 2002;416:759–63.
Masat L, Caldwell J, Armstrong R, Khoshnevisan H, Jessberger R, Herndier B, et al. Association of SWAP-70 with the B cell antigen receptor complex. Proc Natl Acad Sci. 2000;97:2180–4.
Sivalenka RR, Jessberger R. SWAP-70 Regulates c-kit-Induced mast cell activation, cell-cell adhesion, and migration. Mol Cell Biol. 2004;24:10277–88.
Pearce G, Angeli V, Randolph GJ, Junt T, Von Andrian U, Schnittler H-J, et al. Signaling protein SWAP-70 is required for efficient B cell homing to lymphoid organs. Nat Immunol. 2006;7:827–34.
Yamaguchi K, Kawasaki T. Function of Arabidopsis SWAP70 GEF in immune response. Plant Signal Behav. 2012;7:465–8.
Kawasaki T, Koita H, Nakatsubo T, Hasegawa K, Wakabayashi K, Takahashi H, et al. Cinnamoyl-CoA reductase, a key enzyme in lignin biosynthesis, is an effector of small GTPase Rac in defense signaling in rice. Proc Natl Acad Sci. 2006;103:230–5.
Kawasaki T, Henmi K, Ono E, Hatakeyama S, Iwano M, Satoh H, et al. The small GTP-binding protein Rac is a regulator of cell death in plants. Proc Natl Acad Sci. 1999;96:10922–6.
Yamaguchi K, Imai K, Akamatsu A, Mihashi M, Hayashi N, Shimamoto K, et al. SWAP70 functions as a Rac/Rop guanine nucleotide-exchange factor in rice. Plant J. 2012;70:389–97.
He Q, Naqvi S, McLellan H, Boevink PC, Champouret N, Hein I, et al. Plant pathogen effector utilizes host susceptibility factor NRL1 to degrade the immune regulator SWAP70. Proc Natl Acad Sci. 2018;115:E7834–43.
Wang X, Chen S, Zhang H, Luo P, Zhou F, Zeng B, et al. Agrobacterium-mediated genetic transformation of the most widely cultivated superior clone Eucalyptus urophylla × Eucalyptus grandis DH32-29 in Southern China. Front Plant Sci. 2022;13:1011245.
Huang ZC, Peng S, Li H, Zeng FH. Transcriptional properties of eight synthetic pathogen-inducible promoters in transgenic Arabidopsis thaliana. Biol Plant. 2017;61:389–93.
Chen H, Nelson RS, Sherwood JL. Enhanced recovery of transformants of Agrobacterium tumefaciens after freeze-thaw transformation and drug selection. BioTechniques. 1994;16:664–8, 670.
Zhang X, Henriques R, Lin S-S, Niu Q-W, Chua N-H. Agrobacterium-mediated transformation of Arabidopsis thaliana using the floral dip method. Nat Protoc. 2006;1:641–6.
Van Wees S. Phenotypic Analysis of Arabidopsis Mutants: Trypan blue stain for fungi, oomycetes, and dead plant cells. Cold Spring Harb Protoc. 2008;2008:pdb.prot4982.
Das A, Shukla A, Thakur S, Rathore M, Singh NP. Estimation of neomycin phosphotransferase-II (NPT-II) protein in vegetative and reproductive tissues of transgenic chickpea (Cicer arietinum L.) and biosafety perspectives. J Plant Biochem Biotechnol. 2020;29:568–70.
Mentewab A, Stewart CN. Overexpression of an Arabidopsis thaliana ABC transporter confers kanamycin resistance to transgenic plants. Nat Biotechnol. 2005;23:1177–80.
Kim D-U, Han JW, Jung SJ, Lee SH, Cha R, Chang B-S, et al. Comparison of alcian blue, trypan blue, and toluidine blue for visualization of the primo vascular system floating in lymph ducts. Evid Based Complement Alternat Med. 2015;2015:1–8.
Escandon AS, Hahne G. Genotype and composition of culture medium are factors important in the selection for transformed sunflower (Helianthus annum) callus. Physiol Plant. 1991;81:367–76.
Wang Z, Li L, Ouyang L. Efficient genetic transformation method for eucalyptus genome editing. PLOS ONE. 2021;16:e0252011.
Kombrink A, Sánchez-Vallet A, Thomma BPHJ. The role of chitin detection in plant–pathogen interactions. Microbes Infect. 2011;13:1168–76.
Genevieve Pentecost JW. Potential application of chitin signaling in engineering broad-spectrum disease resistance to fungal and bacterial pathogens in plants. Adv Crop Sci Technol. 2013;1:103.
Libault M, Wan J, Czechowski T, Udvardi M, Stacey G. Identification of 118 Arabidopsis transcription factor and 30 ubiquitin-ligase genes responding to Chitin, a plant-defense elicitor. Mol Plant-Microbe Interactions. 2007;20:900–11.
Kishimoto K, Kouzai Y, Kaku H, Shibuya N, Minami E, Nishizawa Y. Perception of the chitin oligosaccharides contributes to disease resistance to blast fungus Magnaporthe oryzae in rice: Enhancement of MAMP signaling improves resistance. Plant J. 2010;64:343–54.
Wan J, Tanaka K, Zhang X-C, Son GH, Brechenmacher L, Nguyen THN, et al. LYK4, a lysin motif receptor-like kinase, is important for chitin signaling and plant innate immunity in Arabidopsis. Plant Physiol. 2012;160:396–406.
Zhu M, Lu S, Zhuang M, Zhang Y, Lv H, Ji J, et al. Genome-wide identification and expression analysis of the Brassica oleracea L. chitin-binding genes and response to pathogens infections. Planta. 2021;253:80.
Liu Z, Yu W, Zhang X, Huang J, Wang W, Miao M, et al. Genome-wide identification and expression analysis of chitinase-like genes in Petunia axillaris. Plants. 2022;11:1269.
Lefevere H, Bauters L, Gheysen G. Salicylic acid biosynthesis in plants. Front Plant Sci. 2020;11:338.
Pajerowska-Mukhtar KM, Emerine DK, Mukhtar MS. Tell me more: roles of NPRs in plant immunity. Trends Plant Sci. 2013;18:402–11.
Spoel SH, Dong X. Salicylic acid in plant immunity and beyond. Plant Cell. 2024;36:1451–64.
Shah J, Tsui F, Klessig DF. Characterization of a Salicylic Acid- Insensitive Mutant ( sai1 ) of Arabidopsis thaliana, Identified in a selective screen utilizing the SA-Inducible expression of the tms2 Gene. Mol Plant-Microbe Interactions. 1997;10:69–78.
Ryals J, Weymann K, Lawton K, Friedrich L, Ellis D, Steiner HY, et al. The Arabidopsis NIM1 protein shows homology to the mammalian transcription factor inhibitor I kappa B. Plant Cell. 1997;9:425–39.
Hu Y, Zhi L, Li P, T. Hancock J, Hu X. The role of salicylic acid signal in plant growth, development and abiotic stress. Phyton-Int J Exp Bot. 2022;91:2591–605.
Ding Y, Sun T, Ao K, Peng Y, Zhang Y, Li X, et al. Opposite roles of salicylic acid receptors NPR1 and NPR3/NPR4 in transcriptional regulation of plant immunity. Cell. 2018;173:1454-1467.e15.
Huang P, Dong Z, Guo P, Zhang X, Qiu Y, Li B, et al. Salicylic acid suppresses apical hook formation via NPR1-mediated repression of EIN3 and EIL1 in Arabidopsis. Plant Cell. 2020;32:612–29.
Li A, Sun X, Liu L. Action of salicylic acid on plant growth. Front Plant Sci. 2022;13:878076.
Gupta V, Willits MG, Glazebrook J. Arabidopsis thaliana EDS4 contributes to salicylic acid (SA)-dependent expression of defense responses: evidence for inhibition of jasmonic acid signaling by SA. Mol Plant-Microbe Interactions. 2000;13:503–11.
Ferrari S, Plotnikova JM, De Lorenzo G, Ausubel FM. Arabidopsis local resistance to Botrytis cinerea involves salicylic acid and camalexin and requires EDS4 and PAD2 , but not SID2 , EDS5 or PAD4. Plant J. 2003;35:193–205.
Shapiro AD, Zhang C. The Role of NDR1 in avirulence gene-directed signaling and control of programmed cell death in Arabidopsis. Plant Physiol. 2001;127:1089–101.
Huang Z, Yeakley JM, Garcia EW, Holdridge JD, Fan J-B, Whitham SA. Salicylic acid-dependent expression of host genes in compatible Arabidopsis-virus interactions. Plant Physiol. 2005;137:1147–59.
Di X, Gomila J, Takken FLW. Involvement of salicylic acid, ethylene and jasmonic acid signalling pathways in the susceptibility of tomato to Fusarium oxysporum. Mol Plant Pathol. 2017;18:1024–35.
Li N, Han X, Feng D, Yuan D, Huang L-J. Signaling crosstalk between salicylic acid and ethylene/jasmonate in plant defense: do we understand what they are whispering? Int J Mol Sci. 2019;20:671.
Yang J, Duan G, Li C, Liu L, Han G, Zhang Y, et al. The crosstalks between jasmonic acid and other plant hormone signaling highlight the involvement of jasmonic acid as a core component in plant response to biotic and abiotic stresses. Front Plant Sci. 2019;10:1349.
Ding L-N, Li Y-T, Wu Y-Z, Li T, Geng R, Cao J, et al. Plant disease resistance-related signaling pathways: recent progress and future prospects. Int J Mol Sci. 2022;23:16200.
Mucha E, Fricke I, Schaefer A, Wittinghofer A, Berken A. Rho proteins of plants – Functional cycle and regulation of cytoskeletal dynamics. Eur J Cell Biol. 2011;90:934–43.
Agrawal GK, Iwahashi H, Rakwal R. Small GTPase ‘Rop’: molecular switch for plant defense responses. FEBS Lett. 2003;546:173–80.
Fehér A, Lajkó DB. Signals fly when kinases meet Rho-of-plants (ROP) small G-proteins. Plant Sci. 2015;237:93–107.

No competing interests reported.

Download PDF

Reviewers agreed at journal
02 Sep, 2024
Reviewers agreed at journal
29 Aug, 2024
Reviewers invited by journal
21 Jul, 2024
Editor invited by journal
16 Jul, 2024
Editor assigned by journal
16 Jul, 2024
Submission checks completed at journal
16 Jul, 2024
First submitted to journal
04 Jul, 2024

You are reading this latest preprint version

GWSF-EuSWAP70 gene expression to enhance gray mold resistance in Arabidopsis thaliana

Status:

Version 1

Abstract

Figures

Introduction

Materials and Methods

Materials,gene and vector construction

Transformation and screen

Disease resistance

Induction treatment and qPCR analyse

Measurement of perforation area of leaves inoculated with gray mold treatment

Results

Discussion

Conclusions

Abbreviations

Declarations

References

Additional Declarations

Status:

Version 1