Plasma extracellular vesicle sampling from high grade gliomas demonstrates a small RNA signature indicative of disease and identifies lncRNA RPPH1 as a high grade glioma biomarker.

doi:10.21203/rs.3.rs-4693910/v1

Download PDF

Research Article

Plasma extracellular vesicle sampling from high grade gliomas demonstrates a small RNA signature indicative of disease and identifies lncRNA RPPH1 as a high grade glioma biomarker.

https://doi.org/10.21203/rs.3.rs-4693910/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Background: High grade gliomas (HGGs) and cells of the tumour microenvironment (TME) secrete extracellular vesicles(EVs) into the plasma that contain genetic and protein cargo, which function in paracrine signaling. Isolation of these EVs and their cargo from plasma could lead to a simplistic tool that can inform on diagnosis and disease course of HGG.

Methods: In the present study, plasma EVs were captured utilizing a peptide affinity method (Vn96 peptide) from HGG patients and normal controls followed by next generation sequencing (NovaSeq6000) to define a small RNA (sRNA) signature unique to HGG.

Results: Over 750 differentially expressed sRNA (miRNA, snoRNA, lncRNA, tRNA, mRNA fragments and non-annotated regions) were identified between HGG and controls. MiEAA 2.0 pathway analysis of the miRNA in the sRNA signature revealed miRNA highly enriched in both EV and HGG pathways demonstrating the validity of results in capturing a signal from the TME. Also revealed were several novel HGG plasma EV sRNA biomarkers including lncRNA RPPH1 (Ribonuclease P Component H1), RNY4 (Ro60-Associated Y4) and RNY5 (Ro60-Associated Y5). Furthermore, in paired longitudinal patient plasma sampling, RPPH1 informed on surgical resection (decreased on resection) and importantly, RPPH1 increased again on clinically defined progression.

Conclusions: The present study supports the role of plasma EV sRNA sampling (and particularly RPPH1) as part of a multi-pronged approach to HGG diagnosis and disease course surveillance.

High-Grade Glioma

Extracellular vesicles

Small RNA sequencing

Biomarkers

Lnc RPPH1

High-grade gliomas (HGGs) are the most common primary malignant brain tumour, definitively diagnosed with invasive surgery [1, 2]. The 2021 World Health Organization (WHO) classifies HGG as isocitrate dehydrogenase wild-type (IDH-WT), versus IDH mutant tumours [3, 4]. IDH mutation defines two subsets of tumour that differ in terms of patient demographic, genetic, and prognostic factors. The most common and more aggressive IDH-WT HGG tumours, which includes diffuse Grade 3 astrocytomas and Grade 4 Glioblastoma Multiforme (GBM) were the focus of this study. IDH-WT HGGs are universally fatal (median survival 14–18 months) despite multimodal therapy (surgical resection, radiation, chemotherapy) [5, 6]. HGG progression is the rule, as these tumours are proficient at adapting to a hostile microenvironment and co-opting surrounding normal brain cells (astrocytes and neurons), immune cells (e.g., microglia, monocytes, and macrophages), and endothelial cells to promote survival and progression [7–9].

Recent evidence suggests that several modalities of cell-to-cell communication between HGG cells and those of the tumour microenvironment (TME) enable pro-tumorigenic features [7, 10–13]. Secretion of phospholipid membrane-bound extracellular vesicles (EVs) serve as an efficient means of bidirectional communication between HGG and cells of the TME to mediate autocrine/paracrine signaling [9, 12–23]. For example, HGG cells release EVs containing pro-angiogenic proteins such as vascular endothelial growth factor (VEGF) isoforms A and C, or fibroblast growth factor (FGF) that target the surrounding endothelium and promote tumour vascularity [24–29]. Alternatively, EVs released by normal astrocytes containing tumour-suppressive cargo have been shown to inhibit growth of HGG [11].

EVs (ranging in size from 30nm to 1000nm) are secreted into all biofluids such as blood and cerebrospinal fluid (CSF) and are subdivided according to their size and subcellular origin (exosomes, microvesicles, and apoptotic bodies) [21, 30, 31]. While EVs are produced by almost all cell-types [32], malignant HGG cancer cells have been shown to increase production of EVs and their secretion into plasma [33]. Despite the blood-brain barrier, EVs derived from HGG tumours have been detected in the plasma, most notably in the well-designed experiment using surgically resected tissue and plasma collected from patients treated with 5-aminolevulinic acid (5-ALA) [34]. Thus, the isolation of plasma EVs and elucidation of their cargo is an appealing non-invasive methodology (liquid biopsy) for informing on HGG. Numerous methods of EV isolation have been described in the literature to analyze various cancer pathologies [34–37]. The Vn96 peptide is a peptide affinity capture method developed for the capture of EVs in clinically relevant biofluids [18–20, 33, 38–41]. Numerous studies have shown captured Vn96-EVs from plasma contain canonical EV markers, and Vn96 has been utilized for the discovery of EV cargo-biomarkers in amyotrophic lateral sclerosis [39] and cancers, such as prostate [42], lung [43], and pancreatic ductal adenocarcinoma [44].

Non-coding RNAs (such as miRNA, snoRNA, lncRNA, piRNA, and others) contained in EVs of HGG plasma and those of cancers outside of the brain, have already been shown to be effective forms of tumour-associated cell-to-cell communication [27, 29, 34, 45–48]. For example, the long non-coding RNA (lncRNA) ribonuclease P RNA component H1 (RPPH1) has been shown to play an important role in multiple cancers (e.g., lung, colorectal cancer) [49, 50]. Moreover, RPPH1 contained in EVs isolated from colon cancer has been shown to regulate M2 polarization in macrophages of the TME, promoting proliferation and metastases of colon cancer cells [49]. In HGG patient plasma-EVs, MALAT1 was found to promote tumour proliferation and chemoresistance [51]. HGG angiogenesis was mediated by EV-associated CCAT2 or HIF1A-AS [52, 53], and immune regulation of the HGG TME by EV MROCKI or LNCARSR [54, 55]. The abnormal expression levels of various miRNA isolated from the EVs of HGG patient plasma have been found to mediate tumour aggressiveness and correlate with overall survival. Low levels of miR-485-3p were shown to correlate with significantly worse survival in HGG patients [56]. Angiogenesis was regulated by EV miR-1, miR-9, or miR-148a-3p [57–59], and TME immune regulation by miR-451 and miR-21[17]. EV miR-1238, miR-135b, or miR-151a were found to be critical in acquired treatment resistance [60–62]. These and other studies establish an ever-growing list implicating EVs and their sRNA cargo in many aspects of HGG tumorigenesis and cancer as a whole.

We aim to demonstrate that HGG-associated plasma-EVs obtained with peptide affinity capture can serve as promising non-invasive biomarkers of disease with the potential to interrogate pro-tumour crosstalk [9, 21, 24, 36, 63–68]. For the first time in HGG we have utilized peptide affinity capture of plasma-EVs to determine a sRNA signature that can inform on HGG in patient samples pre- and post-surgery. Our sRNA signature recapitulates previous data demonstrating the validity of our method and adds novel potential sRNA biomarkers. These data can be used to aid in the establishment of biomarkers of disease and potential therapeutic targets in the future.

Patient and sample collection

Ethical approval was obtained from the Research Ethics Board of Nova Scotia Health (REB#1023343). Adult patients (>18 years old) identified as having a suspected HGG underwent surgical resection or biopsy were recruited from the Queen Elizabeth II Health Sciences Centre following written, informed consent. All surgeries were carried out under general anesthesia with standard monitoring of vitals, neuronavigation, and sterile surgical technique. Tumour resections were completed through a craniotomy overlying the tumour region. Biopsies were completed via a small craniotomy or burrhole with stereotactic guidance, at the discretion of the attending neurosurgeon. Whole blood samples were obtained longitudinally from just prior to the initiation of surgery (n = 10), 18 +/- 1 days post-surgery (n = 6), and at the time of clinically defined progression (n = 5). Only samples from patients with confirmed histopathological diagnosis of HGG (2021 WHO Grade III and IV tumours) were subsequently analyzed. Blood was collected in Vacutainer EDTA-tubes (BD). Control non-cancer plasma was obtained from Innovative Research Inc. (Novi, MI). Blood was processed within 2 hours of collection by centrifugation at 1,500xg for 15 min at 22°C. The plasma fraction was stored at -80°C. All methods were carried out in accordance with the Canadian Research Tri-Council policy on ethical conduct for research involving humans (https://ethics.gc.ca/eng/policy-politique_tcps2-eptc2_2018.html). Patients included is this study had to have pathology verified HGG (Grade 3 or 4) and be IDH-WT. Patients with Grade 3 or 4 astrocytoma and IDH-mutations were excluded. Patients in whom long-term plasma collection was not feasible due to distance from primary care site were excluded. Both male and female patients were recruited, however this study is underpowered to detect differences in sex variables and was not explored as part of this paper. As this was not a clinical trial, patients were not randomized, and investigators were not blinded to whether a sample was a control or HGG sample.

HGG tumour volume assessment

The volume of pre-surgical and post-surgical gadolinium-enhancing tumour tissue was measured on T1-weighted magnetic resonance imaging (MRI) scans, using semi-automated, intensity-based image segmentation. T1-hyperintense blood products seen on unenhanced T1-weighted images were digitally removed from gadolinium-enhanced T1-weighted images and were not included in the measurement of gadolinium-enhancing tumour tissue. Triplicate measurements were made by a single observer, and median values were recorded. Tumours without visible gadolinium enhancement were assigned a volume of zero.

Vn96-mediated EV isolation and Protein or RNA extraction.

Plasma was thawed at room temperature and pre-cleared at 3,000 x g for 15 min. Peptide-affinity capture of EVs was performed following well established protocols [40, 41, 43, 69]. EV-RNA was extracted with the miRVana miRNA isolation kit (Invitrogen) following manufacturer’s protocol for total RNA. EV-Protein was precipitated from the organic fraction using acetone and solubilized with 8 M urea, 0.2% SDS and 1 M Tris-HCl, pH 6.8 similar to [70, 71]. Total RNA quantity and profile was assessed using Fragment Analyzer 5200 (Agilent Technologies Inc.).

Western blot analysis

EV-Protein samples (25 µg) were divided into two aliquots of equal volume and one sample prepared under reducing conditions with 10% β-mercaptoethanol and the other under non-reducing conditions. Samples were loaded onto Any KD Mini-Protean TGX Stain-Free Protein gels (Bio-Rad) and transferred to 0.45 µm polyvinylidene fluoride membranes. Membranes were blocked with 5% (w/v) skim milk in tris-buffered saline with 0.1 % Tween-20 (TBST). Primary antibodies were prepared in TBST with 5% skim milk: Hsc-70 (1:200, Santa Cruz Biotechnology Cat# SC-7298, RRID:AB_627761), CD63 (1:200, Santa Cruz Biotechnology Cat# SC-5275, RRID:AB_627877), FLOT1 (1:1000, Cell Signaling Technology, Cat #18634, RRID:AB_2773040), CD9 (1:200, Santa Cruz Biotechnology Cat# SC-59140, RRID: AB_1120766), and GRP94 (1:1000, New England Biolabs, Cat#2104S, RRID:AB_823506). Anti-mouse IgG (1:5,000, Jackson ImmunoResearch, Cat#115-035-003, RRID:AB_10015289), and anti-rabbit IgG (1:5,000, Jackson ImmunoResearch, Cat#111-035-003, RRID:AB_2313567) secondary antibodies were used as appropriate and conjugated to horse radish peroxidase. HEK 293T cells were obtained from ATCC (Cat# CRL-3216). HEK 293T whole cell lysate protein was used as a positive control, cell lines are tested monthly for Mycoplasma and only negative cell lines were utilized.

sRNA sequencing and bioinformatics

Next-generation sequencing was performed on EV-RNA (3-10 ng) using the NextFlex Small RNA sequencing kit v3 (Perkin Elmer) following manufacturers’ protocol. cDNA libraries were quantified on iSeq prior to loading on a NovaSeq 6000 (Illumina).Raw reads from sRNAseq were converted to fastq files and the adapter sequences (TGGAATTCTCGGGTGCCAAGG) were removed using TrimGalore (v0.6.5; https://github.com/FelixKrueger/TrimGalore). Alignment was performed using STAR (v2.7.0f; [72], RRID:SCR_004463) and the GRCh38 human genome with the parameters “—outFilterScoreMinOverLread 0 --outFilterMatchNmin 16 --outFilterMatchNminOverLread 0 --outFilterMismatchNoverLmax 0.05 --alignIntronMax 1 --alignEndsType EndToEnd”. The resulting .bam files were passed through a counting method by chromosome location using the Bioconductor package derfinder (v1.18.9; RRID:SCR_006442; [73]). Finally, the chromosome positions with counts were annotated using multiple databases such as Gencode (v38; [74]), pirnaDB (v1.7.6; [75]), MINT tRNA fragment database (v2.0; [76]), and Mirbase (v21; [77]). R statistical environment (v4.2.2) was used to calculate the variance between the normalized expressed chromosome regions read counts with trimmed mean of M-values (TMM) normalization method and differential expression analysis was performed using the Bioconductor package edgeR (v3.18.1; RRID:SCR_006442; [78]). R was used to build the following complimentary figures: upset plots with upset function from ‘upsetR’; MDS plots were built with plotMDS function from ‘edgeR’ library and ggplot from ‘ggplot2’ library; and the volcano plots were built using ggplot from ‘ggplot2’library. A false discovery rate (FDR Benjamini-Hochberg adjustment) of less than or equal to 0.05 and a fold change of greater than 1 or less than -1 were considered significant for further analysis.

Functional analysis and tissue specificity of miRNA

Functional analysis of the differentially expressed (DE) mature miRNAs between control and HGG patient samples was facilitated by the miRNA enrichment analysis and annotation tool (miEAA 2.0) [79]. Over-representation analysis (ORA) was performed with the default statistical parameters (FDR Benjamini-Hochberg adjustment and significance level 0.05). Selected databases included “Localization (RNALocate)”, “Diseases (MNDR)”, and “Pathways (miRWalk)”. Results of the analysis showing significantly over- or under-represented categories were exported to Excel (Microsoft) spreadsheets and ordered by the number of observed miRNAs. Tissue enrichment analysis for DE miRNA was facilitated by miRNAtissueAtlas2 [80]. For each DE miRNA (n = 34) the median reads per million was downloaded for the tissue panel, including brain, bone, lung, liver, lymph, bowel, muscle, heart and kidney. Median reads per million for each miRNA was divided by the maximum expression for each specific tissue and data was visualized by a heatmap.

Analysis of sRNA expression (RPPH1) in tissue and assessment of prognostic value

The expression of sRNA in tissue were queried from cancer and normal tissue repositories from The Cancer Genome Atlas (TCGA) and The Genotype-Tissue Expression (GTEx) databases accessed through the UCSC Xena browser (http://xenabrowser.net) [81]. To determine the expression RPPH1 in normal tissue as compared with HGG tissue, the TCGA Target GTEx database was filtered to select from only normal brain tissue (GTEx) and IDH-WT HGG tissue (TCGA). RPPH1 expression was profiled with respect to tissue type and the raw data was displayed as a violin plot. Welch’s t-test was used to determine statistical significance. Kaplan-Meier (KM) survival analysis was performed using the TCGA low grade glioma and glioblastoma database. Through Xena, grade 3 and 4 IDH-WT HGG were selected. Furthermore, as the TCGA database used an antiquated classification scheme (denoting all grade 2 IDH-WT tumours as low-grade gliomas), those grade 2 samples with any known driver mutations/amplifications for HGG [3, 82–84] were included. Eight grade 2 samples with amplifications of EGFR, PDGFRA/B, MDM2/4, or mutations in PTEN, TP53, H3F3A, TERT, CDKN2A/B, RB1, NF1, PIK3CA, EGFR, PDGFRA/B, or PDGFA/B/C/D were reclassified as HGG. KM curve was generated to compare HGG patients with high RPPH1 expression to those with low RPPH1 expression. Statistical significance was displayed as a p-value utilizing the log-rank test. P-value < 0.05 was considered significant. Analysis of RPPH1 expression between pre-surgery, post-surgery and progression was calculated using ANOVA with multiple comparisons (p<0.05).

Patient cohort characteristics

Age and sex of control patient’s plasma samples, along with baseline age, sex, and select tumour characteristics of ten HGG patients are shown (Table 1). The mean age of patients with tumours at the time of surgery was 65 years, and eight patients were male. All tumours were IDH-WT HGG. Half of the tumours were found to have methylated MGMT promoter regions and seven were predominantly localized to the temporal lobe (Table 1).

Table 1

Important patient and tumour characteristics of high grade glioma (HGG) patients and commercial, control plasma samples. *Anaplastic astrocytoma patient was *IDH* wild type.
High Grade Glioma IDH WT (n = 10)		Controls (n = 4)
Age at diagnosis, years
Mean (SEM)	65 (1.6)	49 (3.5)
Median (range)	65 (57–74)
Sex, no.
Males (% of total)	8 (80%)	3 (75%)
Females (% of total)	2 (20%)	1 (25%)
Histopathology, no.
Glioblastoma	9	N/A
Anaplastic astrocytoma	1*	N/A
MGMT status
Methylated	5	N/A
Unmethylated	5	N/A
IDH mutation status
Mutant	0	N/A
Wildtype	10	N/A
Tumour region
Frontal	2	N/A
Temporal	7	N/A
Parietal	0	N/A
Occipital	1	N/A

sRNAs are differentially expressed between control and HGG plasma EVs

Following the International Society of Extracellular vesicle (ISEV) guidelines, we confirmed the capture of EVs by Vn96 in HGG plasma, by detecting canonical EV-protein markers using Western blot analysis [85]. For this we pooled HGG EV-protein in order to conserve these precious samples. As demonstrated in Fig. 1A we detected canonical EV-protein markers Hsc-70, CD63, CD9 and FLOT1 in the pooled HGG EV sample and very low amounts of the non-EV protein GRP94. This demonstrates the capture of EVs from plasma of HGG patients, similar to previously reported [70, 86–88]. Sequencing and bioinformatic analysis of sRNA isolated from plasma EVs of controls and those from HGG patients, identified 4147 regions mapped to the human genome. The vast majority of the regions were uniquely annotated regions, although multi-annotated and non-annotated regions were also identified (Fig. 1B). The distribution and frequency of uniquely annotated and multi-annotated regions stratified by the type of annotated sRNA is shown (Fig. 1C). Most uniquely annotated regions were mRNA fragments, followed by lncRNA fragments, and a smaller proportion consisted of uniquely annotated tRNA, miRNA, and snoRNA. Most multi-annotated regions showed shared sequences with mRNA fragments, followed by lncRNA (Fig. 1C). Considering uniquely annotated and multi-annotated miRNA, there were 542 miRNAs sequenced. Multi-dimensional scaling (MDS) plot shows control samples appearing to cluster distinctly from the HGG samples, suggesting dissimilarity between these two groups (Fig. 2A). Differential expression (DE) analysis was performed and identified 789 regions, that passed statistical parameters, namely, false discovery rate (FDR) < 0.05 (-log₁₀FDR = 1.3) and a fold change (FC) of log₂ > 1 or < -1 (Fig. 2B). To better understand the complexity of DE regions, volcano plots were generated for the most relevant annotated sRNA species including miRNA (Fig. 2C), snoRNA (Fig. 2D), lncRNA full length/fragments (Fig. 2E), mRNA fragments (Fig. 2F), tRNA (Fig. 2G), and for regions that have no known annotation (Fig. 2H).

Functional analysis of differentially expressed miRNA reveal associations with HGG and pathways involved in HGG pathogenesis

Of the 528 miRNAs sequenced, 34 mature miRNAs were found to be significantly DE between control and HGG samples (Table 2). Considering the direction of fold change, 22 mature miRNAs were found to be enriched in HGG, while 12 were found to be depleted in HGG (Table 2).

Table 2

Differentially expressed mature miRNA between control and HGG. Mature miRNAs are sorted by increasing FDR.
Enriched in HGG plasma EVs-Mature ID	Log₂ Fold change	False Discovery Rate
hsa-miR-451a	2.502	0.001
hsa-miR-200a-3p	7.071	0.003
hsa-miR-4511	6.511	0.004
hsa-miR-3648	6.057	0.005
hsa-miR-6803-3p	5.448	0.006
hsa-miR-218-5p	6.614	0.008
hsa-miR-223-3p	1.365	0.009
hsa-miR-6741-3p	7.868	0.014
hsa-miR-197-3p	2.062	0.015
hsa-miR-122-5p	2.334	0.017
hsa-miR-504-5p	7.175	0.021
hsa-miR-4755-3p	7.099	0.026
hsa-miR-143-3p	1.354	0.026
hsa-miR-1-3p	1.445	0.028
hsa-miR-328-3p	1.675	0.029
hsa-miR-4755-5p	6.938	0.030
hsa-miR-148b-3p	1.168	0.033
hsa-miR-16-5p	1.436	0.037
hsa-miR-485-3p	2.221	0.045
hsa-let-7i-5p	1.127	0.045
hsa-let-7i-3p	1.127	0.045
hsa-miR-7-5p	1.204	0.049
Depleted in HGG plasma EVs-Mature ID
hsa-miR-4536-3p	-6.768	0.002
hsa-miR-31-5p	-5.014	0.003
hsa-miR-6866-3p	-6.427	0.004
hsa-miR-223-5p	-1.330	0.012
hsa-miR-320b	-1.330	0.012
hsa-miR-320a-3p	-1.018	0.014
hsa-miR-320d	-2.022	0.015
hsa-miR-320c	-1.456	0.017
hsa-miR-6881-3p	-6.093	0.022
hsa-miR-887-3p	-5.899	0.026
hsa-miR-184	-3.872	0.040
hsa-miR-484	-1.110	0.042

Utilizing miEAA 2.0, over-representation analysis (ORA) indicated significant over-representation of the 34 mature miRNAs in categories and subcategories associated with HGGs, cancer, and EVs (Table 3). Additionally, ORA revealed over-representation of the 34 mature miRNAs in categories associated with hallmarks of HGG pathogenesis including angiogenesis, proliferation/invasion (Table 4), and their relevant signaling pathways. For the full ORA output see Table S1. In order to potentially understand the tissue origin of our DE miRNA, we utilized Tissue Atlas 2.0 (TissueAtlas (uni-saarland.de)). As shown in Fig. 3a number of our DE miRNA have enriched expression in brain (miR-485-3p, miR-504-5p, miR-6881-3p and miR-184) and bone (miR-4511, miR-223-5p, miR-4755-5p, miR-6741-3p, and miR-4755-3p).

Table 3

Significantly enriched categories related to localization and disease obtained utilizing ORA (miEAA 2.0) [79] for 34 DE miRNAs when comparing control to high grade glioma patients. Importantly, this demonstrates with functional annotation and pathway analysis of our DE miRNAs, added confidence in the sRNA signature (especially the miRNA contribution), which are over-represented in subcategories for EVs and HGG.
Category	Subcategory	Enrichment	False Discovery Rate	Observed miRNA
Localization (RNALocate)	Microvesicle	over-represented	0.000074	28
	(hsa-miR-451a; hsa-miR-200a-3p; hsa-miR-4511; hsa-miR-3648; hsa-miR-218-5p; hsa-miR-223-3p; hsa-miR-223-5p; hsa-miR-197-3p; hsa-miR-122-5p; hsa-miR-504-5p; hsa-miR-4755-3p; hsa-miR-143-3p; hsa-miR-1-3p; hsa-miR-328-3p; hsa-miR-148b-3p; hsa-miR-16-5p; hsa-miR-485-3p; hsa-let-7i-5p; hsa-let-7i-3p; hsa-miR-7-5p; hsa-miR-31-5p; hsa-miR-320b; hsa-miR-320a-3p; hsa-miR-320d; hsa-miR-320c; hsa-miR-887-3p; hsa-miR-184; hsa-miR-484)
Diseases (MNDR)	Cancer	over-represented	0.000401	27
	(hsa-miR-451a; hsa-miR-200a-3p; hsa-miR-4511; hsa-miR-218-5p; hsa-miR-223-3p; hsa-miR-223-5p; hsa-miR-197-3p; hsa-miR-122-5p; hsa-miR-504-5p; hsa-miR-4755-3p; hsa-miR-143-3p; hsa-miR-1-3p; hsa-miR-328-3p; hsa-miR-4755-5p; hsa-miR-148b-3p; hsa-miR-16-5p; hsa-miR-485-3p; hsa-let-7i-3p; hsa-miR-7-5p; hsa-miR-31-5p; hsa-miR-320b; hsa-miR-320a-3p; hsa-miR-320d; hsa-miR-320c; hsa-miR-887-3p; hsa-miR-184; hsa-miR-484)
Diseases (MNDR)	Glioblastoma	over-represented	0.000001	26
	(hsa-miR-451a; hsa-miR-200a-3p; hsa-miR-4511; hsa-miR-218-5p; hsa-miR-223-3p; hsa-miR-223-5p; hsa-miR-197-3p; hsa-miR-122-5p; hsa-miR-504-5p; hsa-miR-143-3p; hsa-miR-1-3p; hsa-miR-328-3p; hsa-miR-148b-3p; hsa-miR-16-5p; hsa-miR-485-3p; hsa-let-7i-5p; hsa-let-7i-3p; hsa-miR-7-5p; hsa-miR-31-5p; hsa-miR-320b; hsa-miR-320a-3p; hsa-miR-320d; hsa-miR-320c; hsa-miR-887-3p; hsa-miR-184; hsa-miR-484)
Diseases (MNDR)	Malignant glioma	over-represented	0.000074	22
	(hsa-miR-451a; hsa-miR-200a-3p; hsa-miR-218-5p; hsa-miR-223-3p; hsa-miR-223-5p; hsa-miR-197-3p; hsa-miR-122-5p; hsa-miR-504-5p; hsa-miR-143-3p; hsa-miR-1-3p; hsa-miR-328-3p; hsa-miR-148b-3p; hsa-miR-16-5p; hsa-miR-485-3p; hsa-let-7i-5p; hsa-miR-7-5p; hsa-miR-31-5p; hsa-miR-320b; hsa-miR-320a-3p; hsa-miR-320c; hsa-miR-184; hsa-miR-484)
Localization (RNALocate)	Exosome	over-represented	0.000043	16
	(hsa-miR-451a; hsa-miR-200a-3p; hsa-miR-218-5p; hsa-miR-223-3p; hsa-miR-197-3p; hsa-miR-122-5p; hsa-miR-143-3p; hsa-miR-328-3p; hsa-miR-148b-3p; hsa-miR-16-5p; hsa-let-7i-5p; hsa-miR-7-5p; hsa-miR-31-5p; hsa-miR-320a-3p; hsa-miR-887-3p; hsa-miR-484)

Table 4

Significantly enriched categories related to angiogenesis obtained via ORA (miEAA 2.0) [79] for 34 DE miRNAs when comparing control to high grade glioma patients. This demonstrates the potential role for EV-mediated miRNA transport to contribute to cell to cell communication in the TME, by regulating new blood vessel formation or proliferation and invasion.
Category	Subcategory	Enrichment	False Discovery Rate	Observed miRNA
Angiogenesis
Pathways (miRWalk)	P00005 Angiogenesis	over-represented	0.0010	18
Pathways (miRWalk)	P00021 FGF signaling pathway	over-represented	0.0005	17
Pathways (miRWalk)	P00056 VEGF signaling pathway	over-represented	0.0023	14
Pathways (miRWalk)	P04393 Ras Pathway	over-represented	0.0024	14
Pathways (miRWalk)	P00057 Wnt signaling pathway	over-represented	0.0005	19
Proliferation and Invasion
Pathways (miRWalk)	P00018 EGF receptor signaling pathway	over-represented	0.0013	16
Pathways (miRWalk)	P00034 Integrin signalling pathway	over-represented	0.0029	16
Pathways (miRWalk)	hsa04350 TGF beta signaling pathway	over-represented	0.0067	14
Pathways (miRWalk)	P00048 PI3 kinase pathway	over-represented	0.0088	13
Pathways (miRWalk)	P00012 Cadherin signaling pathway	over-represented	0.0226	11
Pathways (miRWalk)	WP422 MAPK Cascade	over-represented	0.0025	10

SnoRNA, lncRNA, and Y-RNA are differentially expressed between control and HGG plasma-EVs

Also detected were DE sRNA species other than miRNA, for which pathway analysis was unavailable. As shown in Fig. 2D, seven snoRNA were found enriched in HGG whereas nine were found depleted. For example, members of the SNORD3 family (SNORD3A, 3B, 3C, 3D), SNORD14B, SNORD42A, and SNORD89 were found to be enriched in HGG. In addition, 54 enriched and 103 depleted annotated regions to lncRNA full length/fragments were detected (Fig. 2E). Since the library preparation kit used was designed for small RNA most of the regions annotated for lncRNA (and similarly mRNA) were only fragments of the entire transcript. This is similar to the output previously reported by others [47, 89, 90]. However, in some cases, where the full-length functional lncRNA transcript is short, a large portion of the transcript was detected and statistically significant differences in these lncRNA were sequenced. For example, for lncRNAs MALAT1, and RPPH1, large portions of the transcript were sequenced (~ 40% and ~ 100% respectively) and these were enriched in HGG.

In certain cases, particularly in cancer, DE of fragments of sRNA may be clinically important. Like other studies [91, 92], where cell-death effector fragments of RNY5 and tumour-suppressive fragments of RNY4 were detected in EVs from cancer cells, we detected enrichment in the 5’ (31 nt) effector region of RNY5 in HGG (Fig. 4A, B). RNY4, was also found to be enriched in HGG plasma-EVs, but unlike RNY5, there was no significant difference in the proportions of RNY4 fragments seen between HGG and controls (Fig. 4C). Examples of additional DE lncRNA and Y-RNA are shown in Table 5.

Table 5

Differentially expressed snoRNA, lncRNA, and Y-RNA between control and high grade glioma. snoRNA, lncRNA, and Y-RNA are sorted by increasing FDR
Enriched In HGG plasma EVs-ID		Log₂ Fold change	False Discovery Rate
snoRNA	SNORD3B	4.06	6.00x10^− 11
	SNORD3C	4.07	6.00x10^− 11
	SNORD3D	4.06	6.0x10^− 11
	SNORD3A	3.63	2.22x10^− 9
	SNORD14B	6.05	0.0265
	SNORD42A	4.26	0.0002
	SNORD89	2.10	0.0009
lncRNA	MALAT1	6.77	0.0069
	RPPH1	1.69	0.0007
	RP1-283E3.8	7.56	0.0092
Y-RNA	RNY5	1.63	0.0012
	RNY4	1.29	0.0170
Depleted in HGG plasma EVs-ID
snoRNA	SNORA62	-6.67	0.0002
	SNORD64	-8.19	0.0021
	SNORD67	-5.11	0.0037
	SNORA5C	-6.63	0.0086
	SNORD111	-5.10	0.0095
	SNORA79B	-5.86	0.0166
	SNORD11	-4.67	0.0233
	SNORD44	-1.86	0.0334
	SNORD49A	-1.57	0.0355
	SNORD32A	-2.60	0.0440
lncRNA	RP11-306O13.1	-8.29	0.0002
	LINC02067	-6.91	0.0020
	CTD-2651B20.7	-2.04	0.0024
	CTD-2651B20.6	-2.04	0.0025
	HELLPAR	-6.45	0.0081
	RP1-236J16.2	-5.89	0.0085
	NORAD	-5.99	0.0135
	TAGAP-AS1	-5.63	0.0145
	GPR176-D	-5.96	0.0231
	CYTOR	-5.40	0.0293

Small RNA profiling shows differences between pre- and post-surgery HGG plasma-EVs that may signify volume of residual tumour remaining post-surgery

We sought to see changes in sRNA profiles following surgery for HGG resection and interpret any differences in pre- and post-surgery profiles, in relation to the volume of tumour remaining post-surgery. Pre- and post-surgery plasma-EV samples were compared from six matched HGG patients. We first performed MDS to visualize global changes in sRNA signatures between pre- and post-surgery samples. As visualized on a MDS plot, sequencing of sRNA isolated from plasma-EVs revealed heterogenous changes in expression levels of sRNA when comparing matched pre- and post-surgery samples (Fig. 5A). Although this analysis was complicated by the low sample size and various extents of resection, there appeared to be substantial, but heterogenous changes in four of the six HGG paired samples. Two pairs of samples did not show a marked change and were found clustered together as highlighted in the red circle. Interestingly, these two patients showed a high volume of post-surgical residual tumour (Fig. 5B). Small RNA profiling of plasma-EVs appeared to be influenced by the extent of tumour remaining after surgery, with larger tumour volumes remaining post-surgery being associated with minimal changes in sRNA profiles, when comparing matched pre- and post-surgery samples. Differential expression analysis, with the same statistical parameters described previously, revealed only 23 regions DE between pre- and post-surgery samples (Fig. 5C). For a list of DE sRNA in pre- and post-surgery plasma-EV comparison, see Table S2.

Post-surgical trends in sRNA identified as significant in HGG vs. control samples identifies important biomarkers including RPPH1 for monitoring disease and signaling progression

The sequencing output was further queried with the DE plasma-EV sRNA determined to be significant in HGG vs. Control (above) using fold change analysis, to identify trends pre- and post-surgery as shown in the heat maps (Fig. 6A,B). This type of analysis is somewhat limited by a high variability of residual disease, as shown (Fig. 5B). Highlighted were a few sRNA enriched in HGG vs. control, which demonstrated significantly reduced expression after surgery such as miR-3648 (p = 0.014) and SNORD42A (p = 0.034). Few other sRNA showed a trend toward reduced expression after surgery, but did not reach significance, including MALAT1 (p = 0.096), SNORD89 (p = 0.14) (Fig. 6A,B). RPPH1, a known plasma EV biomarker in colorectal cancer [93], showed a significant reduction in expression post-surgery (p = 0.006, Fig. 6A). Given RPPH1 was significant in HGG vs. control and demonstrated reduced expression post-surgery, RPPH1 expression was queried in five patient plasma samples in our cohort, at the time of clinically defined progression (273 +/- 29 days post-surgery; n = 5) after standard treatment (Fig. 7A). As anticipated, RRPH1 expression significantly increased in plasma-EV samples at clinically defined progression. Therefore, we characterize RPPH1 as an important plasma-EV biomarker that not only identifies HGG, but also serves as an indicator for surgical resection and HGG progression.

RPPH1 is upregulated in HGG tissue and higher expression levels are associated with worse disease specific survival

Given the strength of our data supporting RPPH1 as a novel biomarker in HGG and support from the literature for RPPH1 in other cancer subtypes, RPPH1 expression was queried in The Genotype-Tissue Expression (GTEx, normal brain tissue) and The Cancer Genome Atlas (TCGA) databases for HGG, using UCSC Xena [81]. See materials and methods for reclassification of astrocytomas based on WHO 2021 criteria. RPPH1 was present and identified as having greater expression in HGG tissue (n = 144) relative to normal brain tissue (n = 1141) (Fig. 7B). Furthermore, Kaplan-Meier survival analysis showed that high RPPH1 tissue expression was associated with worse disease specific survival in IDH-WT HGG (Fig. 7C). RPPH1 is enriched in both plasma-EVs, and tissues of IDH-WT HGG patients compared to controls and higher levels of expression is associated with a worse prognosis in these patients, further strengthening its importance as a novel HGG biomarker.

The goal of non-invasive liquid biopsy is to identify biomarkers for HGG, which can predict the correct diagnosis of newly identified brain tumours, provide insight into relative survival or prognosis, be obtainable throughout the course of the disease to predict progression and/or response to adjunct therapies, and ultimately provide novel therapeutic targets. We profiled sRNA from Vn96-EVs isolated from HGG patient plasma sampled perioperatively and during post-surgical follow up, and demonstrated a unique, diagnostic sRNA signature for HGG. We analyzed the DE sRNA, mainly miRNA, using in silico tools to both validate and provide additional clinical relevance to our findings. Uniquely, we identified lncRNA RPPH1 as an important plasma EV biomarker for HGG, with expression levels informing on prognosis, extent of HGG resection, and tumour progression.

Comparing across studies for small RNA biomarkers in HGG is complicated by numerous factors including but not limited to: 1) tissue versus liquid biopsy (blood), 2) differences in methods used for EV isolation, 3) library preparation kits that will enrich for specific (total vs small) RNA species. The functional significance of concordance or discordance of small RNA species between HGG tissue and HGG EVs is not yet fully understood as cells are known to selectively sort small RNA into EVs [94]. For example, through oncogenic transformation, HGG cells may retain pro-oncogenic small RNA while selectively sorting tumor suppressor small RNA into EVs for export In practice, for the sole purpose of plasma biomarkers of HGG disease, the end function of the small RNA are not required. Despite these differences, there are advantages to utilizing plasma for HGG biomarkers, as analyzing HGG tissue alone may exclude relevant biomarkers from the immune component of cancer that may also be important, and plasma is much easier to obtain in a longitudinal fashion. The fraction of blood utilized (serum versus plasma) can alter results as serum contains increased levels of platelet-derived particles which can influence profiling, hence our decision to utilize plasma [95]. Choices in library preparation kits also influence the abundance of small RNA species within transcriptomic analysis, for example the choice of oligo-dT reverse transcriptase priming would enrich for poly-adenylated mRNA over small RNA. Despite these challenges, similar biomarkers that are discovered across multiple studies should be considered strong candidates for clinical applications or therapeutic targets.

Abnormal expression of miRNAs in cancer tissue and in tumour-associated EVs has been extensively studied in HGG and found to influence hallmark processes for growth and progression [64–66]. Due to the large volume of functional data on HGG and miRNA in the literature, bioinformatic analysis exists to functionally categorize miRNA data into localizations and disease processes. Utilizing miEAA analysis, our DE miRNAs were over-represented in categories related to localization in EVs, brain cancer, and functional categories of cancer hallmark pathways (miRWalk) involved in HGG proliferation, invasion, and angiogenesis. A significant number (26/34) of our DE miRNA have functional roles in HGG in the literature. The localization of a number of the same miRNA to EVs and their involvement in HGG pathways and disease supports that our sRNA EV biomarkers are indeed coming from the tumour microenvironment. Whether these are directly from HGG cells, or the surrounding supportive cells, will require further analysis. The miEAA analysis of the DE miRNA gives confidence to a true EV signal coming from the HGG tumor microenvironment. A review of the current HGG EV literature links our DE miRNAs to miRNA most commonly found in HGG EV studies. Recent reviews commonly cite the let-7 family, miR-21, miR-106, miR-130, miR-155, miR-185, miR-193, miR-210, miR-222, miR-451, miR-485 miR-486, and miR-574[96, 97] as being found in multiple publications in relation HGG. Twelve of these miRNAs were identified in plasma EVs of HGG in this study, with three (let-7, miR-451, miR-485) being significantly overexpressed in HGG EVs compared to controls. Our analysis of tissue specificity demonstrates the significant enrichment of miR-485 to brain, again supporting the validity of this technique to determine biomarkers in HGG. Despite some discordance to the literature, acknowledging that there are clear technical differences, there are some miRNA biomarkers (let-7, mir 451 and mir-485) that are consistent across studies, and our data support these miRNA as liquid biopsy biomarkers or therapeutic targets in the future.

Other DE species of sRNA sequenced when comparing HGG to controls included snoRNA, which function as guide RNAs for ribosomal RNA (rRNA) maturation and processing in the nucleolus [98, 99], with additional roles in chromatin structure regulation, RNA splicing, and protein signaling [100–103]. Recent worked has highlighted the role of snoRNA in cancer by modulating anti-tumour immunity [104]. We identified 17 DE snoRNAs between HGG plasma-EVs and controls. Similar to other studies in cancer, the SNORD3 family, SNORD89, and SNORD42A were found to be upregulated in HGG [48, 105–107]. Relatively little is published directly about snoRNA plasma-EV expression in HGG, as most studies target miRNA or mRNA. SNORD44/47/76 have been identified as HGG tumour suppressors in tissue [108–110]. SNORD44 contained within the GAS5 transcript has been found to be decreased in this study, which has not been documented previously. However, GAS5 has shown a pro-tumourigenic role in HGG which raises the question if the whole transcript is relevant or just one or more of the snoRNA contained within GAS5[111, 112] Interestingly, we show SNORD32A to be significantly depleted in HGG plasma-EVs. Loss of SNORD32A in mammalian cells was found to be protective against oxidative stress [113], which would be critical in HGG, as it is known to be a highly hypoxic microenvironment. Further studies to screen snoRNA expression in HGG tissues and in vitro studies to manipulate expression of relevant snoRNA in HGG cell lines and EVs could improve our understanding of their functions in tumorigenesis. Importantly, our work and others demonstrate the peril of utilizing snoRNA as normalization factors in quantitative polymerase chain reaction in HGG and cancer.

Comparing pre- and post-surgery plasma EV small RNA is complex and influenced by individual patient factors such as degree of resection, extent of residual tumour volume, post-surgical inflammation and kinetics of the tumour/EVs. Samples in this study were taken before surgery and two weeks post-surgery. Two weeks post-surgery was selected to allow EVs released during ultrasonic tumour resection and surgery to be depleted, and this timepoint is prior to induction to radiation and chemotherapy. However, whether this is the correct time to serve as a new baseline in long-term studies is not known. Although post-surgical changes in plasma small RNA EVs signatures were variable across samples, the data supports a thresholding effect of surgical resection on alterations in EV signatures. This occurs at 10 cm³ where EV small RNA plasma signatures did not alter with greater residual volumes. This concept aligns with HGG survival data that suggests a similar thresholding effect of residual disease and HGG survival [114, 115]. Interestingly, in a pediatric grade 4 brain tumour, medulloblastoma, 1.5 cm³ is left on axial imaging is consistent with poor survival [116]. Researchers need to be aware of these potential thresholding effects when analyzing longitudinal changes in circulating biomarkers.

We analyzed the changes in the specific DE miRNA found enriched in HGG vs controls after surgical debulking; although none reached significance with FDR, trends were observed (Fig. 4A&B). miR-320d was depleted in HGG EVs presurgically and a trend toward increasing in EVs post-surgery. HGG tissue has demonstrated reduced expression of miR-320d in HGG in response to temozolomide (TMZ), suggesting a possible role for miR-320d in chemosensitivity [117]. In our comparison of pre- and post-surgical HGG plasma-EVs, we see an interesting trend of miR-320d upregulation post-surgery, which may signify a release of miR-320d inhibition upon sufficient resection of tumour and an overall anti-tumorigenic profile of plasma-EVs. Conversely, we see the opposite trend in pre- and post-surgical comparison of miR-3648, which was enriched in HGG plasma-EVs and showed a predominantly downward trend of expression following surgical resection. While miR-3648 has been characterized in numerous other cancers such as prostate, bladder, gastric, lung, and esophageal [118–122], it has not been previously found to be significant in HGG. In most cancers, miR-3648 has been shown to be a pro-oncogenic miRNA important in tumorigenesis and higher expression of miR-3648 in tissues have been linked with worse survival [123].

Y-RNA are a highly conserved and emerging class of non-coding small RNA that are biologically active found in EVs and involved in cancer [124]. Both RNY4 and RNY5 were elevated in HGG EVs compared to controls although interestingly these Y-RNA are processed differently. The 5’ (31nt) RNY5 fragment from EVs of cancer cells was found to trigger cell death preferentially in non-cancer cells, when compared to cancer cells. This suggested a role for the 5’ RNY5 fragment from cancer EVs in modulating the TME to selectively kill non-cancerous cells, while promoting tumour survival [91]. Previous work in HGG CSF demonstrated that both RNY4 and RNY5 were found as biomarkers in CSF and the exosomes of cultured glioma stem cells [47]. Given that plasma is easier to obtain, we can confirm both RNY4/5 to be biomarkers for HGG. Additive to this we can confirm further processing of these RNY5 into a smaller 5’fragment is the important biomarker. Our data demonstrates that it is this 5’ functional suicide fragment of RNY5 to be enriched in HGG plasma-EVs. This is in contrast to RNY4, where enrichment of the full-length Y-RNA occurs in HGG plasma-EVs. Additionally, the finding of RNY4, RNY5 and RPPH1 enriched and localized in HGG plasma-EVs could implicate a functional relationship between these non-coding RNA, which are all transcribed by RNA polymerase III (Pol III) [125]. RPPH1, as the catalytic RNA component of Ribonuclease P (RNAse P), plays an important role in RNA cleavage and processing and it has been hypothesized by other authors to potentially have a role in cleavage of RNY5, although studies are ongoing [126, 127]. Further work demonstrating similar suicidality of the 5’ RNY5 fragment in non-HGG brain cells versus HGG is ongoing in our laboratory.

In our study, RPPH1 was enriched in plasma-EVs in HGG samples relative to healthy controls and showed a drop in expression following tumour resection in all samples (p = 0.006). RPPH1 levels increased again at time of clinical progression (as determined by the treating oncologist and MRI imaging). Our study is limited in determining the source of EVs containing RPPH1 in our plasma samples, albeit previous literature has suggested the majority of EVs in HGG are from the tumor cells of the TME [33]. However, we analyzed the TCGA tissue expression of RPPH1 in HGG using XENA [81]. We show that RPPH1 is significantly enriched in HGG tissue as compared to normal brain and that higher expression of RPPH1 in HGG is associated with a worse prognosis. This provides supporting evidence that RPPH1 expression is associated with the TME. This expression pattern of RPPH1 is similar to studies in colorectal cancer (CRC), where RPPH1 was found to be enriched in both plasma-derived exosomes from CRC patients and tumour tissues, and higher tissue expression was associated with worse overall survival [49]. In non-small cell lung cancer (NSCLC) and gastric cancer, higher RPPH1 expression was likewise associated with worse overall survival [50, 128]. Interestingly, RPPH1 exists in alternate forms based on the pattern of splicing, including lnc-RPPH1 and circ-RPPH1. Xue and colleagues analyzed the Gene Expression Omnibus (GEO) for circular RNA (circRNA) expression in GBM and demonstrated circ-RPPH1 was more highly expressed in HGG compared to normal tissue and predicted survival [129]. Our sequencing strategy would not allow for the sequencing of circRNA, however it warrants further investigation to explore the relationship between lnc- and circ-RPPH1 in HGG. RPPH1 has been shown to be involved in multiple cancer promoting pathways including: 1) as a miRNA sponge for miR-122 and miR-326, 2) promoting M2 polarization of tumor-associated macrophages, 3) WNT1/Beta-catenin signaling, and 4) cleavage of precursor tRNA [49, 50, 125, 130, 131]. It will be important in future experiments to determine the functional role of RPPH1 in HGG.

Like other liquid biopsy studies in HGG, we identify DE miRNA, snoRNA, sdRNA, Y-RNA, and lncRNA isolated from EVs that distinguish HGG from control samples and are involved in HGG pathogenesis. We are aware of a few studies [33, 68, 132–134] including ours that have sampled EVs from patients in a longitudinal manner (i.e., pre- and post-surgery, pre- or post-chemoradiotherapy, or routine surveillance), but to the best of our knowledge we are the first to profile the breadth of sRNA sequenced from EVs from matched pre-, post-surgery, and during clinical progression. Although other studies report on sRNA, the library preparation kit selection did not allow for sequencing of the entirety of sRNA. We also acknowledge that isolated EVs were not exclusive to those excreted by HGG tumour cells (as with 5-ALA based EV isolation; [34]) but reflect all plasma-EVs. We would argue that this may not necessarily be a disadvantage, as our sRNA signature would reflect the different sRNA cargoes of EVs derived from HGG microenvironment and not the HGG alone. With biomarkers we are more concerned with the message that a HGG exists and less concerned at this point on which cells send the message.

We show the potential for plasma EVs and their sRNA cargoes to be used as novel biomarkers and the feasibility for minimally invasive sampling of blood from HGG patients in a perioperative fashion. We have identified a sRNA signature from plasma-EVs that distinguishes HGG and may indicate adequate tumour resection. Our group is the first to show plasma EV RPPH1 is a meaningful biomarker of HGG from diagnosis, surgery to disease progression and thus could be utilized as part of a multi-modality disease surveillance. Given that RPPH1 is also highly expressed in HGG tissue and predicts survival, it is enticing to envision therapeutic strategies targeting RPPH1 (i.e., anti-sense RNA) in the future.

Taken together our results demonstrate the validity of utilizing plasma EV sRNA as biomarkers of HGG and provide a rationale to prospectively follow these biomarkers in combination with imaging.

5-ALA

5-aminolevulinic acid

ATCC

american type culture collection

CCAT2

colon cancer associated transcript 2

cDNA

complementary DNA

circ

circular

CRC

colorectal cancer

CSF

cerebrospinal fluid

differentially expressed

EDTA

Ethylenediaminetetraacetic acid

extracellular vesicle

FDR

false discovery rate

FGF

fibroblast growth factor

GBM

glioblastoma

GTEx

the genotype-tissue expression

HGG

high grade glioma

HIF1A-AS

hypoxia-inducible factor 1A

IDH-WT

isocirtrate dehydrogenase wild type

kaplan meier

LNCARSR

lncRNA regulator of akt signaling associated with HCC and RCC

lncRNA

long non-coding RNA

MALAT1

metastasis associated lung adenocarcinoma transcript 1

MDS

multidimensional scaling

MGMT

methylguanine methyltransferase

miRNA

micro RNA

MRI

magnetic resonance imaging

mRNA

messenger RNA

MROCK1

MARCKS cis regulating lncRNA promoter of cytokines and inflammation

NSCLC

non-small cell lung cancer

ORA

over-representation analysis

piRNA

piwi-RNA

RNY4

Ro60-associated Y4

RNY5

Ro60-Associated Y5

RPPH1

ribonuclease P component H1

RRID

research resource identifier

snoRNA

small nucleolar RNA

sRNA

small RNA

TBST

tris-buffered saline with 0.1% Tween-20

TCGA

the cancer genome atlas

TME

tumor microenvironment

tRNA

transfer RNA

VEGF

vascular endothelial growth factor

WHO

world health organization

Ethics approval and consent to participate

Ethics approval was obtained by the Research Ethics Board of Nova Scotia Health (REB#1023343). Adult patients (>18 years old) identified as having a suspected HGG who then underwent surgical resection or biopsy and were recruited from the Queen Elizabeth II Health Sciences Centre following written, informed consent. All methods were carried out in accordance with the Canadian Research Tri-Council policy on ethical conduct for research involving humans (https://ethics.gc.ca/eng/policy-politique_tcps2-eptc2_2018.html).

Availability of data and materials

The datasets generated and/or analysed during the current study are available in the NCBI Gene Expression Omnibus (GEO) repository under the accession number GSE269391.

Competing Interests

The authors report no conflicts to disclose.

Funding

This study was supported by grants from the Dalhousie University Faculty of Medicine, Department of Surgery, Dalhousie Medical Research Foundation (DMRF), Genome Atlantic, Research New Brunswick and the Beatrice Hunter Cancer Research Institute (BHCRI), with funds provided by the Terry Fox Research Institute’s Marathon of Hope Atlantic Cancer Consortium.

Authors' contributions

JH, GW, KA, MW, and LN were responsible for data generation, bioinformatics, manuscript draft writing and review. BH, RC, and SC performed small RNA sequencing, data generation and management, and manuscript review. AH prepared and managed the clinical research ethics board documents, assisted with patient data management and manuscript review.

MM, MS, SC are major clinical collaborators and were responsible for patient management/follow up, MRI image analysis, biobanking and sample management.

AW, JR conceptualized and designed the study, were responsible for financial acquisition, manuscript draft writing, review and finalization, and project supervision. All authors read and approved the final manuscript.

Acknowledgements

We would like to thank the patients affected by HGG and their families for agreeing to participate in this study. In particular, we would like to highlight the generous donations and fundraising efforts of Garry Beattie and Lori Duggan. We would like to thank the Dalhousie University Department of Anesthesia, Pain Management & Perioperative Medicine for their assistance with intraoperative sample collection. We would also like to the neurosurgeons of the Dalhousie University Division of Neurosurgery, including Dr. David Clarke, Dr. Simon Walling, Dr. Stephen Lownie, Dr. Daniel McNeely, Dr. Gwynedd Pickett, Dr. Sean Christie, Dr. Sean Barry, Dr. Lutz Weise, and Dr. Jacob Alant for their assistance with patient recruitment and intraoperative sample collection.

DeAngelis LM (2001) Brain Tumors. N Engl J Med 344:114–123
Ostrom QT, Gittleman H, Stetson L, Virk SM, Barnholtz-Sloan JS (2015) Epidemiology of gliomas. Cancer Treat Res 163:1–14
Louis DN, Perry A, Wesseling P, et al (2021) The 2021 WHO Classification of Tumors of the Central Nervous System: a summary. Neuro Oncol 23:1231–1251
Motomura K, Kibe Y, Ohka F, Aoki K, Yamaguchi J, Saito R (2023) Clinical characteristics and radiological features of glioblastoma, IDH-wildtype, grade 4 with histologically lower-grade gliomas. Brain Tumor Pathol. https://doi.org/10.1007/s10014-023-00458-5
Stupp R, Mason WP, van den Bent MJ, et al (2005) Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma. N Engl J Med 352:987–996
Stupp R, Hegi ME, Mason WP, et al (2009) Effects of radiotherapy with concomitant and adjuvant temozolomide versus radiotherapy alone on survival in glioblastoma in a randomised phase III study: 5-year analysis of the EORTC-NCIC trial. Lancet Oncol 10:459–466
Broekman ML, Maas SLN, Abels ER, Mempel TR, Krichevsky AM, Breakefield XO (2018) Multidimensional communication in the microenvirons of glioblastoma. Nat Rev Neurol 14:482–495
Abels ER, Broekman MLD, Breakefield XO, Maas SLN (2019) Glioma EVs Contribute to Immune Privilege in the Brain. Trends Cancer 5:393–396
Yekula A, Yekula A, Muralidharan K, Kang K, Carter BS, Balaj L (2020) Extracellular Vesicles in Glioblastoma Tumor Microenvironment. Front Immunol. https://doi.org/10.3389/fimmu.2019.03137
Serpe C, Monaco L, Relucenti M, et al (2021) Microglia-derived small extracellular vesicles reduce glioma growth by modifying tumor cell metabolism and enhancing glutamate clearance through miR-124. Cells. https://doi.org/10.3390/cells10082066
Serpe C, Michelucci A, Monaco L, et al (2022) Astrocytes-Derived Small Extracellular Vesicles Hinder Glioma Growth. Biomedicines. https://doi.org/10.3390/biomedicines10112952
Nieland L, Morsett LM, Broekman MLD, Breakefield XO, Abels ER (2021) Extracellular Vesicle-Mediated Bilateral Communication between Glioblastoma and Astrocytes. Trends Neurosci 44:215–226
Adnani L, Kassouf J, Meehan B, Spinelli C, Tawil N, Nakano I, Rak J (2022) Angiocrine extracellular vesicles impose mesenchymal reprogramming upon proneural glioma stem cells. Nat Commun. https://doi.org/10.1038/S41467-022-33235-7
Pan BT, Johnstone RM (1983) Fate of the transferrin receptor during maturation of sheep reticulocytes in vitro: Selective externalization of the receptor. Cell 33:967–978
Ludwig AK, Giebel B (2012) Exosomes: Small vesicles participating in intercellular communication. Int J Biochem Cell Biol 44:11–15
Cappello F, Logozzi M, Campanella C, Caruso Bavisotto C, Marcilla A, Properzi F, Fais S (2016) Exosome levels in human body fluids: A tumor marker by themselves? European Journal of Pharmaceutical Sciences. https://doi.org/10.1016/j.ejps.2016.09.010
van der Vos KE, Abels ER, Zhang X, et al (2016) Directly visualized glioblastoma-derived extracellular vesicles transfer RNA to microglia/macrophages in the brain. Neuro Oncol 18:58–69
Bijnsdorp I V, Maxouri O, Kardar A, et al (2017) Feasibility of urinary extracellular vesicle proteome profiling using a robust and simple, clinically applicable isolation method. J Extracell Vesicles. https://doi.org/10.1080/20013078.2017.1313091
Joy AP, Ayre DC, Chute IC, Beauregard A-P, Wajnberg G, Ghosh A, Lewis SM, Ouellette RJ, Barnett DA (2018) Proteome profiling of extracellular vesicles captured with the affinity peptide Vn96: comparison of Laemmli and TRIzol© protein-extraction methods. J Extracell Vesicles. https://doi.org/10.1080/20013078.2018.1438727
Griffiths SG, Ezrin A, Jackson E, Dewey L, Doucette AA (2019) A robust strategy for proteomic identification of biomarkers of invasive phenotype complexed with extracellular heat shock proteins. Cell Stress Chaperones 24:1197–1209
Han L, Lam EWF, Sun Y (2019) Extracellular vesicles in the tumor microenvironment: old stories, but new tales. Mol Cancer. https://doi.org/10.1186/S12943-019-0980-8
Matarredona ER, Pastor AM (2019) Extracellular Vesicle-Mediated Communication between the Glioblastoma and Its Microenvironment. Cells 9:96
Heijnen HFG, Schiel AE, Fijnheer R, Geuze HJ, Sixma JJ (1999) Activated Platelets Release Two Types of Membrane Vesicles: Microvesicles by Surface Shedding and Exosomes Derived From Exocytosis of Multivesicular Bodies and α-Granules. Blood 94:3791–3799
Skog J, Würdinger T, van Rijn S, Meijer DH, Gainche L, Curry WT, Carter BS, Krichevsky AM, Breakefield XO (2008) Glioblastoma microvesicles transport RNA and proteins that promote tumour growth and provide diagnostic biomarkers. Nat Cell Biol 10:1470–1476
Treps L, Perret R, Edmond S, Ricard D, Gavard J (2017) Glioblastoma stem-like cells secrete the pro-angiogenic VEGF-A factor in extracellular vesicles. J Extracell Vesicles. https://doi.org/10.1080/20013078.2017.1359479
Lucero R, Zappulli V, Sammarco A, et al (2020) Glioma-Derived miRNA-Containing Extracellular Vesicles Induce Angiogenesis by Reprogramming Brain Endothelial Cells. Cell Rep 30:2065-2074.e4
Balandeh E, Mohammadshafie K, Mahmoudi Y, Hossein Pourhanifeh M, Rajabi A, Bahabadi ZR, Mohammadi AH, Rahimian N, Hamblin MR, Mirzaei H (2021) Roles of Non-coding RNAs and Angiogenesis in Glioblastoma. Front Cell Dev Biol 9:2543
Wang Z, Yuan Y, Ji X, et al (2021) The Hippo-TAZ axis mediates vascular endothelial growth factor C in glioblastoma-derived exosomes to promote angiogenesis. Cancer Lett 513:1–13
Guo X, Sui R, Piao H (2022) Tumor-derived small extracellular vesicles: potential roles and mechanism in glioma. J Nanobiotechnology 20:1–17
Colombo M, Raposo G, Théry C (2014) Biogenesis, Secretion, and Intercellular Interactions of Exosomes and Other Extracellular Vesicles. Annu Rev Cell Dev Biol 30:255–289
Tkach M, Théry C (2016) Communication by Extracellular Vesicles: Where We Are and Where We Need to Go. Cell 164:1226–1232
Yu W, Hurley J, Roberts D, Chakrabortty SK, Enderle D, Noerholm M, Breakefield XO, Skog JK (2021) Exosome-based liquid biopsies in cancer: opportunities and challenges. Annals of Oncology 32:466–477
Osti D, Del Bene M, Rappa G, et al (2019) Clinical Significance of Extracellular Vesicles in Plasma from Glioblastoma Patients. Clinical Cancer Research 25:266–276
Hsia T, Yekula A, Batool SM, Rosenfeld YB, You DG, Weissleder R, Lee H, Carter BS, Balaj L (2022) Glioblastoma-derived extracellular vesicle subpopulations following 5-aminolevulinic acid treatment bear diagnostic implications. J Extracell Vesicles 11:e12278
Logozzi M, De Milito A, Lugini L, et al (2009) High Levels of Exosomes Expressing CD63 and Caveolin-1 in Plasma of Melanoma Patients. PLoS One 4:e5219
Kucharzewska P, Christianson HC, Welch JE, Svensson KJ, Fredlund E, Ringnér M, Mörgelin M, Bourseau-Guilmain E, Bengzon J, Belting M (2013) Exosomes reflect the hypoxic status of glioma cells and mediate hypoxia-dependent activation of vascular cells during tumor development. Proc Natl Acad Sci U S A 110:7312–7317
Bebelman MP, Janssen E, Pegtel DM, Crudden C (2021) The forces driving cancer extracellular vesicle secretion. Neoplasia 23:149–157
Bijnsdorp I V., Schelfhorst T, Luinenburg M, Rolfs F, Piersma SR, de Haas RR, Pham T V., Jimenez CR (2021) Feasibility of phosphoproteomics to uncover oncogenic signalling in secreted extracellular vesicles using glioblastoma-EGFRVIII cells as a model. J Proteomics. https://doi.org/10.1016/j.jprot.2020.104076
Saucier D, Wajnberg G, Roy J, et al (2019) Identification of a circulating miRNA signature in extracellular vesicles collected from amyotrophic lateral sclerosis patients. Brain Res 1708:100–108
Roy JW, Taylor CA, Ouellette RJ, Lewis SM (2022) Peptide-Affinity Isolation of Extracellular Vesicles and Cell-Free DNA From Human Plasma. Methods in Molecular Biology 2508:341–352
Roy JW, Taylor CA, Beauregard AP, et al (2021) A multiparametric extraction method for Vn96-isolated plasma extracellular vesicles and cell-free DNA that enables multi-omic profiling. Sci Rep 11:8085–8085
Davey M, Benzina S, Savoie M, Breault G, Ghosh A, Ouellette RJ (2020) Affinity Captured Urinary Extracellular Vesicles Provide mRNA and miRNA Biomarkers for Improved Accuracy of Prostate Cancer Detection: A Pilot Study. Int J Mol Sci 21:1–21
Taylor C, Chacko S, Davey M, et al (2020) Peptide-Affinity Precipitation of Extracellular Vesicles and Cell-Free DNA Improves Sequencing Performance for the Detection of Pathogenic Mutations in Lung Cancer Patient Plasma. Int J Mol Sci 21:1–19
Roy JW, Wajnberg G, Ouellette A, Boucher JE, Lacroix J, Chacko S, Ghosh A, Ouellette RJ, Lewis SM (2023) Small RNA sequencing analysis of peptide-affinity isolated plasma extracellular vesicles distinguishes pancreatic cancer patients from non-affected individuals.
Cheng J, Meng J, Zhu L, Peng Y (2020) Exosomal noncoding RNAs in Glioma: biological functions and potential clinical applications. Mol Cancer 19:1–14
Peng J, Liang Q, Xu Z, et al (2022) Current Understanding of Exosomal MicroRNAs in Glioma Immune Regulation and Therapeutic Responses. Front Immunol 12:5934
Wei Z, Batagov AO, Schinelli S, et al (2017) Coding and noncoding landscape of extracellular RNA released by human glioma stem cells. Nat Commun 8:1–15
Liang J, Wen J, Huang Z, Chen XP, Zhang BX, Chu L (2019) Small Nucleolar RNAs: Insight Into Their Function in Cancer. Front Oncol 9:587
Liang Z xing, Liu H shan, Wang F wei, et al (2019) LncRNA RPPH1 promotes colorectal cancer metastasis by interacting with TUBB3 and by promoting exosomes-mediated macrophage M2 polarization. Cell Death Dis. https://doi.org/10.1038/s41419-019-2077-0
Wu Y, Cheng K, Liang W, Wang X (2020) lncRNA RPPH1 promotes non-small cell lung cancer progression through the miR-326/WNT2B axis. Oncol Lett. https://doi.org/10.3892/ol.2020.11966
Chen W, Xu X-K, Li J-L, et al (2017) MALAT1 is a prognostic factor in glioblastoma multiforme and induces chemoresistance to temozolomide through suppressing miR-203 and promoting thymidylate synthase expression. Oncotarget 8:22783–22799
Lang HL, Hu GW, Zhang B, Kuang W, Chen Y, Wu L, Xu GH (2017) Glioma cells enhance angiogenesis and inhibit endothelial cell apoptosis through the release of exosomes that contain long non-coding RNA CCAT2. Oncol Rep 38:785–798
Dai X, Liao K, Zhuang Z, et al (2019) AHIF promotes glioblastoma progression and radioresistance via exosomes. Int J Oncol 54:261–270
Liu DH, Yang X, Guo JF, Meng H, Shen SH (2022) Immune-related lncRNAs, LINC01268 and CTB-31O20.2, as favorable prognostic markers for glioma inhibition. Transl Cancer Res 11:823–834
Li Z, Meng X, Wu P, et al (2021) Glioblastoma Cell-Derived lncRNA-Containing Exosomes Induce Microglia to Produce Complement C5, Promoting Chemotherapy Resistance. Cancer Immunol Res 9:1383–1399
Wang ZQ, Zhang MY, Deng ML, Weng NQ, Wang HY, Wu SX (2017) Low serum level of miR-485-3p predicts poor survival in patients with glioblastoma. PLoS One. https://doi.org/10.1371/journal.pone.0184969
Bronisz A, Wang Y, Nowicki MO, et al (2014) Extracellular vesicles modulate the glioblastoma microenvironment via a tumor suppression signaling network directed by miR-1. Cancer Res 74:738–750
Chen X, Yang F, Zhang T, et al (2019) MiR-9 promotes tumorigenesis and angiogenesis and is activated by MYC and OCT4 in human glioma. Journal of Experimental & Clinical Cancer Research. https://doi.org/10.1186/S13046-019-1078-2
Wang M, Zhao Y, Yu ZY, et al (2020) Glioma exosomal microRNA-148a-3p promotes tumor angiogenesis through activating the EGFR/MAPK signaling pathway via inhibiting ERRFI1. Cancer Cell Int. https://doi.org/10.1186/s12935-020-01566-4
Yin J, Zeng A, Zhang Z, Shi Z, Yan W, You Y (2019) Exosomal transfer of miR-1238 contributes to temozolomide-resistance in glioblastoma. EBioMedicine 42:238–251
Xiao S, Yang Z, Lv R, Zhao J, Wu M, Liao Y, Liu Q (2014) miR-135b contributes to the radioresistance by targeting GSK3β in human glioblastoma multiforme cells. PLoS One. https://doi.org/10.1371/journal.pone.0108810
Zeng A, Wei Z, Yan W, et al (2018) Exosomal transfer of miR-151a enhances chemosensitivity to temozolomide in drug-resistant glioblastoma. Cancer Lett 436:10–21
Berenguer J, Lagerweij T, Zhao XW, et al (2018) Glycosylated extracellular vesicles released by glioblastoma cells are decorated by CCL18 allowing for cellular uptake via chemokine receptor CCR8. J Extracell Vesicles. https://doi.org/10.1080/20013078.2018.1446660
Garcia CM, Toms SA (2020) The Role of Circulating MicroRNA in Glioblastoma Liquid Biopsy. World Neurosurg 138:425–435
Ghaemmaghami AB, Mahjoubin-Tehran M, Movahedpour A, Morshedi K, Sheida A, Taghavi SP, Mirzaei H, Hamblin MR (2020) Role of exosomes in malignant glioma: microRNAs and proteins in pathogenesis and diagnosis. Cell Communication and Signaling. https://doi.org/10.1186/S12964-020-00623-9
Bouzari B, Mohammadi S, Bokov DO, Krasnyuk II, Hosseini-Fard SR, Hajibaba M, Mirzaei R, Karampoor S (2022) Angioregulatory role of miRNAs and exosomal miRNAs in glioblastoma pathogenesis. Biomedicine & Pharmacotherapy 148:112760
Sisakht AK, Malekan M, Ghobadinezhad F, Firouzabadi SNM, Jafari A, Mirazimi SMA, Abadi B, Shafabakhsh R, Mirzaei H (2022) Cellular Conversations in Glioblastoma Progression, Diagnosis and Treatment. Cell Mol Neurobiol. https://doi.org/10.1007/s10571-022-01212-9
Pavlyukov MS, Yu H, Bastola S, et al (2018) Apoptotic Cell-Derived Extracellular Vesicles Promote Malignancy of Glioblastoma Via Intercellular Transfer of Splicing Factors. Cancer Cell 34:119-135.e10
Ghosh A, Davey M, Chute IC, et al (2014) Rapid isolation of extracellular vesicles from cell culture and biological fluids using a synthetic peptide with specific affinity for heat shock proteins. PLoS One. https://doi.org/10.1371/journal.pone.0110443
Roy JW, Taylor CA, Beauregard AP, et al (2021) A multiparametric extraction method for Vn96-isolated plasma extracellular vesicles and cell-free DNA that enables multi-omic profiling. Sci Rep 11:8085
Joy AP, Ayre DC, Chute IC, Beauregard AP, Wajnberg G, Ghosh A, Lewis SM, Ouellette RJ, Barnett DA (2018) Proteome profiling of extracellular vesicles captured with the affinity peptide Vn96: comparison of Laemmli and TRIzol(c) protein-extraction methods. J Extracell Vesicles 7:1438727
Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, Batut P, Chaisson M, Gingeras TR (2013) STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29:15–21
Collado-Torres L, Nellore A, Frazee AC, Wilks C, Love MI, Langmead B, Irizarry RA, Leek JT, Jaffe AE (2017) Flexible expressed region analysis for RNA-seq with derfinder. Nucleic Acids Res 45:e9–e9
Harrow J, Frankish A, Gonzalez JM, et al (2012) GENCODE: the reference human genome annotation for The ENCODE Project. Genome Res 22:1760–1774
Piuco R, Galante PAF (2021) piRNAdb: A piwi-interacting RNA database. bioRxiv 2021.09.21.461238
Pliatsika V, Loher P, Magee R, Telonis AG, Londin E, Shigematsu M, Kirino Y, Rigoutsos I (2018) MINTbase v2.0: a comprehensive database for tRNA-derived fragments that includes nuclear and mitochondrial fragments from all The Cancer Genome Atlas projects. Nucleic Acids Res 46:D152–D159
Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ (2006) miRBase: microRNA sequences, targets and gene nomenclature. Nucleic Acids Res. https://doi.org/10.1093/nar/gkj112
Robinson MD, McCarthy DJ, Smyth GK (2010) edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 26:139–140
Kern F, Fehlmann T, Solomon J, Schwed L, Grammes N, Backes C, van Keuren-Jensen K, Craig DW, Meese E, Keller A (2020) miEAA 2.0: integrating multi-species microRNA enrichment analysis and workflow management systems. Nucleic Acids Res 48:W521–W528
Kern F, Fehlmann T, Solomon J, Schwed L, Grammes N, Backes C, Van Keuren-Jensen K, Craig DW, Meese E, Keller A (2020) miEAA 2.0: integrating multi-species microRNA enrichment analysis and workflow management systems. Nucleic Acids Res 48:W521–W528
Goldman MJ, Craft B, Hastie M, et al (2020) Visualizing and interpreting cancer genomics data via the Xena platform. Nature Biotechnology 2020 38:6 38:675–678
Brennan CW, Verhaak RGW, McKenna A, et al (2013) The somatic genomic landscape of glioblastoma. Cell 155:462
McLendon R, Friedman A, Bigner D, et al (2008) Comprehensive genomic characterization defines human glioblastoma genes and core pathways. Nature 455:1061–1068
Sturm D, Witt H, Hovestadt V, et al (2012) Hotspot mutations in H3F3A and IDH1 define distinct epigenetic and biological subgroups of glioblastoma. Cancer Cell 22:425–437
Thery C, Witwer KW, Aikawa E, et al (2018) Minimal information for studies of extracellular vesicles 2018 (MISEV2018): a position statement of the International Society for Extracellular Vesicles and update of the MISEV2014 guidelines. J Extracell Vesicles 7:1535750
Ghosh A, Davey M, Chute IC, et al (2014) Rapid isolation of extracellular vesicles from cell culture and biological fluids using a synthetic peptide with specific affinity for heat shock proteins. PLoS One 9:e110443
Roy JW, Taylor CA, Ouellette RJ, Lewis SM (2022) Peptide-Affinity Isolation of Extracellular Vesicles and Cell-Free DNA From Human Plasma. Methods Mol Biol 2508:341–352
Taylor C, Chacko S, Davey M, et al (2020) Peptide-Affinity Precipitation of Extracellular Vesicles and Cell-Free DNA Improves Sequencing Performance for the Detection of Pathogenic Mutations in Lung Cancer Patient Plasma. Int J Mol Sci. https://doi.org/10.3390/ijms21239083
Chettimada S, Lorenz DR, Misra V, Wolinsky SM, Gabuzda D (2020) Small RNA sequencing of extracellular vesicles identifies circulating miRNAs related to inflammation and oxidative stress in HIV patients. BMC Immunol. https://doi.org/10.1186/S12865-020-00386-5
de Mooij T, Peterson TE, Evans J, McCutcheon B, Parney IF (2020) Short non-coding RNA sequencing of glioblastoma extracellular vesicles. J Neurooncol 146:253–263
Chakrabortty SK, Prakash A, Nechooshtan G, Hearn S, Gingeras TR (2015) Extracellular vesicle-mediated transfer of processed and functional RNY5 RNA. RNA 21:1966–1979
Li C, Wang W, Sun Y, Ni Y, Qin F, Li X, Wang T, Guo M, Sun G (2022) Selective sorting and secretion of hY4 RNA fragments into extracellular vesicles mediated by methylated YBX1 to promote lung cancer progression. Journal of Experimental and Clinical Cancer Research 41:1–20
Liang Z xing, Liu H shan, Wang F wei, et al (2019) LncRNA RPPH1 promotes colorectal cancer metastasis by interacting with TUBB3 and by promoting exosomes-mediated macrophage M2 polarization. Cell Death Dis. https://doi.org/10.1038/S41419-019-2077-0
Groot M, Lee H cells Sorting Mechanisms for MicroRNAs into Extracellular Vesicles and Their Associated Diseases. https://doi.org/10.3390/cells9041044
Zhang X, Takeuchi T, Takeda A, Mochizuki H, Nagai Y (2022) Comparison of serum and plasma as a source of blood extracellular vesicles: Increased levels of platelet-derived particles in serum extracellular vesicle fractions alter content profiles from plasma extracellular vesicle fractions. PLoS One. https://doi.org/10.1371/JOURNAL.PONE.0270634
Rooj AK, Mineo M, Godlewski J (2016) MicroRNA and extracellular vesicles in glioblastoma: small but powerful. Brain Tumor Pathol 33:77–88
Nikoobakht M, Shamshiripour P, Shahin M, Bouzari B, Razavi-Hashemi M, Ahmadvand D, Akbarpour M (2021) A systematic update to circulating extracellular vesicles proteome; transcriptome and small RNA-ome as glioma diagnostic, prognostic and treatment-response biomarkers. Cancer Treat Res Commun. https://doi.org/10.1016/J.CTARC.2021.100490
Matera AG, Terns RM, Terns MP (2007) Non-coding RNAs: lessons from the small nuclear and small nucleolar RNAs. Nat Rev Mol Cell Biol 8:209–220
Ojha S, Malla S, Lyons SM (2020) snoRNPs: Functions in Ribosome Biogenesis. Biomolecules. https://doi.org/10.3390/biom10050783
Schubert T, Pusch MC, Diermeier S, Benes V, Kremmer E, Imhof A, Längst G (2012) Df31 protein and snoRNAs maintain accessible higher-order structures of chromatin. Mol Cell 48:434–444
Kishore S, Stamm S (2006) The snoRNA HBII-52 regulates alternative splicing of the serotonin receptor 2C. Science 311:230–232
Kishore S, Khanna A, Zhang Z, Hui J, Balwierz PJ, Stefan M, Beach C, Nicholls RD, Zavolan M, Stamm S (2010) The snoRNA MBII-52 (SNORD 115) is processed into smaller RNAs and regulates alternative splicing. Hum Mol Genet 19:1153–1164
Siprashvili Z, Webster DE, Johnston D, et al (2016) The noncoding RNAs SNORD50A and SNORD50B bind K-Ras and are recurrently deleted in human cancer. Nat Genet 48:53–58
Xiao H, Feng X, Liu M, Gong H, Zhou X (2023) SnoRNA and lncSNHG: Advances of nucleolar small RNA host gene transcripts in anti-tumor immunity. Front Immunol. https://doi.org/10.3389/fimmu.2023.1143980
Lunavat TR, Cheng L, Kim DK, et al (2015) Small RNA deep sequencing discriminates subsets of extracellular vesicles released by melanoma cells – Evidence of unique microRNA cargos. RNA Biol 12:810–823
Zhu W, Niu J, He M, et al (2019) SNORD89 promotes stemness phenotype of ovarian cancer cells by regulating Notch1-c-Myc pathway. J Transl Med. https://doi.org/10.1186/s12967-019-2005-1
Pauli C, Liu Y, Rohde C, et al (2020) Site-specific methylation of 18S ribosomal RNA by SNORD42A is required for acute myeloid leukemia cell proliferation. Blood 135:2059–2070
Xia XR, Li WC, Yu ZT, Li J, Peng CY, Jin L, Yuan GL (2020) Effects of small nucleolar RNA SNORD44 on the proliferation, apoptosis and invasion of glioma cells. Histochem Cell Biol 153:257–269
Xu B, Ye MH, Lv SG, Wang QX, Wu MJ, Xiao B, Kang CS, Zhu XG (2017) SNORD47, a box C/D snoRNA, suppresses tumorigenesis in glioblastoma. Oncotarget 8:43953–43966
Chen L, Han L, Wei J, et al (2015) SNORD76, a box C/D snoRNA, acts as a tumor suppressor in glioblastoma. Sci Rep. https://doi.org/10.1038/SREP08588
Xu B, Ye MH, Lv SG, Wang QX, Wu MJ, Xiao B, Kang CS, Zhu XG (2017) SNORD47, a box C/D snoRNA, suppresses tumorigenesis in glioblastoma. Oncotarget 8:43953–43966
Chen L, Han L, Wei J, et al (2015) SNORD76, a box C/D snoRNA, acts as a tumor suppressor in glioblastoma. Sci Rep. https://doi.org/10.1038/srep08588
Michel CI, Holley CL, Scruggs BS, Sidhu R, Brookheart RT, Listenberger LL, Behlke MA, Ory DS, Schaffer JE (2011) Small nucleolar RNAs U32a, U33, and U35a are critical mediators of metabolic stress. Cell Metab 14:33–44
Brown TJ, Brennan MC, Li M, et al (2016) Association of the Extent of Resection With Survival in Glioblastoma: A Systematic Review and Meta-analysis. JAMA Oncol 2:1460–1469
Revilla-Pacheco F, Rodríguez-Salgado P, Barrera-Ramírez M, Morales-Ruiz MP, Loyo-Varela M, Rubalcava-Ortega J, Herrada-Pineda T, Haque N (2021) Extent of resection and survival in patients with glioblastoma multiforme: Systematic review and meta-analysis. Medicine 100:E26432
Millard NE, De Braganca KC (2016) Medulloblastoma. J Child Neurol 31:1341–1353
Guo X, Luo Z, Xia T, Wu L, Shi Y, Li Y (2019) Identification of miRNA signature associated with BMP2 and chemosensitivity of TMZ in glioblastoma stem-like cells. Genes Dis 7:424–439
Xing R (2019) miR-3648 promotes prostate cancer cell proliferation by inhibiting adenomatous polyposis coli 2. J Nanosci Nanotechnol 19:7526–31
Sun W, Li S, Yu Y, et al (2019) MicroRNA-3648 is upregulated to suppress TCF21, resulting in promotion of invasion and metastasis of human bladder cancer. Mol Ther Nucleic Acids 16:519–30
Tang W, Pei M, Li J, et al (2022) The miR-3648/FRAT1-FRAT2/c-Myc negative feedback loop modulates the metastasis and invasion of gastric cancer cells. Oncogene 41:4823–4838
Tu Y, Mei F (2022) miR-3648 promotes lung adenocarcinoma-genesis by inhibiting SOCS2 (suppressor of cytokine signaling 2). Bioengineered 13:3044–3056
Zhang D, Yin H, Bauer TL, Rogers MP, Velotta JB, Morgan CT, Du W, Xu P, Qian X (2021) Development of a novel miR-3648-related gene signature as a prognostic biomarker in esophageal adenocarcinoma. Ann Transl Med 9:1702–1702
Dong Y, Wu B, Wang X, Lu F, Li Q, Zhao Q (2022) High miR-3648 expression and low APC2 expression are associated with shorter survival and tumor progression in NSCLC. Histol Histopathol 37:355–364
Valkov N, Das S (2020) Y RNAs: Biogenesis, Function and Implications for the Cardiovascular System. Adv Exp Med Biol 1229:327
Zhou S, Van Bortle K (2023) The Pol III transcriptome: Basic features, recurrent patterns, and emerging roles in cancer. Wiley Interdiscip Rev RNA. https://doi.org/10.1002/wrna.1782
Bartkiewicz M, Gold H, Altman S (1989) Identification and characterization of an RNA molecule that copurifies with RNase P activity from HeLa cells. Genes Dev 3:488–499
Jarrous N, Mani D, Ramanathan A (2022) Coordination of transcription and processing of tRNA. FEBS J 289:3630–3641
Yue K, Ma JL, Jiang T, Yue J, Sun SK, Shen JL, Miao Y (2020) LncRNA RPPH1 predicts poor prognosis and regulates cell proliferation and migration by repressing P21 expression in gastric cancer. Eur Rev Med Pharmacol Sci 24:11072–11080
Xue L, Chen H, Wang X, Han L, Liu Y, Ding X (2022) circRPPH1_025 Overexpression Promotes Migration and Invasion of Glioblastoma Multiforme. Dis Markers. https://doi.org/10.1155/2022/4764028
Zhang Y, Tang L (2017) Inhibition of breast cancer cell proliferation and tumorigenesis by long non-coding RNA RPPH1 down-regulation of miR-122 expression. Cancer Cell Int. https://doi.org/10.1186/s12935-017-0480-0
Wu J, Niu S, Tan M, et al (2018) Cryo-EM Structure of the Human Ribonuclease P Holoenzyme. Cell 175:1393-1404.e11
Santangelo A, Imbrucè P, Gardenghi B, et al (2018) A microRNA signature from serum exosomes of patients with glioma as complementary diagnostic biomarker. J Neurooncol 136:51–62
Olioso D, Caccese M, Santangelo A, Lippi G, Zagonel V, Cabrini G, Lombardi G, Dechecchi MC (2021) Serum Exosomal microRNA-21, 222 and 124-3p as Noninvasive Predictive Biomarkers in Newly Diagnosed High-Grade Gliomas: A Prospective Study. Cancers (Basel). https://doi.org/10.3390/cancers13123006
Batool SM, Muralidharan K, Hsia T, Falotico S, Gamblin AS, Rosenfeld YB, Khanna SK, Balaj L, Carter BS (2022) Highly Sensitive EGFRvIII Detection in Circulating Extracellular Vesicle RNA of Glioma Patients. Clinical Cancer Research OF1–OF13

No competing interests reported.

Download PDF

Editorial decision: Revision requested
15 Jul, 2024
Editor assigned by journal
15 Jul, 2024
Submission checks completed at journal
09 Jul, 2024
First submitted to journal
05 Jul, 2024

You are reading this latest preprint version

Plasma extracellular vesicle sampling from high grade gliomas demonstrates a small RNA signature indicative of disease and identifies lncRNA RPPH1 as a high grade glioma biomarker.

Status:

Version 1

Abstract

Figures

Background

Material and Methods

Results

Patient cohort characteristics

sRNAs are differentially expressed between control and HGG plasma EVs

SnoRNA, lncRNA, and Y-RNA are differentially expressed between control and HGG plasma-EVs

Discussion

Conclusion

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1