MiR-221 represents an innovative bio-marker in cervical carcinoma detection

doi:10.21203/rs.3.rs-46927/v1

Download PDF

Research article

MiR-221 represents an innovative bio-marker in cervical carcinoma detection

https://doi.org/10.21203/rs.3.rs-46927/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

MiR-221 has been identified to play an important role in tumorigenesis and progression. In the present study, we aimed at to investigate the expression pattern of serum miR-221 and evaluate its diagnostic value in cervical cancer.

Methods

Quantitative real-time polymerase chain reaction (qRT-PCR) was used to measure the expression pattern of miR-221 in cervical cancer patients and healthy controls. The association of miR-221 with clinicopathological data was analyzed with χ² test. Then receiver operating characteristic (ROC) curve was built to evaluate the diagnostic value of serum miR-221 by calculating the area under the ROC curve (AUC).

Results

The results indicated that the miR-221 expression level was statistically elevated in cervical cancer patients compared with healthy individuals. The increased miR-221 expression was significantly associated with lymph node metastasis (P = 0.026) and FIGO stage (P = 0.028). ROC curve suggested that serum miR-221 had a high diagnostic value in differentiating cervical cancer patients from healthy controls with AUC of 0.932 (95%CI: 0.903–0.960) corresponding with sensitivity of 77.6% and specificity of 94.8%.

Conclusions

Taken together, the expression level of miR-221 is increased in cervical carcinoma and it may serve as a promoting bio-marker in the diagnosis of cervical cancer patients.

Cancer Biology

Oncology

MiR-221

Cervical cancer

Diagnosis

Cervical cancer is the second most common gynaecological malignancy after breast cancer in the world. Due to the delayed initial screening about 265,000 deaths from cervical cancer, especially in the developing countries, which representing a healthy threaten for women [1, 2]. At present, a series of risk factors have been found to play important roles in the occurrence of cervical cancer, such as life style, hormonal contraceptives, immunosuppression or certain infections, especially human papilloma virus (HPV) [3–7]. However, the morbidity and mortality of cervical cancer are still increasing in the developing countries, and the patients tend to be younger [8]. Screening is the current treatment for early detection of cervical cancer, but those patients who are too young to benefit from screening are usually diagnosed at advanced stage and has poor prognosis. Consequently, identifying novel invasive bio-markers is crucial for early detection of cervical cancer. In recent years, many researches have found that a lot of miRNAs are involved in the initiation and development of cervical cancer.

MicroRNAs (miRNAs) are a class of small (19–25 nucleotides) noncoding RNA molecules that modulate target gene expression [9]. Accumulating evidences have indicated that miRNAs are involved in diverse biological processes, including cell apoptosis, proliferation, migration, invasion and metabolism [10–12]. Aberrantly expression of miRNAs is observed in various cancers that can function as novel biomarkers for diagnosis and potential therapeutic targets [13, 14]. As a member of miRNAs, miR-221 was found up-regulated in bladder cancer tissues and influenced T24 cell proliferation and apoptosis [15]. Moreover, the miR-221 was found that modulate proliferation and invasion of cervical cancer cells, but the clinical significance of it in the diagnosis of cervical cancer was still unclear [16].

In the present study, we mainly explored the serum expression levels of miR-221 in cervical cancer patients and healthy control and investigated the relationship between miR-221 expression and clinicopathological characteristics of cervical cancer patients. Then the diagnostic value of miR-221 was also estimated.

Patients and specimens

All protocols were approved by the Ethics Committee of the Harrison International Peace Hospital. In total, 125 patients who were diagnosed as cervical cancer before any treatments and 115 healthy control subjects from the Harrison International Peace Hospital, were included in our study. Blood samples from cervical cancer patients and healthy controls were collected during physical examination and then serum was separated and stored at -80℃ for use. The patients with cervical cancer assessment were performed according to histological grade and FIGO staging. The clinical characteristics of the patients were summarized in Table 1. All the participants provided their written informed consent in advance.

Table 1

The relationship between *miR-221* expression and clinicopathological features of cervical cancer patients
Parameters	Cases (n = 125)	miR-221 expression		χ²	P
Parameters	Cases (n = 125)	Low	High	χ²	P
Age				0.385	0.535
< 50	63	27	36
≥ 50	62	30	32
Tumor size				0.053	0.818
< 4 cm	65	29	36
≥ 4 cm	60	28	32
Histological grade				2.171	0.141
G1-G2	59	31	28
G3	66	26	40
Lymph node metastasis				4.936	0.026
Negative	61	34	27
Positive	64	23	41
FIGO stage				4.809	0.028
Ib-IIa	59	33	26
IIb-IIIa	66	24	42
Differentiation				0.720	0.396
poor	60	25	35
Moderate + well	65	32	33

RNA extraction and quantitative real-time RT-PCR

Total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s instructions. Complementary DNA (cDNA) was synthesized from total RNA using the Reverse Transcription Kit (Applied Biosystems). To quantify mature miR-221 expression, quantitative real-time RT-PCR (qRT-PCR) was performed using an ABI PRISM 7500 Sequence Detection System (Applied Biosystems, Inc., Foster City, CA, USA). U6 was used as an endogenous control for normalization. The primer sequences of miR-221 were designed as follows: forward, AGCUACAUUGUCUGCUGGGUUUC; reverse, GAAACCCAGTCTCAA TGTAGCTCCGGAAACCCAGTCTCAATGTAGCT [17]. The primers for U6: forward, 5’-CTCGCTTCGGCAGCACA-3’ and reverse 5’-AACGCTTCACGAATTTGCGT-3’ [18]. The relative expression of miR-221 was calculated and normalized using the 2^−ΔΔCT method relative to U6.

Statistical analysis

Statistical analysis was performed using SPSS 21.0 software (SPSS, Inc., Chicago, IL, USA) and GraphPad Prism 5 (GraphPad Software, Inc., La Jolla, CA, USA). Data were expressed as the mean ± standard deviation (SD) with at least three independent experiments. Student’s t-test was used to analyze differences between tumor and normal groups, and χ² test was used to analyze the correlation between miR-221 expression and clinicopathological factors of cervical cancer patients. Receiver-operating characteristic (ROC) curve and the area under the ROC curve (AUC) were applied to assess the serum miR-221 diagnosis value in cervical cancer. Differences were considered statistically significant when P-value less than 0.05 (*P < 0.05 and **P < 0.01).

The expression of miR-221 was increased in cervical cancer

We used qRT-PCR analysis to measure the serum miR-221 expression in cervical cancer patients and healthy individuals. As shown in Fig. 1, the expression of serum miR-221 was strongly up-regulated in cervical cancer patients compared to healthy individuals (P < 0.01).

Correlation of miR-221 expression with clinicopathological characteristics of cervical cancer patients

To assess to association between miR-221 expression and the clinicopathological parameters, the 125 patients were divided into high-expression and low-expression groups according to the average level of miR-221. Our finding showed that high expression of miR-221 was significantly related to lymph node metastasis (P = 0.026) and FIGO stage (P = 0.028), but no relationship was found with other clinicopathological features, including age, tumor size, histological grade and differentiation (all P > 0.05, Table 1).

Diagnostic potential of miR-221 in cervical cancer

To investigate the correlations between the miR-221 dysexpression and diagnosis in cervical cancer patients, we used ROC curve analysis. As shown in Fig. 2, the result showed that miR-221 had a relatively high accuracy in differentiating cervical cancer patients from healthy individuals based on AUC of 0.932 (95%CI: 0.903–0.960 ) with the sensitivity of 77.6% and specificity of 94.8% at the optimal cut-off value of 2.155.

Cervical cancer is one of the most common malignancies in women all over the world. Among the risk factors, the infection of HPV, especially the high risk type HPV virus, is the main cause of cervical cancer, and with the longer of carcinogenic infection lasting, showing the greater of risk [19, 20]. Most women with early-stage cervical tumors can be cured. Although benefit from the development of early detection and diagnostic technique, cervical cancer having a good prognosis, there are still many patients appeared tissues infiltration and metastasis and the morbidity and mortality of this cancer are still increasing in the developing countries [8]. Thus, the accurate bio-markers are meaningful for the diagnosis and prognosis of cervical cancer.

To date, molecular markers have been identified to be involved in the tumorigenesis, development and progression of cancers, including cervical cancer [21]. For instance, Azizmohammadi S et al. demonstrated that miRNA-145 and miR-9 were both up-regulated in cervical cancer and may be as potential prognostic markers in patients suffering from cervical cancer [22]. SHI et al. suggested that secreted protein acidic and rich in cysteine (SPARC) may be a potential therapeutic option for cervical cancer patients [23]. Liliana Alvarado-Ruiz et al. found that normal cervical cancer from women without cervical lesions expression HOXA9 but controlling HOXA9 expression appears to be a necessary step during cervical cancer development [24]. These data suggested the crucial roles of cancer related molecules in cervical cancers. In the present study, we aimed at to identify a novel accurate diagnostic biomarker for patients with cervical cancer.

Upregulation of miR-221 has been reported in various cancers. Yilmaz SS et al. showed that miR-221 was upregulated in larynx cancer plasma samples and plasma miR-221 may be a potential diagnostic/prognostic marker in larynx cancer [25]. Eissa S et al. indicated that the relative level of miR-221 expression in breast cancer tissues was higher than that in noncancerous tissues and it may be a potential biomarker and molecular therapeutic target for breast cancer [26]. Yang et al. revealed that miR-221 played a crucial role in the occurrence and the progression of human osteosarcoma and may function as a promising marker for screening individuals with osteosarcoma [27]. In study of Li et al., serum miR-221 expression levels has been indicated that significantly higher in patients with cutaneous malignant melanoma (CMM) and it has prognostic value in CMM patients [28]. Previous study has found the aberrant expression of miR-221 in the progression of cervical cancer [16]. But clinical diagnostic value of miR-221 in cervical cancer has not been investigated. In the present study, we sought to assess serum miR-221 expression pattern as well as its diagnostic role in patients with cervical cancer.

In this study, we measured the expression of miR-221 and the association between miR-221 with clinicopathological features in cervical cancer patients. The result of qRT-PCR revealed the expression of miR-221 in cervical cancer was increased compared with healthy control, which suggests that miR-221 may therefore function as a tumor oncogene. The elevated expression of miR-221 was correlated with lymph node metastasis and FIGO stage, which suggested that miR-221 was involved in the development of cervical cancer. Furthermore, the diagnostic value of miR-221 has also been investigated in our study using ROC curve analysis. The high AUC value, sensitivity and specificity values suggested that miR-221 may be a valuable diagnosis biomarker for cervical cancer detection.

In conclusion, serum miR-221 was significantly up-regulated in cervical cancer in this study. Moreover, the elevated miR-221 expression might play as a non-invasive diagnostic bio-marker for detection of cervical cancer patients from healthy individuals. Further studies with larger sample sizes are still needed to enhance the accuracy and potential of miR-221 in cervical cancer.

Quantitative real-time polymerase chain reaction (qRT-PCR)

receiver operating characteristic (ROC)

area under the ROC curve (AUC)

human papilloma virus (HPV)

MicroRNAs (miRNAs)

standard deviation (SD)

cutaneous malignant melanoma (CMM)

Ethics approval and consent to participate

This study was supported by the Ethics Committee of Harrison International Peace Hospital and also has been carried out in accordance with the World Medical Association Declaration of Helsinki.

Consent for publication

We obtaining permission from participants to publish their data.

Availability of data and materials

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Competing interests

The authors declare that they have no competing interests.

Funding

Not applicable.

Authors’ contributions

S.C. design of the work; L.Z. the acquisition, analysis, S.C. interpretation of data; L.Z. the creation of new software used in the work; S.C. have drafted the work or substantively revised it. All authors read and approved the final manuscript.

Acknowledgements

Not applicable.

Dasari S, Wudayagiri R, Valluru L. Cervical cancer: Biomarkers for diagnosis and treatment. Clin Chim Acta. 2015;445:7–11.
Siegel RL, Miller KD, Jemal A. Cancer statistics, 2015. Cancer J Clin. 2015;65(1):5–29.
Zhang B, Zhou AF, Zhu CC, Zhang L, Xiang B, Chen Z, Hu RH, Zhang YQ, Qiu L, Zhang YM, et al. Risk factors for cervical cancer in rural areas of Wuhan China: a matched case-control study. Asian Pacific journal of cancer prevention: APJCP. 2013;14(12):7595–600.
Bonneau C, Perrin M, Koskas M, Genin AS, Rouzier R. [Epidemiology and risk factors for cancer of the uterus]. La Revue du praticien. 2014;64(6):774–9.
de Sanjose S, Serrano B, Castellsague X, Brotons M, Munoz J, Bruni L, Bosch FX: Human papillomavirus (HPV) and related cancers in the Global Alliance for Vaccines and Immunization (GAVI) countries. A WHO/ICO HPV Information Centre Report. Vaccine 2012, 30 Suppl 4:D1-83, vi.
Ardhaoui M, Ennaifer E, Letaief H, Salsabil R, Lassili T, Chahed K, Bougatef S, Bahrini A, El Fehri E, Ouerhani K, et al. Prevalence, Genotype Distribution and Risk Factors for Cervical Human Papillomavirus Infection in the Grand Tunis Region, Tunisia. PloS one. 2016;11(6):e0157432.
Piroozmand A, Mostafavi Zadeh SM, Madani A, Soleimani R, Nedaeinia R, Niakan M, Avan A, Manian M, Moradi M, Eftekhar Z. The Association of High Risk Human Papillomaviruses in Patients With Cervical Cancer: An Evidence Based Study on Patients With Squamous Cell Dysplasia or Carcinoma for Evaluation of 23 Human Papilloma Virus Genotypes. Jundishapur journal of microbiology. 2016;9(4):e32728.
Arbyn M, Castellsague X, de Sanjose S, Bruni L, Saraiya M, Bray F, Ferlay J. Worldwide burden of cervical cancer in 2008. Annals of oncology: official journal of the European Society for Medical Oncology. 2011;22(12):2675–86.
Ambros V. The functions of animal microRNAs. Nature. 2004;431(7006):350–5.
Miska EA. How microRNAs control cell division, differentiation and death. Curr Opin Genet Dev. 2005;15(5):563–8.
Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 2004;116(2):281–97.
Shukla GC, Singh J, Barik S. MicroRNAs: Processing, Maturation, Target Recognition and Regulatory Functions. Mol Cell Pharmacol. 2011;3(3):83–92.
Yu F, Lu Z, Chen B, Dong P, Zheng J. microRNA-150: a promising novel biomarker for hepatitis B virus-related hepatocellular carcinoma. Diagnostic pathology. 2015;10:129.
Hoss AG, Labadorf A, Latourelle JC, Kartha VK, Hadzi TC, Gusella JF, MacDonald ME, Chen JF, Akbarian S, Weng Z, et al. miR-10b-5p expression in Huntington's disease brain relates to age of onset and the extent of striatal involvement. BMC Med Genom. 2015;8:10.
Liu H, Chang JK, Hou JQ, Zhao ZH, Zhang LD. Inhibition of miR-221 influences bladder cancer cell proliferation and apoptosis. Eur Rev Med Pharmacol Sci. 2017;21(14):3193–9.
Yang Y, Zhao X, Li HX. MiR-221 and miR-222 simultaneously target ARID1A and enhance proliferation and invasion of cervical cancer cells. Eur Rev Med Pharmacol Sci. 2016;20(8):1509–15.
Yang W, Yang Y, Xia L, Wang F, Song M, Chen X, Liu J, Song Y, Zhao Y, Yang C. MiR-221 Promotes Capan-2 Pancreatic Ductal Adenocarcinoma Cells Proliferation by Targeting PTEN-Akt. Cellular physiology biochemistry: international journal of experimental cellular physiology biochemistry pharmacology. 2016;38(6):2366–74.
Wang S, Zhao X, Wang J, Wen Y, Zhang L, Wang D, Chen H, Chen Q, Xiang W. Upregulation of microRNA-203 is associated with advanced tumor progression and poor prognosis in epithelial ovarian cancer. Med Oncol. 2013;30(3):681.
Trottier H, Franco EL. The epidemiology of genital human papillomavirus infection. Vaccine. 2006;24(Suppl 1):1–15.
Rodriguez AC, Schiffman M, Herrero R, Wacholder S, Hildesheim A, Castle PE, Solomon D, Burk R. Rapid clearance of human papillomavirus and implications for clinical focus on persistent infections. J Natl Cancer Inst. 2008;100(7):513–7.
Waggoner SE. Cervical cancer. Lancet. 2003;361(9376):2217–25.
Azizmohammadi S, Safari A, Kaghazian M, Sadrkhanlo M, Yahaghi E, Farshgar R, Seifoleslami M. Molecular identification of miR-145 and miR-9 expression level as prognostic biomarkers for early-stage cervical cancer detection. QJM: monthly journal of the Association of Physicians. 2017;110(1):11–5.
Shi D, Jiang K, Fu Y, Fang R, Liu XI, Chen J. Overexpression of SPARC correlates with poor prognosis in patients with cervical carcinoma and regulates cancer cell epithelial-mesenchymal transition. Oncology letters. 2016;11(5):3251–8.
Alvarado-Ruiz L, Martinez-Silva MG, Torres-Reyes LA, Pina-Sanchez P, Ortiz-Lazareno P, Bravo-Cuellar A, Aguilar-Lemarroy A, Jave-Suarez LF. HOXA9 is Underexpressed in Cervical Cancer Cells and its Restoration Decreases Proliferation, Migration and Expression of Epithelial-to-Mesenchymal Transition Genes. Asian Pacific journal of cancer prevention: APJCP. 2016;17(3):1037–47.
Yilmaz SS, Guzel E, Karatas OF, Yilmaz M, Creighton CJ, Ozen M. MiR-221 as a pre- and postoperative plasma biomarker for larynx cancer patients. Laryngoscope. 2015;125(12):E377–81.
Eissa S, Matboli M, Sharawy A, El-Sharkawi F. Prognostic and biological significance of microRNA-221 in breast cancer. Gene. 2015;574(1):163–7.
Yang Z, Zhang Y, Zhang X, Zhang M, Liu H, Zhang S, Qi B, Sun X. Serum microRNA-221 functions as a potential diagnostic and prognostic marker for patients with osteosarcoma. Biomedicine pharmacotherapy = Biomedecine pharmacotherapie. 2015;75:153–8.
Li P, He QY, Luo CQ, Qian LY. Circulating miR-221 expression level and prognosis of cutaneous malignant melanoma. Medical science monitor: international medical journal of experimental clinical research. 2014;20:2472–7.

Download PDF

Version 1

posted

You are reading this latest preprint version

MiR-221 represents an innovative bio-marker in cervical carcinoma detection

Status:

Version 1

Abstract

Background

Methods

Results

Conclusions

Figures

Background

Methods

Statistical analysis

Results

Discussion

Conclusions

Abbreviations

Declarations

Ethics approval and consent to participate

Consent for publication

Funding

Authors’ contributions

Acknowledgements

References

Status:

Version 1