Effects of PD-L1 Inhibitors on Mitochondrial Function in Melanoma A375 Cells: Unveiling a Shielded Drug Resistance Mechanism

doi:10.21203/rs.3.rs-4684855/v1

Download PDF

Research Article

Effects of PD-L1 Inhibitors on Mitochondrial Function in Melanoma A375 Cells: Unveiling a Shielded Drug Resistance Mechanism

https://doi.org/10.21203/rs.3.rs-4684855/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: Resistance to immune checkpoint inhibitors, particularly PD-L1 inhibitors, poses a significant challenge in cancer treatment by limiting patient survival. The intricate mechanisms underlying this resistance remain poorly understood, highlighting a critical gap in oncology research.

Objective: This study aimed to delve into the regulatory impacts of PD-L1 inhibitors on mitochondrial function within melanoma cells (A375) and explore the potential correlation between PD-L1 resistance and mitochondrial function.

Methods: 1. A375 cells were treated with PD-L1 inhibitors, and the effects on mitochondrial gene expression, respiratory chain complex IV activity, reactive oxygen species (ROS) levels, apoptosis-related genes (BAX and BCL-2) expression, tumor pathogenicity-related indicators (cell viability, migration, and invasion) were observed. 2. Fluorescently labeled mitochondria membrane, cell nucleus, and PD-L1 inhibitors were used in high-resolution confocal microscopy to determine whether PD-L1 inhibitors can enter mitochondria. 3. A375 cells treated with PD-L1 inhibitors were subjected to intervention with mitochondrial respiratory chain inhibitor, succinate carrier inhibitor, to observe the effects on apoptosis-related genes (BAX mRNA and BCL-2 expression), tumor pathogenicity-related indicators (cell viability, migration, and invasion).

Results: 1.Through high-resolution confocal microscopy, it was observed that PD-L1 inhibitors penetrated mitochondria, binding to the cristae of the inner mitochondrial membrane without entering the cell nucleus.2.Treatment with PD-L1 inhibitors resulted in increased mitochondrial gene expression and respiratory chain activity, reduced ROS levels, elevated BAX expression, decreased BCL-2 expression, and diminished tumor migration and invasion in A375 cells.3.Inhibition of mitochondrial respiratory chain function by succinate carrier inhibitors impeded the enhancement of mitochondrial function induced by PD-L1 inhibitors in A375 cells. This led to a sustained increase in BAX expression, a significant decrease in BCL-2 expression, and a notable reduction in cell viability, tumor migration, and invasion.

Conclusion: PD-L1 inhibitors exhibit the capability to penetrate mitochondria, exerting an inhibitory effect on tumor activity in melanoma cells while significantly enhancing mitochondrial function. Disrupting this enhancement of mitochondrial function by PD-L1 inhibitors reverses their overall anti-tumor efficacy, hinting at a novel mechanism of tumor resistance mediated through the regulation of the mitochondrial pathway by PD-L1 inhibitors.

Melanoma

Immunotherapy

Mitochondria

The skin serves as the body's largest organ. Cutaneous malignant tumors are among the most frequently occurring tumors and their incidence is rapidly increasing due to factors such as population aging and environmental degradation^1,2. Malignant melanoma (MM) is a prevalent form of skin cancer and carries the highest mortality rate among skin cancers. In recent years, the prevalence of MM has been escalating, posing an increasingly grave threat to human well-being²^。

Early-stage melanoma can be effectively treated through surgical resection; however, for patients with advanced-stage melanoma, simple surgical removal yields unsatisfactory results. Even with surgical resection, patients with tumor thickness exceeding 4 mm (T4N0M0, AJCC stage BIB-C), or those with regional lymph node or distant metastasis (T1-4N1-3M0, AJCC stage III), experience recurrence rates of 60% to 75% and 5-year survival rates ranging from 30% to 70%^3,4.

Biological therapy offers the potential to diminish the risk of melanoma recurrence or mortality. Immune checkpoint inhibitors, which earned the Nobel Prize in 2018 due to their remarkable therapeutic effects on melanoma and other tumors, play a crucial role. The binding of PD-1 and PD-L1 triggers signaling pathways associated with tumor immune tolerance, a significant mechanism underlying tumor immune evasion. PD-1 inhibitors or PD-L1 inhibitors impede the binding of PD-1 and PD-L1, thus inhibiting the initiation of signaling pathways related to tumor immune tolerance and exerting therapeutic effects on tumors. Among all the effective immune checkpoint inhibitors, PD-L1 inhibitors exhibit a clinical efficacy rate of 30-40% for melanoma, surpassing that of other tumor types⁵. Since 2014, immune therapy targeting PD-1/PD-L1 has demonstrated favorable clinical outcomes in melanoma treatment, effectively extending patient survival time⁵.

Until now, the treatment of tumors, including melanoma, has not achieved ultimate success. Whether it is traditional chemotherapy or more recent immune checkpoint inhibitors, approximately half of the patients develop drug resistance during the course of treatment, leading to a significant number of deaths each year due to treatment failure. Tumor drug resistance mechanisms present a major challenge in the fields of tumor treatment and research, necessitating urgent breakthroughs.

Currently, the identified mechanisms of drug resistance fail to adequately explain the resistance to PD-L1 inhibitors in the treatment of melanoma. Clinical observations still indicate the persistence of drug resistance phenomena, resulting in treatment failure and patient mortality, with effective survival time falling far below expectations. Consequently, it is crucial to thoroughly investigate new mechanisms associated with resistance to immune checkpoint PD-L1 inhibitors.

The mechanism behind the anti-tumor activity of PD-L1 inhibitors lies in their ability to alleviate T cell immune tolerance and restore the tumor-suppressive function of T cells. Essentially, PD-L1 inhibitors function by restoring the immune surveillance capability of immune cells. Previous studies have highlighted the significant role of antibiotic-induced changes in bacteria themselves as a mechanism of bacterial resistance. However, it remains unclear whether PD-L1 inhibitors directly affect tumor cells and whether this is linked to resistance against PD-L1 inhibitors. Currently, there are no available literature reports on this topic. Therefore, exploring the direct impact of PD-L1 inhibitors on tumor cells may offer a novel avenue for investigating potential mechanisms underlying resistance to PD-L1 inhibitor treatment of melanoma.

An increasing number of studies indicate that mitochondrial dysfunction has a clear impact on both the tumor itself and the tumor environmental. It is closely associated with the mechanisms of drug resistance in tumors, involving carcinogenic potential, tumor cell apoptosis, mitochondrial metabolism¹¹, immune evasion, and metastasis^12–14. These factors may be involved in key mechanisms of tumor drug resistance^15,16. We conducted relevant research, and the results have significant implications for exploring the mechanisms of PD-1/PD-L1 inhibitor resistance in melanoma cells.

1.1 Materials

DMEM (Culbertson's Modified Eagle Medium) culture medium and 0.25% trying/EDTA solution were both purchased from Mother Fisher Scientific (USA, New York). BMS-202 (HY-19745) and GW604714X were obtained from Expressiveness. The primary antibody TUBLIN (1:5000) was acquired from Enzyme Biotech (China, Guangzhou). Primary antibodies MT-CO1 (1:1000), MT-ND4 (1:1000), MT-ND5 (1:1000), BAX (1:500), BCL-2 (1:500), and horseradish oxidase-conjugated goat anti-rabbit (1:2500) and goat anti-mouse (1:10000) secondary antibodies were all purchased from Ab cam (UK, Cambridge). The Cy3 fluorescent labeling of BMS-202 was performed by Habitual (China, Guangzhou), and the mitochondrial dye PKMITO DEEP RED was sourced from Bivouacking (China, Nanjing).

1.2 Cell Culture and Drug Treatment

Melanoma cells A375 were acquired from SUNNCELL (China, Wuhan). The cells were cultured in DMEM containing 10% fetal bovine serum (FBS) (Cell Bio FSP500) and 1% antibiotics (penicillin and streptomycin), and maintained in a cell culture incubator at 37°C with 5% CO2. Cells in the logarithmic growth phase were selected for the experiments.

1.3 Cell Viability Assay

The cell proliferation rate of A375 cells was determined using the CCK-8 assay. Cells were seeded in a 96-well plate at a density of approximately 5,000 cells/cm^2 and then incubated. The cells were treated with respective concentrations of BMS-202 and GW drug solutions to observe cell morphology changes. Except for the blank group, 10 μL of CCK-8 solution was added to each well, and the cells were further incubated for 1-2 hours. The optical density (OD) values were measured at a wavelength of 450 nm using a microplate reader. This process determined the cell proliferation rates under different concentration treatments and helped select the optimal experimental concentration for each group.

1.4 Western Blot

Total proteins were extracted using dialysis buffer (RIPA:PMSF = 100:1), and denatured by boiling at 100°C for 8 minutes. Briefly, equal amounts of the extracts were loaded onto ADS-polyacrylamide gels, electroplated, and then transferred to PVDF membranes (Activate, 10600021). The membranes were blocked with 5% skim milk and subsequently incubated with primary antibodies overnight at 4°C. Afterwards, the membranes were incubated with Conjugation secondary antibodies and detected using the Signaler ECL bioluminescence kit (NCM Biotech, P10100). Protein bands were visualized using bioluminescence imaging systems (Syn gene and Annotation). Grayscale values for quantitative analysis were determined using Image software.

1.5 Real-Time Quantitative PCR (Art-PAR) Analysis

Total RNA was extracted from cells，using the RNA easy kit (Enzyme, R701-01), adhering to the guidelines provided by the manufacturer. This was followed by reverse transcription utilizing the Fair III 1st Strand DNA Synthesis Kit (Enzyme, R323-01). Primers were meticulously designed based on gene sequences listed in the NCBI Gen Bank, employing Premier 5.0 software for this purpose. The selected primers encompassed those for MT-CO1, with upstream TATGTTCTATCAATGGGAGC and downstream GTAGTCTGAGTAGCGTCGTG; a-ac tin, with upstream CACAGCTTCTCTTTGATGTCAC and downstream CTACCTCATGAAGATCCTGACC; MT-ND4, with upstream TTCCTCCGACCCCCTAACAA and downstream GATAAGTGGCGTTGGCTTGC; MT-ND5, with upstream CACACCGCACAATCCCCTAT and downstream TGGAGGTGGAGATTTGGTGC; BAX, with upstream CAGCACGGACTTGAACAACC and a complex downstream sequence CTCCACGGAAACAGCTGATGTGCTGCTGCGAGATTATCTGA; BCL-2, with upstream TGCCACCTTTTGACAGTGATG. The Art-PAR assays were conducted on a CFX2 system (Bio-Rad). a-ac tin served as the internal control for normalization, and the relative gene expression levels were quantified employing the 2^-ΔΔCt method, ensuring precise and reliable data analysis.

1.6 Detection of Mitochondrial Respiratory Chain Complex IV and Mn-SOD

Cells were lysed with PBS, and the supernatant was collected after centrifugation. The protein concentration was determined using the BCA protein assay kit. According to the manufacturer's instructions, the mitochondrial respiratory chain Complex IV (MRCCIV) ELISA kit (MEIMIAN, MM-44753M1) and CuZn/Mn-SOD activity assay kit (Beyotime, S0103) were used to extract Complex IV and Mn-SOD from the cells. The OD values were measured at a wavelength of 450nm using a full-wavelength microplate reader (Multiskan SkyHigh, Thermo Fisher Scientific).

1.7 MDA (Malondialdehyde) Detection

Cells were lysed with PBS, and the supernatant was collected after centrifugation. The protein concentration was determined using the BCA protein assay kit. According to the manufacturer's instructions, the MDA detection kit (Beyotime, S0131S) was used to measure the MDA content. The OD values were measured at a wavelength of 532nm using a full-wavelength microplate reader (Multiskan SkyHigh, Thermo Fisher Scientific).

1.8 ATP (Adenosine Triphosphate) Detection

According to the manufacturer's instructions, cells were lysed using an ATP detection lysis buffer. The ATP content in the cells was extracted using the ATP detection kit (Beyotime, S0026). The RLU (Relative Luminescence Unit) values were measured using a full-wavelength fluorescence microplate reader with a luminometric measurement module (Varioskan Flash, Thermo Fisher Scientific).

1.9 Mitochondrial Reactive Oxygen Species (mtROS) Detection

MitoSOX Red, a superoxide indicator, is a novel fluorescent probe that specifically targets and stains live cell mitochondria. Upon oxidation by mitochondrial superoxide, it generates bright red fluorescence. In brief, following the manufacturer's instructions: the supernatant of the cell culture treated with drug was discarded after 24 hours; then, an appropriate amount of Hoechst 33342 live cell staining solution (with a concentration of 5μg/ml) diluted in serum-free medium was added to the cells, and incubated at 37°C in the dark for 15 minutes; afterwards, the cells were washed three times with warm PBS; next, the cells were treated with MitoSOX Red solution (with a concentration of 2.5μM) diluted in serum-free medium, and incubated at 37°C in the dark for 10 minutes; finally, the cells were washed three times with warm PBS. The fluorescence intensity of mtROS was observed and captured using an inverted fluorescence microscope (DMi8, Leica) with an excitation wavelength of 396nm and an emission wavelength of 610nm

2.0 Membrane Potential (∆Ψm) Detection

JC-1 is an ideal fluorescent probe widely used for detecting mitochondrial membrane potential (∆Ψm). When the mitochondrial membrane potential is high, JC-1 aggregates in the mitochondrial matrix to form J-aggregates, producing red fluorescence. On the other hand, when the mitochondrial membrane potential is low, JC-1 remains in a monomeric state and emits green fluorescence. According to the manufacturer's instructions, Seed cells in a 12-well plate and treat them with drugs. Incubate the cells for 24 hours. Discard the supernatant. For the positive control group, add CCCP (10 mM) to the cell culture medium at a 1:1000 dilution to achieve a final concentration of 10 µM. Incubate the cells in the dark for 20 minutes to completely abolish the membrane potential. Incubate the cells with prepared JC-1 working solution at 37°C in the dark for 20 minutes. Wash the cells twice with JC-1 buffer solution. Add 500 µL of serum-free culture medium. Use an inverted fluorescence microscope (DMi8, Leica) to observe and capture images of JC-1 monomers under an excitation wavelength of 490 nm and an emission wavelength of 530 nm. Then, observe and capture images of JC-1 aggregates under an excitation wavelength of 525 nm and an emission wavelength of 590 nm.

2.1 Mitochondrial Localization

Cells were treated with BMS-202 (5 µM) labeled with Cy-3 for 24 hours. After washing three times with warm PBS, PKMITO DEEP RED (250 µM) was diluted to a 1:2500 ratio with preheated medium at 37°C and incubated in the dark for 10 minutes. After washing three times with warm PBS, mitochondria were observed and captured using a super-resolution microscope (SIM, STED).

2.2 Scratch Assay

50,000 cells were seeded in a six-well plate and allowed to adhere until the cell coverage reached 80% or higher. A sterile 200 μL pipette tip was used to scratch a straight line in each well. The medium was then removed, and the cells were washed three times with PBS. For the control group, 2 mL of complete DMEM medium was added, while for the experimental group, BMS-202 and GW were added separately and cultured for an additional 24 hours. The plate was then placed under an inverted microscope for image capture, and the area of the scratch was measured using MShot image Analysis software.

2.3 Tumor Invasion Assay

First, disperse 1×105 cells in 200 μL of serum-free culture medium and seed them in the upper chamber of a transwell insert. The lower chamber should contain 800 μL of DMEM medium supplemented with 10% FBS. Once the cells have fully adhered, replace the serum-free culture medium in the upper chamber with 200 μL for the control group. For the experimental groups, add 5 μM BMS-202 and 10 μM GW separately to the upper chambers, while keeping the lower chambers unchanged. Incubate the cells for 24 hours, then wash the upper chamber with PBS. Next, fix the transwell insert in 4% paraformaldehyde for 15 minutes, followed by another wash with PBS. Proceed to stain the insert with Hematoxylin solution for 15 minutes. Finally, rinse the insert with PBS, place it under a microscope for imaging, and use Image J software to calculate the number of A375 cells that invaded through the insert.

2.Statistics

The experimental results were analyzed using GraphPad Prism 9.0 software (GraphPad Software Inc., San Diego, CA, USA). The significance of differences between two groups was determined using Student's t-test. For comparisons of mean values among multiple groups, one-way analysis of variance (ANOVA) was performed. Pairwise comparisons between groups were conducted using the LSD-t test. All data are presented as mean ± standard deviation (SD). Differences were considered statistically significant at a p-value less than 0.05 (P＜0.05).

Utilizing the succinate carrier inhibitor GW to suppress mitochondrial respiratory chain activity, our data reveal that GW amplifies the BMS-202-induced upregulation of apoptotic proteins BAX, Caspase-3, and Caspase-8 (Figure 4). Additionally, it further decreases the expression level of the anti-apoptotic marker BCL-2 (Figures 4A and 4B)

I. Localization of BMS-202 in Mitochondria

We conducted an experiment where we tagged BMS-202 with cy-3 and analyzed the outcomes. After a 24-hour period, we observed no indication of BMS-202-cy3entering the cell nucleus under low magnification microscopy (Figure 1A). However, with the implementation of super-resolution microscopy SIM, we made an intriguing discovery. Within just 30 minutes, BMS-202-cy3 successfully infiltrated the mitochondria and specifically localized on the inner membrane. Conversely, there was no notable presence of BMS-202-cy3 fluorescence within the cell nucleus (Figure 1B/C). This finding holds significant implications for broader comprehension of BMS-202's biological functionality and its mechanisms of action.

II：Drug concentration and cell viability assay

First of all, we determined the required drug concentrations for the experiment through drug concentration and cell viability assays.

III：The Influence of BMS-202 on Mitochondrial Function

Drug concentration and cell viability assay

Our research demonstrate a significant impact of BMS-202 on mitochondrial function. The experiments reveal that BMS-202 effectively enhances the expression levels of mitochondrial genes MT-CO1, MT-ND4, and MT-ND5 (Figure 2A, B). Additionally, it increases the content of mitochondrial respiratory chain complexes I and IV (Figure 2C), resulting in elevated ATP levels (Figure 2D) and an augmentation of the mitochondrial membrane potential (Figure 2E).We determined the required drug concentrations for the experiment through drug concentration and cell viability assays.

To inhibit mitochondrial respiration, we employed the succinate carrier inhibitor GW. The results indicate that GW can suppress the increase in respiratory chain complexes I and IV induced by BMS-202, thereby mitigating the rise in mitochondrial membrane potential (Figure 2C, E). Furthermore, GW has the ability to reverse the upregulation of mitochondrial gene expression (MT-CO1, MT-ND4, and MT-ND5) caused by BMS-202 (Figure 2A, B). However, it is important to note that GW is unable to counteract the elevation of ATP levels induced by BMS-202 (Figure 2D).

IV: Influence of BMS-202 on Levels of Oxidative Stress

Our research findings indicate that BMS-202 effectively reduces the levels of malondialdehyde (MDA), a product of lipid peroxidation, in melanoma A375 cells (Figure 3A). Additionally, it increases the content of superoxide dismutase (SOD) (Figure 3B), demonstrating its capability to lower intracellular oxidative stress levels. Interestingly, the fluorescence detection of reactive oxygen species (ROS) did not show significant changes in the group treated with BMS-202 (Figure 3C). These results provide strong evidence of BMS-202's ability to reduce intracellular oxidative stress.

To inhibit mitochondrial respiratory chain function, we employed the succinate carrier inhibitor, GW. Remarkably, our data reveal that GW effectively counteracts the elevation of MDA levels and the reduction of SOD levels induced by BMS-202 (Figures 3A and 3B). Furthermore, GW is able to enhance the ROS fluorescence levels, which were unaffected by BMS-202 treatment (Figures 3C and 3D). These findings suggest that GW can modulate the impact of BMS-202 on oxidative stress within cells

V: Impact of BMS-202 on Cellular Apoptosis

Our findings indicate that BMS-202 elevates the expression levels of apoptotic markers BAX, Caspase-3, and Caspase-8 (Figure 4), while concurrently diminishing the expression of the anti-apoptotic protein BCL-2 (Figures 4A and 4B).

VI: Impact of BMS-202 on Cell Migration and Adhesion

Our results indicate that BMS-202 exhibits the ability to effectively decrease the migratory and invasive capabilities of A375 melanoma cells (Figure 4). Notably, when combined with GW, a pyruvate carrier inhibitor that inhibits mitochondrial respiration, it demonstrates even greater reduction in cell migration and invasion (Figure 4). These findings highlight the potential synergistic effect of BMS-202 and GW in suppressing the metastatic properties of melanoma cells.

Melanoma is a type of skin cancer that arises from the malignant transformation of melanocytes, the cells responsible for producing the pigment melanin. It can occur on the skin, mucous membranes, and even internal organs. Although melanoma accounts for only 7% of all skin cancer cases, it is responsible for more than 90% of skin cancer-related deaths, making up about 65% of all deaths caused by skin cancer. Melanoma poses a significant threat to individuals affected by the disease.

Although immune checkpoint inhibitors, such as PD-1 monoclonal antibodies, have been widely recognized as effective treatments for melanoma, their use is based on evidence-based medicine and has shown to extend patients' progression-free survival and this breakthrough in cancer therapy was honored with the 2018 Nobel Prize. However, clinical studies have revealed that PD-L1 inhibitors therapy alone cannot eradicate all tumor cells in patients. It demonstrates better tumor suppression effects in the early stages of treatment, but after 1–2 years, most patients develop resistance, leading to tumor regrowth, proliferation, metastasis, and ultimately patient death. The significant problem faced in the treatment of malignant tumors, including melanoma, is the development of resistance to PD-1 monoclonal antibodies, which urgently needs to be addressed in clinical practice¹⁷.

Mitochondria are semi-autonomous organelles enclosed by a double phospholipid membrane that exist in eukaryotic cells. They possess their own genetic material and genetic system, with a relatively small genome. Human mitochondrial DNA contains 37 genes. Mitochondria regulate cell growth and the cell cycle in response to environmental changes.

In fact, mitochondria originated from ancient cyanobacteria and their primary characteristic is the ability to perform aerobic respiration and provide energy. During a significant change on Earth when marine algae produced a large amount of oxygen, creating an environment where cells required aerobic respiration to survive, cyanobacteria were engulfed by eukaryotic cells to perform aerobic respiration and provide energy, establishing a symbiotic relationship. Particularly during long-term evolution, mitochondria underwent gene exchange with the cell nucleus and eventually became fully integrated as organelles within eukaryotic cells. The process of symbiosis demonstrates the highly functional and adaptive nature of mitochondria, enabling them to adapt to external changes and maintain cell survival.

To investigate the involvement of PD-L1 inhibitors in mitochondrial pathway regulation, we conducted observations and studies using high-resolution con focal microscopy. Our visualization study provides the first clear images showing that after entering the cell, PD-L1 inhibitors can penetrate the double hospholipase membrane of mitochondria and enter the mitochondrial matrix. They clearly attach to the sacristan of the inner mitochondrial membrane. Importantly, our results also demonstrate that PD-L1 inhibitors do not enter the nucleus. PD-L1 inhibitors are widely used chemotherapeutic drugs in clinical settings and are known to have significant clinical effects. Their role has primarily been focused on the regulation of T cells and their anti-tumor effects, which occur extracellular.

Currently, the phenomenon of resistance to PD-L1 inhibitors is highly significant and poses a serious threat to cancer patients. The mechanisms underlying PD-L1 inhibitor resistance are far from meeting clinical needs. Limited information is available regarding the biological regulatory effects of PD-L1 inhibitors on tumor cells themselves, and there are no literature reports on the regulation of tumor cell mitochondria by PD-L1 inhibitors^23,24.

Conventional pathology indicates that tumor cells are relatively immature, poorly differentiated, and highly adaptable in the face of adverse conditions such as hypoxia and oxidative stress damage. Therefore, tumor cells likely harbor mechanisms of drug resistance, which should be given due attention. PD-L1 inhibitors play a critical role in tumor therapy, and our results demonstrate for the first time that PD-L1 inhibitors can directly enter mitochondria without entering the nucleus. By entering the mitochondria and influencing gene regulation within this organelle, PD-L1 inhibitors have a series of effects on mitochondrial function. These findings are of great significance and provide a direct basis for further research on the regulation of the mitochondrial pathway by PD-L1 inhibitors and potential mechanisms of resistance.

Our results indicate that after intervention with PD-1 monoclonal antibodies in A375 melanoma cells, there was an increase in the expression of the mitochondrial gene mt-co1 and its corresponding protein. Additionally, the activity of mitochondrial respiratory chain complex IV was enhanced, leading to an increase in ATP production and a decrease in mitochondrial reactive oxygen species (ROS) levels. These findings suggest that PD-L1 inhibitors intervention in A375 cells not only significantly enhances mitochondrial function, from the expression of mitochondrial functional genes to the activity of mitochondrial respiratory chain complex IV, but also reduces mitochondrial oxidative stress damage.

Mitochondria are crucial cellular organelles involved in energy production, biosynthesis, metabolism, and signal transduction. They generate ATP and reactive oxygen species, exerting important effects on cellular functions. Previous studies have demonstrated that mitochondria play a role in tumor development through their involvement in mitochondrial bio genesis and autotroph, dynamics of fission and fusion, cellular susceptibility to death, regulation of oxidative stress, and modulation of metabolism and signal transduction. Mitochondria also confer flexibility to tumor cells, allowing them to survive under adverse environmental conditions, chemotherapy, and targeted cancer treatments by altering fuel utilization, energetically, cellular susceptibility to death, and oxidative stress. Increasing evidence suggests a close relationship between mitochondrial dysfunction and tumor development and drug resistance. It may also present a novel avenue for improving tumor resistance. However, there is limited research on the impact of immune checkpoint inhibitors on mitochondrial function in tumor cells. In-depth investigation of the effects of immune checkpoint inhibitors on melanoma mitochondrial function may uncover new mechanisms of tumor resistance.

Our findings reveal that PD-1 monoclonal antibodies can significantly enhance mitochondrial function in A375 melanoma cells, increasing energy supply and providing favorable opportunities for tumor cell survival.

Our results also indicate that PD-1 monoclonal antibodies not only enhance mitochondrial function but also reduce reactive oxygen species (ROS) levels, thus alleviating oxidative stress damage. Mitochondria are crucial organelles for ROS production and the primary source of cellular oxidative stress. During ATP generation in the mitochondrial respiratory chain, electrons can leak from the respiratory chain, leading to the formation of highly biologically active ROS molecules when they react with oxygen. ROS can impair bio molecules within the cell by binding to them, resulting in oxidative stress damage to the cell.

Our findings reveal that PD-L1 inhibitors intervention enhances mitochondrial function in A375 melanoma cells and increases ATP production. Additionally, it can decrease cellular oxidative damage. Theoretically, this can provide favorable conditions for the survival of A375 cells by reducing oxidative stress.

Our results indicate that PD-L1 inhibitors lead to an increase in the expression of the pro-apoptotic protein BAX1 gene and protein in A375 cells, while the expression of the anti-apoptotic gene BCL-2 gene and protein decreases. These findings suggest that PD-L1 inhibitors can promote apoptosis in melanoma A375 cells, which is beneficial for tumor suppression.

Immune checkpoint therapy uses PD-L1 or PD-1 inhibitors to inhibit the binding of PD-L1 and PD-1 in the extracellular tumor environmental, relieve T cell immune tolerance, allowing T cells to play an immune surveillance role and indirectly exert anti-tumor effects. In immune checkpoint therapy, melanoma shows better efficacy. Our study for the first time confirms that PD-L1 inhibitors can directly suppress the tumor activity of melanoma A375 cells, rather than depending on immune activity or immune surveillance function. Currently, this mechanism is not clear.

Our study also shows that the effect of PD-L1 inhibitors on tumor cell activity may have significant differences at the cellular and acellular mitochondrial levels. At the mitochondrial level, PD-L1 inhibitors enhance the mitochondrial function of the tumor cells, especially the function of the mitochondrial respiratory chain, and reduce oxidative stress damage to the mitochondria, thus theoretically enhancing the activity of the tumor cells. However, at the cellular level, PD-L1 inhibitors significantly inhibit the activity of tumor cells. Combined with the initial mechanism of immune checkpoint therapy, PD-L1 inhibitors can indirectly exert anti-tumor effects by relieving the immune tolerance of T cells outside the cells. Our research results show that as a classical hypnotherapy drug, PD-L1 inhibitors have multi-level effects on tumor cells, and different levels of regulation may lead to inconsistent results, which may be the reason for the low efficacy and high drug resistance of immune checkpoint therapy for tumors. Currently, research on PD-1, its ligated PD-L1, and mitochondria is rare and mainly focused on the effect on the mitochondrial function of T cells. Exploring potential drug resistance mechanisms has important scientific value and clinical significance.

However, mitochondria in the cell possess a double hospholipase membrane, forming a physical barrier that creates a relatively isolated compartment within the cell. This physical segregation is of great significance in protecting the essential physiological functions of mitochondria, but it also poses a physical obstacle for researchers studying the mechanisms involved. Methods such as gene silencing using Sinai require continuous passage through both the cell's hospholipase bi layer and the mitochondrial double membrane. As a result, the biological effects of gene silencing are greatly disrupted, making accurate observations and conclusions challenging. This represents an important barrier in the study of mitochondrial regulatory mechanisms.

Our results confirm that PD-L1 inhibitors are capable of entering mitochondria. However, the mechanisms by which PD-L1 inhibitors enhance mitochondrial function after entering mitochondria are still unclear. Currently, there is limited research on the interaction between PD-1, its ligated PD-L1, and mitochondria²³, with the existing studies mainly focusing on the impact on mitochondrial function in T cells²⁴.

To elucidate the potential biological effects of the series of enhanced mitochondrial functions after PD-L1 inhibitors enter mitochondria in melanoma A375 cells, we conducted a series of observations to investigate the effects of PD-L1 inhibitors on apoptosis and tumor pathogenic in melanoma A375 cells. We also intervened using a mitochondrial respiratory chain inhibitor, an inhibitor of the pyruvate carrier, to explore the impact of PD-L1 inhibitors on the development of resistance in melanoma A375 cells through the mitochondrial pathway.

When we intervened using a mitochondrial respiratory chain inhibitor, an inhibitor of the pyruvate carrier, to study the impact of the mitochondrial pathway of PD-L1 inhibitors on apoptosis in A375 cells, we found that blocking the enhanced mitochondrial respiratory chain activity in A375 cells induced by PD-L1 inhibitors resulted in a sustained decrease in the expression of the anti-apoptotic gene BCL-2 gene and protein. The reverse experimental evidence provided by the pyruvate carrier inhibitor suggests that the regulation of the mitochondrial pathway by PD-L1 inhibitors can attenuate apoptosis in melanoma cells, promoting tumor cell viability, and theoretically enhancing drug resistance in melanoma cells. Our results reveal that PD-L1 inhibitors exert multiple pathways of activity regulation in A375 melanoma cells, with both positive and negative effects. The regulatory effects of the mitochondrial pathway are masked by the overall cellular effects and require reverse experimental evidence using the pyruvate carrier inhibitor to be revealed.

Mitochondria play a role in regulating cell apoptosis. Decreased mitochondrial function, increased reactive oxygen species, enhanced mitochondrial permeability, and monochrome C release leading to cell apoptosis are important pathways in apoptotic cell death25–27. Apoptosis is a fundamental biological process in which cell death is strictly controlled by multiple genes. A crucial characteristic of tumor cells is their inability to undergo normal apoptosis28,29. The main goal of clinical oncology is to develop therapies that promote cell apoptosis and effectively eliminate cancer cells³⁰. The mechanism of immune checkpoint therapy is to induce tumor cell apoptosis by inhibiting T cell immune tolerance, thus achieving therapeutic effects for treating tumors³¹. Therefore, the mitochondrial pathway revealed by PD-L1 inhibitors has significant implications as it enhances the series of mitochondrial functions. Although it may attenuate apoptotic function, the enhanced mitochondrial function provides crucial support for normal cellular physiological activities and reduces oxidative stress damage, thereby minimizing cellular dysfunction. Thus, the mitochondrial pathway mediated by PD-L1 inhibitors provides favorable conditions for the survival of tumor cells by ensuring an adequate supply of resources. However, the ultimate biological effects of this pathway need to be confirmed through longer-term observations.

To further validate the resistance capabilities regulated by PD-L1 inhibitors through the mitochondrial pathway, However, when we pre-date A375 cells with a mitochondrial respiratory chain inhibitor, the pyruvate carrier inhibitor, and then intervened with PD-L1 inhibitors, the results showed the following: compared to the group treated with PD-L1 inhibitors alone, the group of A375 cells pre-date with pyruvate exhibited not only a decline in mitochondrial function but also an acceleration of cell apoptosis. Furthermore, the indicators directly related to tumor pathogenic, such as the scratch assay, representing cell migration capacity, showed a reduction, and the invasion assay, representing cell invasion ability, demonstrated a decrease as well. As a result, the pathogenic of the tumor decreased. These results further confirm the regulatory effect of the mitochondrial pathway by PD-L1 inhibitors and its contribution to tumor resistance.

The results of the intervention with the pyruvate carrier inhibitor are of great significance. In terms of overall cellular regulation, PD-L1 inhibitors have an inhibitory effect on the tumor characteristics of A375 cells. However, the regulatory effect of the mitochondrial pathway by PD-L1 inhibitors is contrary to the overall effect. It can enhance the pathogenic of the tumor and promote resistance to PD-L1 inhibitors. However, due to the strong cellular-level regulatory effect of PD-L1 inhibitors, the regulatory effect on mitochondrial function in A375 cells is masked. The resistance effect mediated by the mitochondrial pathway of PD-L1 inhibitors cannot be directly observed and requires inhibition of mitochondrial respiratory chain function to be revealed.

Mitochondrial function is of crucial importance for cells. Throughout the evolutionary history of animals and plants, organisms that are compatible with mitochondria and have adapted from anaerobic to aerobic respiration have thrived and continued to evolve, while the majority of organisms that are incompatible with mitochondria have been eliminated. An increasing body of research shows that mitochondria play a significant role in tumor development and treatment. Oxidative stress damage originating from mitochondria, as the source, is a major cause of cellular and mechanistic aging. Apoptosis mediated by mitochondria has increasingly become a primary target in cancer treatment³⁰. The relationship between mitochondrial function and tumor occurrence and resistance is closely linked^{12,15,18–20} and could potentially provide new avenues for improving tumor resistance^19,21,22. Mitochondria, through their bio genesis, metabolism, and dynamics, play a critical role in the resistance of cancer stem cells³². In fact, mitochondria originated from ancient bacteria, possessing strong adaptability and functionality. They support cell survival through self-modifications and serve as a driving force for cellular and species evolution³³. In cancer research, studies have demonstrated that heterogeneous DNA genotype are continuously reshaped during successive cytoplasmic divisions. Therefore, over time, tumor tissues from the same individual can generate several genotype with different carcinogenic potentials, leading to the emergence of new drug-resistant tumor strains^14,34. Although nuclear regulation has an impact, mitochondrial function still exerts a tremendous influence on organisms^35,36. Mitochondria are key features in overcoming chemotherapy resistance in cancer, and mitochondrial-targeted drugs hold promising prospects^15,37. The resistance effects manifested through the mitochondrial pathway regulated by PD-L1 inhibitors should not be overlooked.

Especially at present, in clinical practice, PD-L1 inhibitors are used to treat various tumors, including melanoma, by suppressing the uncontrolled growth of tumors. However, this approach .limited, typically ranging from 1 to 2 years, after which resistance to PD-L1 inhibitors may occur. Mitochondria possess high functionality and adaptability. The enhancement of tumor pathogenic through the mitochondrial pathway regulated by PD-L1 inhibitors may be one of the valuable mechanisms contributing to resistance in melanoma. This aspect warrants further investigation.

The mechanisms by which PD-L1 inhibitors enter mitochondria and exert regulatory effects after entering mitochondria are not clear. Currently, there is limited research on PD-1, its ligated PD-L1, and mitochondria^23,24. Some studies have shown that in breast cancer patients treated with facilitate in combination with immune checkpoint inhibitors (ICI), the treatment response to facilitate plus ICI is associated with the acellular redistribution of PD-L1. Tumor samples from patients with good therapeutic efficacy showed that PD-L1 is primarily distributed on the mitochondrial membrane, while in patients with poor therapeutic efficacy, PD-L1 is mainly distributed on the cell membrane rather than the mitochondrial membrane. Further research has demonstrated that the distribution pattern of PD-L1 is regulated by the ATAD3A-PINK1 axis. PINK1 recruits PD-L1 into mitochondria, and ATAD3A can prevent PINK1 from recruiting PD-L1 to the mitochondrial distribution. Therefore, ATAD3A becomes a resistance factor in ICI plus facilitate combination therapy. These findings suggest that PD-L1 enhances the sensitivity of breast cancer to immune checkpoint inhibitor therapy by aggregating in mitochondria³⁸.

Our experiments have demonstrated that PD-L1 inhibitors can enter mitochondria and attach to the sacristan of the inner mitochondrial membrane. Our research also suggests that the regulatory effects of PD-L1 inhibitors through the mitochondrial pathway can promote resistance in A375 melanoma cells. Given that the aggregation of PD-L1 in mitochondria can increase the sensitivity of breast cancer to immune checkpoint inhibitor therapy, and PD-L1 inhibitors are small molecule inhibitors of PD-L1 that antagonize PD-L1 by binding to it, we hypothesize that the regulatory effects of PD-L1 inhibitors through the mitochondrial pathway promote tumor cell resistance through the following mechanism: After entering mitochondria, PD-L1 inhibitors bind to PD-L1 and enhance mitochondrial function, thereby increasing the pathogenic of tumor cells. Essentially, this blocks the action of PD-L1 within mitochondria. This mechanism explains how the regulatory effects of PD-L1 inhibitors through the mitochondrial pathway promote resistance in A375 melanoma cells. This novel mechanism warrants further investigation.

PD-L1 inhibitors have been widely recognized for their clinical efficacy. However, the development of resistance to PD-L1 inhibitors leads to the death of most patients within a limited ragtime, posing a significant clinical challenge that needs to be urgently addressed. Our findings have revealed, for the first time, that PD-L1 inhibitors can enter mitochondria instead of the cell nucleus. PD-L1 inhibitors effectively enhance mitochondrial function, and the regulatory effects of PD-L1 inhibitors through the mitochondrial pathway may represent a novel mechanism of tumor resistance. At the same time, the acellular-level mitochondrial pathway regulation of tumor resistance by PD-L1 inhibitors is overshadowed by the cell-level anti-tumor effects. Considering the excellent functionality and adaptability of mitochondria, especially the ability of tumor cells to adapt to the environment, our future focus lies in whether the tumor resistance effects mediated by the acellular-level mitochondrial pathway regulation of PD-L1 inhibitors can overcome the cell-level anti-tumor effects. Is the resistance of tumor cells to PD-L1 inhibitors through mitochondrial mechanisms a widespread phenomenon? We believe that conducting in-depth research and elucidating the potential resistance mechanisms of PD-L1 inhibitors through the mitochondrial pathway hold significant importance and warrant further investigation.

Conflicts of interest

The research was conducted in the absence of any business or financial relationships that could be construed as potential conflicts of interest.

Source of Funding

This study was supported by the National Nature Science Foundation of China [No.82074172], and the Natural Science Foundation of Guangdong Province, China[No.02820005]，Guangzhou City's Construction Project for Tier-Three Famous Traditional Chinese Medicine Clinics [No.3208203801] and the Zhongnanshan Medical Foundation of Guangdong Province (ZNSA-2020013).

CrediT authorship contribution statement

Xiping Cheng：Writing – review & editing, Funding acquisition, Conceptualization. Fenglan Feng：Validation, Investigation, Data curation,Conceptualization.Zhongrong Liu:Writing – review, Funding acquisition.

Ning Zhang:Validation, Investigation, Data curation.Ruonan Dang:Investigation, Data curation.Zhao Xiaoqing:Investigation, Data curation.Wang Xingrong:Supervision, Resources.Yuqi Yang:Investigation,Supervision:Jinjin Deng:Investigation, Data curation.Wei Meng:Visualization,Investigation.Xinglan Huang: Resources; Software.Shunying Zhang:Resources; Software.Yuqiong Deng:Resources; Software.Caifeng Huang:Supervision.Peng Yan: Software

Sinikumpu, S.-P., Jokelainen, J., Keinänen-Kiukaanniemi, S. & Huilaja, L. Skin cancers and their risk factors in older persons: a population-based study. BMC Geriatr 22, 269 (2022).
WILD, C. P., WEIDERPASS, E. & STEWART, B. W. World Cancer Report: Cancer Research for Cancer Prevention. (International Agency for Research on Cancer, Lyon,France, 2020).
Keung, E. Z. & Gershenwald, J. E. The eighth edition American Joint Committee on Cancer (AJCC) melanoma staging system: implications for melanoma treatment and care. Expert Review of Anticancer Therapy 18, 775–784 (2018).
Enninga, E. A. L. et al. Survival of cutaneous melanoma based on sex, age, and stage in the United States, 1992–2011. Cancer Medicine 6, 2203–2212 (2017).
Vanella, V., Festino, L., Vitale, M. G., Alfano, B. & Ascierto, P. A. Emerging PD-1/PD-L1 antagonists for the treatment of malignant melanoma. Expert Opinion on Emerging Drugs 26, 79–92 (2021).
Bagchi, S., Yuan, R. & Engleman, E. G. Immune Checkpoint Inhibitors for the Treatment of Cancer: Clinical Impact and Mechanisms of Response and Resistance. Annu. Rev. Pathol. Mech. Dis. 16, 223–249 (2021).
Dosset, M. et al. PD-1/PD-L1 pathway: an adaptive immune resistance mechanism to immunogenic chemotherapy in colorectal cancer. OncoImmunology 7, e1433981 (2018).
Zhuang, Y., Liu, C., Liu, J. & Li, G. Resistance Mechanism of PD-1/PD-L1 Blockade in the Cancer-Immunity Cycle. OTT Volume 13, 83–94 (2020).
Gadiot, J. et al. Overall survival and PD‐L1 expression in metastasized malignant melanoma. Cancer 117, 2192–2201 (2011).
Wang, Z. & Wu, X. Study and analysis of antitumor resistance mechanism of PD1/PD‐L1 immune checkpoint blocker. Cancer Medicine 9, 8086–8121 (2020).
Harel, M. et al. Proteomics of Melanoma Response to Immunotherapy Reveals Mitochondrial Dependence. Cell 179, 236-250.e18 (2019).
Vyas, S., Zaganjor, E. & Haigis, M. C. Mitochondria and Cancer. Cell 166, 555–566 (2016).
Grasso, D., Zampieri, L. X., Capelôa, T., Van De Velde, J. A. & Sonveaux, P. Mitochondria in cancer. CST 4, 114–146 (2020).
Wallace, D. C. Mitochondrial DNA Variation in Human Radiation and Disease. Cell 163, 33–38 (2015).
Genovese, I. et al. Mitochondria: Insights into Crucial Features to Overcome Cancer Chemoresistance. IJMS 22, 4770 (2021).
García-Heredia, J. M. & Carnero, A. Role of Mitochondria in Cancer Stem Cell Resistance. Cells 9, 1693 (2020).
Lei, Q., Wang, D., Sun, K., Wang, L. & Zhang, Y. Resistance Mechanisms of Anti-PD1/PDL1 Therapy in Solid Tumors. Front. Cell Dev. Biol. 8, 672 (2020).
Pustylnikov, S., Costabile, F., Beghi, S. & Facciabene, A. Targeting mitochondria in cancer: current concepts and immunotherapy approaches. Translational Research 202, 35–51 (2018).
Han, Y. et al. Tumour microenvironment on mitochondrial dynamics and chemoresistance in cancer. Free Radical Research 52, 1271–1287 (2018).
Fan, M., Shi, Y., Zhao, J. & Li, L. Cancer stem cell fate determination: mito-nuclear communication. Cell Commun Signal 21, 159 (2023).
Chiu, H. Y., Tay, E. X. Y., Ong, D. S. T. & Taneja, R. Mitochondrial Dysfunction at the Center of Cancer Therapy. Antioxidants & Redox Signaling 32, 309–330 (2020).
Rodrigues, T. & Ferraz, L. S. Therapeutic potential of targeting mitochondrial dynamics in cancer. Biochemical Pharmacology 182, 114282 (2020).
Du, F. et al. The role of mitochondria in the resistance of melanoma to PD-1 inhibitors. J Transl Med 21, 345 (2023).
Chamoto, K. et al. Mitochondrial activation chemicals synergize with surface receptor PD-1 blockade for T cell-dependent antitumor activity. Proc. Natl. Acad. Sci. U.S.A. 114, (2017).
Armstrong, J. S. The role of the mitochondrial permeability transition in cell death. Mitochondrion 6, 225–234 (2006).
Armstrong, J. S. Mitochondrial membrane permeabilization: the sine qua non for cell death. Bioessays 28, 253–260 (2006).
Borutaite, V. Mitochondria as decision‐makers in cell death. Environ and Mol Mutagen 51, 406–416 (2010).
Hanahan, D. & Weinberg, R. A. Hallmarks of Cancer: The Next Generation. Cell 144, 646–674 (2011).
Hanahan, D. & Weinberg, R. A. The Hallmarks of Cancer. Cell 100, 57–70 (2000).
Carneiro, B. A. & El-Deiry, W. S. Targeting apoptosis in cancer therapy. Nat Rev Clin Oncol 17, 395–417 (2020).
Shi, W., Yao, X., Fu, Y. & Wang, Y. Interferon‑α and its effects on cancer cell apoptosis (Review). Oncol Lett 24, 235 (2022).
Garimella, S. V., Gampa, S. C. & Chaturvedi, P. Mitochondria in Cancer Stem Cells: From an Innocent Bystander to a Central Player in Therapy Resistance. SCCAA Volume 16, 19–41 (2023).
Gershoni, M., Templeton, A. R. & Mishmar, D. Mitochondrial bioenergetics as a major motive force of speciation. BioEssays 31, 642–650 (2009).
Mazure, N. M., Brahimi-Horn, M. C. & Pouysségur, J. Hypoxic mitochondria: accomplices in resistance. Bulletin du Cancer 98, E40–E46 (2011).
Clancy, D. J. Variation in mitochondrial genotype has substantial lifespan effects which may be modulated by nuclear background. Aging Cell 7, 795–804 (2008).
Cusimano, E. M., Knight, A. R., Slusser, J. G., Clancy, R. L. & Pierce, J. D. Mitochondria: The Hemi of the Cell. Advanced Emergency Nursing Journal 31, 54–62 (2009).
Musicco, C., Signorile, A., Pesce, V., Loguercio Polosa, P. & Cormio, A. Mitochondria Deregulations in Cancer Offer Several Potential Targets of Therapeutic Interventions. IJMS 24, 10420 (2023).
Xie, X.-Q. et al. Targeting ATAD3A-PINK1-mitophagy axis overcomes chemoimmunotherapy resistance by redirecting PD-L1 to mitochondria. Cell Res 33, 215–228 (2023).

No competing interests reported.

Graphicalabstract600dpi.pdf

Download PDF

Version 1

posted

You are reading this latest preprint version

Effects of PD-L1 Inhibitors on Mitochondrial Function in Melanoma A375 Cells: Unveiling a Shielded Drug Resistance Mechanism

Status:

Version 1

Abstract

Figures

Introduction

Materials and Methods

Results

I. Localization of BMS-202 in Mitochondria

II：Drug concentration and cell viability assay

III：The Influence of BMS-202 on Mitochondrial Function

IV: Influence of BMS-202 on Levels of Oxidative Stress

V: Impact of BMS-202 on Cellular Apoptosis

VI: Impact of BMS-202 on Cell Migration and Adhesion

Disscusion

Conclusion

Declarations

Conflicts of interest

Source of Funding

CrediT authorship contribution statement

References

Additional Declarations

Supplementary Files

Status:

Version 1