Similarity in the microbial community structure of tobacco from geographically similar regions

doi:10.21203/rs.3.rs-4694674/v1

Download PDF

Article

Similarity in the microbial community structure of tobacco from geographically similar regions

https://doi.org/10.21203/rs.3.rs-4694674/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

To investigate the structural and functional similarities of microbial communities in burnt-sweetness alcoholized tobacco as a function of distance from the equator and their effects on tobacco quality, we sampled alcoholized tobacco from Chenzhou, Hunan Province, China and from Brazil and Zimbabwe, which are also burnt-sweetness-type tobacco producing regions, and performed high-throughput sequencing of tobacco bacterial and fungal communities along with an analysis of the main chemical constituents of the tobacco to analyze differences in the quality of the tobacco and similarities in the structure of the microbial communities. The total nitrogen, nicotine and starch contents of Chenzhou tobacco were greater than those of Brazilian and Zimbabwean tobacco, and the total sugar and reducing sugar contents of the Brazilian and Zimbabwean tobacco were greater than those of the Chenzhou tobacco (P < 0.05). The alpha diversity indices of the bacterial communities in Chenzhou tobacco were lower than those in the Brazilian and Zimbabwean tobacco, and the alpha diversity indices of the fungal communities in Chenzhou tobacco were greater than those in the Brazilian and Zimbabwean tobacco (P < 0.05). In the ecological networks, bacterial–fungal interactions in the Brazilian and Zimbabwean tobacco were more complex than those in the Chenzhou tobacco, and the microbial ecological networks of the burnt-sweetness-type tobacco from three different regions were dominated by competitive relationships. The microbial community composition of Chenzhou tobacco was similar to that of Brazilian tobacco at the bacterial genus and fungal phylum level, with Sphingomonas being a significantly enriched genus in Brazilian tobacco and a key genus in the Chenzhou network that is able to participate in the degradation of polyphenols and aromatic compounds. Functional microbes related to aromatic compounds and cellulose degradation were significantly more abundant in the Brazilian and Zimbabwean tobacco than in Chenzhou tobacco, and the related degradation of tobacco substances was responsible for the better quality of the Brazilian and Zimbabwean tobacco. In conclusion, there are similarities in the structure, composition and functional flora of microbial communities in tobacco from Chenzhou and Brazil because these regions have similar latitudinal distributions. This study provides theoretical support for selecting cultivation regions for the burnt-sweetness-type alcoholized tobacco and for the alcoholization of tobacco leaves.

Biological sciences/Microbiology/Communities/Microbiome

Biological sciences/Microbiology/Environmental microbiology/Food microbiology

burnt-sweetness type tobacco

microbial community

geographical distance

tobacco quality

The types and contents of the main chemical constituents and aroma-inducing substances of flue-cured tobacco are important factors affecting the quality and stylistic characteristics of tobacco¹. Compared with Chinese flue-cured tobacco, Zimbabwean and Brazilian flue-cured tobacco have lower contents of total nitrogen, polyphenols, chlorine, potassium, volatile acids, total phytobasic alkaloids, and petroleum ether extracts. In contrast, the protein, total sugar, reducing sugar, sugar-to-alkali ratio, and nitrogen-to-alkali ratio of Chinese flue-cured tobacco are greater than those of Zimbabwean and Brazilian flue-cured tobacco². The Chinese burnt-sweetness type of tobacco has defects such as heavy off-gassing, high irritation and insufficient flavor³. In contrast, tobaccos from Zimbabwe and Brazil, which are main producing areas of burnt-sweetness type tobacco, have higher contents of alcohols, ketones, and volatile aroma-inducing substances; therefore, the cigarettes have better aroma and aroma profiles and are an important part of China's large-scale cigarette industry⁴. Due to unique geographical locations and ecological and climatic conditions, tobacco grown in Zimbabwe and Brazil have unique style characteristics. Therefore, exploring the differences and the reasons for the differences in the quality of tobacco from geographically similar production regions in China, Zimbabwe and Brazil can help to promote the study of tobacco.

Tobacco alcoholization, also known as tobacco aging, refers to the process of natural fermentation of tobacco after it is reroasted and placed in boxes in an alcoholization warehouse⁵. During this period, the harmful and organic substances in the tobacco that are not conducive to quality are decomposed and transformed under the synergistic effect of chemical changes, enzymes and microorganisms, which improves the chemical composition of the tobacco and promotes the generation of aroma substances^6,7. Microorganisms can participate in the process of tobacco alcoholization as catalysts for material transformation and quality improvement^8,9. Microorganisms are consumers that use the organic substances in tobacco as substrates for their own growth, reproduction and metabolism and convert the substances into small aromatic molecules through the metabolism of amino acids and carbohydrates and the degradation of aromatic compounds^10,11. Microorganisms are also catabolizers; they have a broad range of enzymes, and the domestication of microbes due to long-term survival on the surface of tobacco increases the specialization and specificity of the enzymes they secrete¹². Microbial enzymes are produced as efficient enzyme catalysts to degrade pectin, cellulose and other cell wall materials, reducing the irritation and off-gassing caused by cell wall materials when the tobacco is burned, improving the quality of the tobacco¹³.

The effects of bacteria on the enhancement of tobacco quality through alcoholization mainly include regulating the proportion of chemical constituents, degrading harmful substances, and increasing the aroma of tobacco¹⁴. Bacillus is the most abundant enzyme-producing bacterial group in tobacco and can produce protease, cellulase, amylase, and glycosidase, which can reduce the irritating odor of tobacco caused by heterogeneous substances and promote the degradation of carotenoids and other substances and the formation of small molecular aroma substances^15–17. Studies have shown that microorganisms such as Bacillus spp., Pseudomonas spp. and Actinobacteria spp. are involved in the degradation of proteins, nicotine and total nitrogen in tobacco¹⁸. Inoculation with Klebsiella spp. and Bacillus thermophilus¹⁹ can effectively degrade macromolecules such as starch and cellulose within tobacco, promoting an increase in the content of aldehydes, ketones, esters, phenols, and alcohol aroma substances. Methylotrophic Bacillus fermentation of tobacco produces a milky flavor to improve the alcoholic quality of tobacco²⁰. The diversity and abundance of fungi identified in roasted tobacco are less than those of bacterial taxa, and Aspergillus, Pythium, Alternaria, Sampaiozyma and Cladosporium are the major fungal taxa in tobacco^21,22. The role of fungi in tobacco alcoholization is mainly due to their high enzymatic activity, which promotes the degradation of tobacco substances. Fungi such as Zygosaccharomyces²³, Saccharomyces cerevisiae²⁰, and Rhodotorula glutinis²⁴ secrete fatty acids, higher alcohols and other metabolites while producing their own aroma substances and using the tobacco material as a substrate. At the same time, they can participate in the synthesis of carotenoids, increase smoking, enrich the aroma of smoke and give tobacco a unique sweet brewing flavor so that the quality of cigarettes is significantly improved.

Chenzhou, Hunan Province, the main production area of China's burnt-sweetness type of tobacco, is one of eight major production areas for caramelized sweet mellow tobacco in the Nanling Hills Ecological Zone²⁵ [25]. Chenzhou's subtropical humid monsoon climate zone is characterized by abundant light and rainfall and a long frost-free period, and the seasonal light, temperature, and water resources are closely in line with the growth and development needs of tobacco²⁵. Chenzhou and Brazil have similar locations on either side of the equator and have similar light durations and intensities. Therefore, studying the differences in microbial community structures between Chenzhou and the Brazilian tobacco can help to elucidate the microbially mediated tobacco quality improvement process. In this study, we used the upper leaves of alcoholized 2-year-old plants produced in Chenzhou, Hunan Province, China, Zimbabwe and Brazil. High-throughput sequencing technology and statistical methods were used to analyze the quality of tobacco and the diversity of microbial communities and to understand the differences in the microbial community structure of burnt-sweetness alcoholized tobacco from different regions. Similarity in microbial community structures was explored to reveal differences in the styles of Chenzhou, Brazilian and Zimbabwean high-quality burnt-sweetness-type alcoholized tobacco to provide theoretical support for determining appropriate cultivation regions for the burnt-sweetness type of alcoholized tobacco and for the alcoholization of tobacco.

2.1Experimental design and sample collection

Alcoholized tobacco from Chenzhou, Hunan Province, China (CZ), Brazil (BX), and Zimbabwe (ZB) was collected in June 2022 from the Alcoholized Tobacco Depot in Yuxi City, Yunnan Province, China. The grade of Chenzhou tobacco was B₂F, the grade of Brazilian and Zimbabwean tobacco was L1O, all of which consisted of upper leaves, and all the samples came from the same alcoholizing warehouse after the same alcoholizing period. During sampling, 8 boxes of tobacco were randomly selected from each region. Because the top layer of tobacco is affected by the environment, the top 20 cm of tobacco was removed to avoid deviations in the quality of the samples. The remainder of the tobacco samples were collected from top to bottom every 10 cm. A total of 8 layers of 8 samples were mixed uniformly for each composite sample, for a total of 24 samples from the three regions was prepared. All samples collected were divided into two parts, one part was placed in a -80°C refrigerator for microbial detection, and the other part was placed in a room temperature laboratory for chemical composition detection.

2.2 Tobacco chemical composition analysis

The tobacco samples used for the analysis of chemical compositions were dried, crushed and sieved according to different index analysis methods, and the total sugar, reducing sugar, chloride ion, total nitrogen, and total potassium contents of the alcoholized tobacco were determined by continuous flow analysis¹⁵. Nicotine content was measured by extraction and decolorization²⁶, and the protein (YC/T249-2008) and starch (YC/T216-2013) contents were determined based on the Tobacco Industry Standards of China.

2.3 Microbial detection of tobacco

Alcoholized tobacco leaves from different regions were pretreated according to methods in Huang²⁷, and the precipitate was collected and stored in an ultralow temperature refrigerator to extract DNA from the samples. DNA was extracted from tobacco samples according to the operation requirements of plant DNA kit. The sequence amplification primers used for the bacterial 16S rRNA of alcoholized tobacco leaves and the fungal ITS region are shown in Table 1.

After configuring the necessary components for the PCR reaction, the template DNA was pre-denatured at 98°C for 5 min on a PCR instrument to fully denature the template DNA, and then entered into 25 amplification cycles to enrich the DNA fragments in large quantities. Each cycle consisted of the following steps, first holding at 98°C for 30 s to denature the template, then holding at 53°C for 30 s to fully anneal the primer from the template, followed by holding at 72°C for 45 s to extend the primer over the template and synthesize the DNA. finally, holding at 72°C for 5 min to extend the product intact. The amplification results were subjected to 2% agarose gel electrophoresis, and the target fragments were cut and then recovered by gel recovery kit. After purification and quantification, all PCR products were homogeneously mixed, and the constructed library was sequenced on the Illumina MiSeq platform. The gene sequences of the microbes identified in this experiment have been uploaded to the National Center for Biotechnology Information (NCBI) database. Among them, the sequence number of bacteria is PRJNA1131320, and the sequence number of fungi is PRJNA1131322.

Table 1

PCR amplification region, primers and sequence information.
Type	Region	Primer name	Primer sequence (5’-3’)
16S rDNA	V4-V5	515F	GTGCCAGCMGCCGCGGTAA
16S rDNA	V4-V5	907R	CCGTCAATTCMTTTRAGTTT
ITS rDNA	ITS3-ITS4	2024F	GCATCGATGAAGAACGCAGC
ITS rDNA	ITS3-ITS4	2409R	TCCTCCGCTTATTGATATGC

2.4 Sequencing data analysis

Microbial sequencing data were analyzed using QIIME2 (2019.4). Raw sequence data were decoded and processed using the demux plugin, primers were removed using the cutadapt plugin, and then sequences were quality filtered, denoised, spliced and chimera removed using the DADA2 plugin. Sequences were grouped according to 97% sequence similarity and generated the feature sequence OTU and abundance data table. The taxonomic information of each OTU was obtained by comparing the OTU feature sequences with the reference sequences in the database. The bacterial OTUs obtained in this study ranged from 62,000 to 11,8147 with a draw leveling depth of 62,000, and the fungal OTUs ranged from 7,182 to 49,992 with a draw leveling depth of 7,182 for all samples.

2.5 Construction of the molecular ecological network for bacterial-fungal interaction

Uploading OTU data of bacteria and fungi of alcoholized tobacco from three origins to the MENA analytical platform²⁸. Combining the results of the analysis of the data from the three origins to choose the same threshold, the OTUs that appeared at least four times in the eight samples were selected to be used to construct the network. Analyze the topological characteristics of the network, nodes and links and calculate the Within-module connectivity (Zi) and Among-module connectivity (Pi) of each node in the network. The interaction network features were analyzed in Cytoscape to obtain network node and connection parameters, and the network was visualized using Gephi. Based on the Zi and Pi values of a node, it can be divided into four parts, including peripheral, module hubs, network hubs and connectors, where the latter three are judged to be the key nodes in the network.

2.6 Data analysis

The chemical composition of tobacco was statistically analyzed using Microsoft Office Excel 2013 and SPSS. Analysis of variance (ANOVA) was performed on the chemical composition data and the results of data analysis were visualized using Origin 8.1.

The alpha diversity index was calculated to characterize the diversity and richness of the microbial community. Differences in tobacco microbial communities at the OTU level and community composition level among different origins were examined based on Bray-Curtis dissimilarity.The number of unique OTUs as well as the number of shared OTUs of microbial communities from different origins were revealed by Venn analysis. The relative abundance of taxa was calculated at the phylum and genus levels for bacterial and fungal communities. Linear discriminant analysis effect size (LEfSe) was used to identify important taxonomic groups related to the differences in the communities of alcoholized tobacco obtained from different regions, also known as biomarkers. All the above data analyses were carried out using the "microeco" and "magrittr" packages in RStudio 4.3.1 and visualized using the "ggplot2" package. Prediction of bacterial and fungal community colony function and abundance by PICRUSt2. Differences in microbial community function among alcoholized tobacco from different regions were analyzed using STAMP software. The Pearson correlation between the relative abundance of different genera, the alpha diversity index and the chemical composition of tobacco was calculated and visualized using the "corrplot" package in RStudio. The Mantel test was performed using the "linKET" package in RStudio to compare the chemical composition of the tobacco with the structure of the tobacco bacterial community, and the results were visualized.

3.1 Chemical composition of tobacco

As shown in Fig. 1, the total sugar, reducing sugar, and chloride contents and the sugar-to-alkali ratio of the Brazilian and Zimbabwean tobacco were significantly greater than those of Chenzhou tobacco (P < 0.05). The total nitrogen, potassium-to-chloride ratio and nicotine content of Chenzhou tobacco were significantly greater than those of the Brazilian and Zimbabwean tobacco (P < 0.05). The differences in total potassium and the nitrogen-to-alkali ratio of tobacco plants from the three regions were not significant (P < 0.05). The results for the content of macromolecules in tobacco leaves from the three regions showed that the starch content of Chenzhou tobacco was significantly greater than that of the Brazilian and Zimbabwean tobacco, and the protein content of the Brazilian tobacco was significantly greater than that from the other two regions (P < 0.05).

3.2 Tobacco microbial community diversity

The alpha diversity of microbial communities of alcoholized tobacco from different origins is shown in Fig. 2. The observed Chao1 value and ACE index of the Zimbabwean tobacco bacterial community were significantly greater than those of the Brazilian and Chenzhou tobacco bacterial communities, and the differences between the Shannon index and Simpson index of the tobacco bacterial communities from the three regions were not significant (P < 0.05). The observed values, Chao1 values and ACE indices of the fungal communities from different regions were significantly different (P < 0.05), with Chenzhou tobacco having the highest value, the Zimbabwean tobacco having the second highest value and the Brazilian tobacco having the lowest value. The Shannon index of the fungal community in Chenzhou tobacco was significantly greater than that in the Brazilian and Zimbabwean tobacco, and the Simpson index of the fungal community did not differ significantly (P < 0.05) among the tobaccos from different regions.

Differences in the microbial community structure of alcoholized tobacco from different origins are shown in Fig. 3. The differences among the bacterial communities of tobacco from different regions were not obvious (Fig. 3a), and 97.6% of the OTUs were shared OTUs, but the number of unique OTUs in the Zimbabwean tobacco was 753, which was much greater than that in the Chenzhou and Brazilian tobacco. There were significant differences in the community structure of fungi in tobacco from different regions (Fig. 3e); only 58.8% of the OTUs were shared, and Chenzhou tobacco had the greatest number of unique OTUs (384). PCoA (Figs. 3b, 3f), NMDS (Fig. 3c) and PCA (Fig. 3g) analyses revealed that the distribution of OTUs in the bacterial communities of tobacco from Chenzhou and Zimbabwe was more aggregated and that the community structures were similar. The bacterial community structure of the Brazilian tobacco was significantly different from that of the Zimbabwean and Chenzhou tobacco. The fungal community structure (based on the OTU level) of tobacco leaves differed significantly among the three regions. Analysis of variance based on Bray‒Curtis distance (i.e., ADNOIS, ANOSIM, and MRPP) further confirmed the above results (Figs. 3d, 3h, Table S1).

3.3 Tobacco microbial community composition

The phyla in the bacterial community of tobacco from different regions were mainly Proteobacteria, Actinobacteria, Firmicutes and Bacteroidetes (Fig. 4a). The relative abundance of the phylum Proteobacteria was significantly greater in Chenzhou tobacco (93.12%) than in Brazilian (86.50%) and Zimbabwean (85.71%) tobacco, and the relative abundance of the phylum Actinobacteria was significantly greater in Brazilian (8.31%) and Zimbabwean (7.69%) tobacco than in Chenzhou (2.02%) tobacco. The difference in the relative abundance of other phyla was not significant (P < 0.05). The dominant bacterial genera differed among tobacco from the three regions (Fig. 4b). The dominant genus of tobacco in Chenzhou (21.69%) and Brazil (31.6%) was Sphingomonas. In contrast, the Zimbabwean tobacco had a low abundance of Sphingomonas, and its dominant genus was Pseudomonas. Enterobacter was significantly more abundant in Chenzhou (21.30%) tobacco than in Brazilian (3.38%) and Zimbabwean (7.82%) tobacco. Methylorubrum and Aureimonas were significantly more abundant in the Brazilian and Zimbabwean tobacco than in Chenzhou tobacco. Methylobacterium and Novosphingobium were significantly more abundant in the Brazilian and Chenzhou tobacco than in Zimbabwean tobacco.

PCA of the tobacco bacterial communities from different regions at the phylum and genus levels also revealed the above differences (Fig. S1a and S1b). The differences in the composition of the tobacco bacterial communities from the three regions at the phylum level were small. At the genus level, the difference in bacteria in tobacco from Brazil and the other two regions was small, while the difference at the genus level between Chenzhou and Zimbabwean tobacco was large.

The phyla of tobacco fungal communities from different regions were mainly Ascomycota, Basidiomycota and Mucoromycota (Fig. 4c). Ascomycota was the dominant phylum in Zimbabwean tobacco, and its relative abundance (90.15%) was significantly greater than that in Chenzhou (65.03%) and Brazilian (58.02%) tobacco. In addition, the relative abundance of Mucoromycota in the Zimbabwean tobacco (5.33%) was also significantly greater than that in the Chenzhou (0.48%) and Brazilian (0.97%) tobacco. The relative abundance of Basidiomycota was significantly greater in the Chenzhou (34.32%) and Brazilian (41.01%) tobacco than in the Zimbabwean tobacco (4.52%). The genus-level composition of the fungal communities of the tobacco plants from the three regions varied considerably (Fig. 4d). Sampaiozyma was the dominant genus in Chenzhou (30.64%) and Brazilian (27.32%) tobacco, and its relative abundance was significantly greater than that in the Zimbabwean (2%) tobacco. The dominant fungal genera in the Zimbabwean tobacco were Aspergillus and Cercospora, and their relative abundances were significantly greater than those in the Chenzhou and Brazilian tobacco. The relative abundances of Alternaria, Cladosporium, and Thanatephorus were greater in Brazilian tobacco, while the relative abundances of Nigrospora and Fusarium were greater in Chenzhou tobacco.

PCA at the phylum and genus levels for the tobacco fungal communities from different regions showed that (Fig. S1c and Fig. S1d) the tobacco fungal communities in Brazil and Chenzhou were similar at the phylum levels, and the tobacco fungal communities in Zimbabwe were more different from those in the other two regions at the phylum level. There were significant differences at the genus level in the tobacco fungal communities from the three regions.

Specific taxa that can be used as biomarkers of tobacco from different regions and the dominant microbiota in each group were identified by LEfSe. A total of 38 statistically significant and biologically consistent bacterial taxa were identified (Fig. 5a). Among them, Brazilian tobacco was enriched with five bacterial taxa, namely, Pseudarthrobacter, Marmoricola, Aureimonas, Methylobacterium, and Sphingomonas. Two bacterial taxa, Sphingobacterium and Enterobacter, were enriched in Chenzhou tobacco. Zimbabwean tobacco was enriched in five bacterial taxa, namely, Curtobacterium, Microbacterium, Brevilactibacter, Marinactinospora and Terribacillus. Correlation analysis between bacterial markers and the chemical composition of tobacco leaves from different regions (Fig. 5-a) revealed that the significantly enriched bacterial taxa in the Brazilian and Zimbabwean tobacco leaves were significantly positively correlated with the TS and RS contents of tobacco leaves and significantly negatively correlated with the TN and protein contents of tobacco leaves. Significantly enriched bacterial taxa in Chenzhou tobacco showed a significant negative correlation with the TS content.

A total of 41 statistically significant and biologically consistent taxa were identified in the fungal community (Fig. 5a). Among them, the Brazilian tobacco was enriched with three fungal taxa, namely, Cladosporium, Alternaria and Thanatephorus. Chenzhou tobacco was enriched in four fungal taxa, namely, Pseudeurotium, Fusarium, Nigrospora and Sampaiozyma. Zimbabwean tobacco was enriched in three fungal taxa, namely, Cercospora, Aspergillus and Rhizopus. The correlation analysis between fungal markers and the chemical composition of tobacco from different regions showed that (Fig. 5-b) significantly enriched fungal taxa in the Brazilian and Zimbabwean tobacco were significantly and positively correlated with the RS content of tobacco, while significantly enriched fungal taxa in Chenzhou tobacco were significantly and negatively correlated with the RS content of tobacco. Significantly enriched taxa in the Zimbabwean tobacco were significantly negatively correlated with TN and protein content, while significantly enriched taxa in Chenzhou tobacco were significantly positively correlated with TN and protein content.

3.4 RMT network

To explore the potential microbial interaction patterns in tobacco leaves from different regions, we constructed ecological networks of bacterial–fungal interactions, showing the structural and topological features of microbial networks within different tobacco leaves. Figure 6 shows that the interaction network formed by bacteria and fungi in tobacco leaves in Brazil was most complex, with the highest number of nodes (132) and links (1019). Zimbabwean tobacco communities had 87 nodes and 245 links, and Chenzhou tobacco communities had the simplest structure of the bacterial–fungal interaction network in tobacco, with 68 nodes and 160 links. Positive links between nodes in the ecological network indicated cooperative interactions (symbiosis), and negative links indicated competitive interactions (antagonism). Negative interactions were dominant among the nodes of the three original tobacco networks. The negative links were in the following order from high to low: Chenzhou (96.88%) > Zimbabwe (95.10%) > Brazil (88.13%). As shown by the network topological characteristics (Table 2), the Brazilian tobacco interaction network had the highest average clustering coefficient and average connectivity with the smallest average path distance. This indicates that the nodes in the Brazilian tobacco bacterial–fungal interaction network have shorter distances but tighter connections between them, forming a more stable network structure.

To clarify the topological characteristics of each node in the ecological network of tobacco from different regions, the network was divided into four parts according to the Zi‒Pi values in the network: peripherals, module hubs, network hubs and connectors. The nodes located at the module hubs, network hubs and connector locations are the key nodes in the network. As shown in Figure S3, there were 3 key nodes in the Chenzhou tobacco interaction network, of which 2 were bacteria and 1 was fungi. There were 12 key nodes in the Zimbabwean tobacco interaction network, of which 7 were bacteria and 5 were fungi. There was no OTU as a key node in the Brazilian tobacco interaction network. Based on the categorical information of the key nodes, the key bacterial nodes in the Chenzhou tobacco network were Zea (OTU1403) and Sphingomonas (OTU1168), and the key node for the fungi was Stellatospora (ATU455). The key bacterial nodes in the Zimbabwean tobacco network were Tumebacillus (OTU364), Rubellimicrobium (OTU1244), Stenotrophomonas (OTU1709), Mycobacterium (OTU351), Unclassified (OTU623), Rubellimicrobium (OTU784) and Streptophyta (OTU1832), and the key nodes for the fungi were Cercospora (ATU141), Periconia (ATU710), Aspergillus (ATU313), Setophoma (ATU667) and Didymella (ATU329).

Based on the types of interactions observed between nodes in different networks (Fig. S4), it was concluded that most of the nodes in the Chenzhou tobacco interaction network were dominated by bacterial–fungal interactions, which accounted for 43.75%, and intrabacterial community and intrafungal community interaction OTUs both accounted for 28.125%. The Brazilian tobacco interaction network was dominated by intrafungal community interactions, which accounted for 72.33% of the total interactions, followed by bacterial–fungal interactions (18.25%) and intrabacterial community interactions (9.42%). In Zimbabwean tobacco, 52.65% of the OTU interaction within the tobacco community were bacterial–fungal interactions, 37.96% of the OTUs were intrabacterial community interactions, and the fewest were intrafungal community interactions, which accounted for only 9.39% of the OTUs. Negative correlations between the nodes of different interaction types was dominant, indicating that microbial taxa within the tobacco plants mostly had competitive interactions.

Table 2

Ecological network topological characteristics.
Network Indices	CZ (0.980)	BX (0.980)	ZB (0.980)
Total nodes	68	132	87
Total links	160	1019	245
Negative links %	96.88	88.13	95.10
Average degree (avgK)	4.706	15.439	5.632
Average clustering coefficient (avgCC)	0.016	0.153	0.084
Average Connectivity	4.706	15.439	5.632
Average path distance (GD)	2.926	2.274	2.826
Modularity (no. of module)	0.482 (7)	0.206 (7)	0.449 (9)
Harmonic geodesic distance (HD)	2.418	1.799	2.411
Connectedness (Con)	0.831	0.473	0.783

3.5 Tobacco microbial community function

Predictive analysis of the functions of bacterial and fungal communities in tobacco from different regions by PICRUSt2 revealed that the bacterial community had a total of 48 functions and that the fungal community had a total of 79 functions. The main functions of the bacterial community were chemoheterotrophy, aerobic chemoheterotrophy, nitrate reduction, aromatic compound degradation, aromatic hydrocarbon degradation and cellulolysis (Fig. 7-a). The main functions of the fungal community were fatty acid and beta-oxidation, the glyoxylate cycle, GDP-mannose biosynthesis, methyl ketone biosynthesis and pyruvate fermentation to isobutanol (Fig. 7-b).

PCA of the microbial functions of tobacco from different regions showed that the bacterial communities of tobacco from the three regions were similar in function (Fig. 7-c), and the fungal communities of Chenzhou and Brazil were similar in function, while there was a significant difference in function between them and the Zimbabwean tobacco fungal communities (Fig. 7-d). Differential analysis of the bacterial community structure via STAMP revealed (Fig. 7-e) that the bacterial communities in the Brazilian and Zimbabwean tobacco were involved in aromatic hydrocarbon degradation, cellulolysis, hydrocarbon degradation, and aliphatic nonmethane hydrocarbon degradation, and these functions were significantly more prominent in the Brazilian and Zimbabwean tobacco than in Chenzhou tobacco.

3.6 Effects of the microbial community on tobacco quality

To clarify the influence of tobacco microbial community structure, diversity, and the relative abundance of key genera on tobacco quality, correlation analysis was performed on the above indicators. We correlated the bacterial and fungal community structures with the chemical composition of tobacco leaves by the Mantel test (Fig. 8a). Overall, there were significant correlations (P < 0.001) between fungal community structure and TS, RS, TN, chloride, starch and protein content, while the correlation between bacterial community structure and chemical composition was not significant. The alpha diversity indices of the fungal communities were significantly negatively correlated with the TS, RS contents and sugar-to-alkali and positively correlated with the TN, TK and protein contents (Fig. 8b).

Among the bacterial taxa (Fig. 8c), Curtobacterium, Microbacterium, Pseudarthrobacter, and Marmoricola were significantly positively correlated with the TS and RS contents, and Sphingobacterium was significantly negatively correlated with the TS and RS contents. The abundances of Sphingomonas, Methylobacterium, and Marmoricola were significantly positively correlated with starch content, and the abundances of Terribacillus and Tumebacillus were significantly negatively correlated with starch content. Curtobacterium, Microbacterium, Pseudarthrobacter, Marmoricola, and Marinactinospora were significantly negatively correlated with TN and protein content, Pseudomonas was significantly negatively correlated with protein content; and Methylorubrum, Aureimonas, and Rubellimicrobium were significantly negatively correlated with TN content.

Among the fungal taxa (Fig. 8d), Fusarium, Didymella, Pseudeurotium, and Stellatospora were significantly negatively correlated with the TS and RS contents, and Aspergillus, Thanatephorus, and Rhizopus were significantly positively correlated with the TS and RS contents. Sampaiozyma, Alternaria, Cladosporium, Thanatephorus, and Periconia were significantly positively correlated with starch, and Nigrospora was significantly negatively correlated with starch. Sampaiozyma, Fusarium, Pseudeurotium, and Stellatospora were significantly positively correlated with TN; Sampaiozyma, Fusarium, Pseudeurotium, and Stellatospora were significantly positively correlated with TN; Aspergillus, Cercospora, and Rhizopus were significantly negatively correlated with TN and protein; and Nigrospora, Pseudeurotium, and Stellatospora were significantly positively correlated with nicotine.

A comparison of the chemical compositions of the three burnt-sweetness types of tobacco revealed that the total nitrogen, nicotine and starch contents of Chenzhou tobacco after one year of alcoholization were significantly greater than those of the Brazilian and Zimbabwean tobacco and that the TS and RS contents of the Brazilian and Zimbabwean tobacco were significantly greater than those of the Chenzhou tobacco (P < 0.05). The rapid degradation of organic macromolecules in the Brazilian and Zimbabwean tobacco with the same alcoholization time and a high content of small molecules, such as total sugars and reducing sugars, were the reasons for the strong aroma and the low irritating effect of these tobaccos. Chenzhou tobacco has a high content of starch and total nitrogen, so it produces a pungent and bitter flavor when it is smoked.

The results of microbial community diversity analysis in tobacco showed that the alpha diversity indices of the bacterial communities in Chenzhou tobacco were significantly lower than those in the Brazilian and Zimbabwean tobacco, and the alpha diversity indices of the fungal communities were greater than those in the Brazilian and Zimbabwean tobacco (P < 0.05). Negative interactions dominated the bacterial community in the ecological network of Chenzhou tobacco. Most functional microorganisms involved in the degradation of starch, protein and nicotine during tobacco alcoholization are bacteria^29–31. Therefore, microbial competition for material resources and antagonism between populations led to a reduction in bacterial taxa in Chenzhou tobacco, and the decrease in diversity resulted in a weakening of the functional characteristics of the bacterial taxa in tobacco, which are involved in the degradation of materials and the enhancement of alcoholized tobacco quality. The microorganisms that cause tobacco mold are Aspergillus flavus, Aspergillus oryzae and other fungal microorganisms³². In conclusion, the lower bacterial diversity and greater fungal diversity in Chenzhou tobacco than in the Brazilian and Zimbabwean tobacco are the reasons why the quality of the Chenzhou tobacco is lower.

The analysis of microbial community composition and functional prediction revealed that the composition of Chenzhou tobacco at the bacterial genus and fungal phylum levels was similar to that of the Brazilian tobacco, while the similarity in the distribution of bacterial and fungal functional flora between the Chenzhou and Brazilian tobacco was significant (P < 0.05), which may be attributed to the similar geographical locations of the two regions relative to the equator. Chenzhou is located at the intersection of the Nanling Mountains and Luoxiao Mountains between 24°N and 26°N, while Brazil is located in the Southern Hemisphere in the eastern part of South America between 5°N and 35°S^33,34. Chenzhou and Brazil have similar latitudinal distributions, sunshine hours and other climatic conditions. Functional prediction analysis revealed that functional bacterial communities in the Brazilian and Zimbabwean tobacco were significantly more abundant than those in Chenzhou tobacco in terms of aromatic hydrocarbon degradation, cellulose degradation, hydrocarbon degradation, and degradation of aliphatic nonmethane hydrocarbons. This may explain the better quality of the Brazilian and Zimbabwean burnt-sweetness type alcoholized tobacco compared to Chenzhou burnt-sweetness type alcoholized tobacco.

Significantly enriched microbial taxa and key microbial groups in tobacco may be responsible for differences in tobacco quality. Based on the results of functional prediction, LEfSe and correlation analysis, it was found that Pseudarthrobacter and Marmoricola, which were significantly enriched in Brazilian tobacco and were positively correlated with the TS and RS contents of tobacco (Fig. 8-c), and they are both polycyclic aromatic hydrocarbon-degrading bacteria that are capable of degrading lignocellulose through fermentation processes^35–37. In addition, Sphingomonas is a significantly enriched taxon in the Brazilian tobacco and a key genus in the ecological network of Chenzhou tobacco. Sphingomonas spp. are considered to be the most promising microbes for the biodegradation of aromatic compounds and can be used for environmental protection and industrial processes due to their high metabolic capacity and wide range of physiological properties³⁸. It has been shown that Sphingomonas can be used to degrade polyphenols and amylopectin in tobacco, and the addition of this strain during the tobacco fermentation process can improve the sensory quality of the final tobacco³⁹. Terribacillus, a significantly enriched bacterial genus within Zimbabwean tobacco, showed a significant negative correlation with starch content, which is consistent with the findings of Tao⁴⁰. Most bacteria in the genus Bacillus are capable of producing amylase to degrade starch into small molecules⁴¹. The abundance of Fusarium, with Pseudeurotium as a significantly enriched fungal taxon within Chenzhou tobacco, was significantly negatively correlated with the total sugar and reducing sugar contents. We speculate that the presence of taxa that utilize the sugars within tobacco as a substrate for metabolism will reduce the sugars within tobacco and affect smoking.

Tobacco and microorganisms together constitute an alcoholizing microecological environment that is influenced by chemical composition and aroma-inducing substance composition, and environmental changes enhance the screening of species due to alterations in the tobacco alcoholizing environment⁴². Microbial interspecies interactions have important effects on the alcoholizing microecological environment and tobacco quality⁴³. Interspecies interactions, such as that between Saccharomyces and Erotium, have been shown to have a key influence on microbial community homeostasis⁴⁴. Enhanced interspecific competitive relationships slow the growth and reproduction of populations that are weakly ecologically adapted and at the same time are at a disadvantage in terms of material competition, leading to a decrease in microbial community diversity. Studies have shown that interactions among microbial communities play a key role in maintaining ecosystem function and structural stability⁴⁵. Therefore, to explore the potential microbial interaction patterns in the bacterial–fungal interaction network of tobacco from different regions, in the present study, a bacterial–fungal interaction ecological network was constructed to display the structural and topological characteristics of the microbial networks within different tobacco species. The results showed that the bacterial–fungal interaction networks of tobacco from the three regions were mainly negatively correlated, with antagonism as the dominant interaction, and their strengths were in the order Chenzhou > Zimbabwe > Brazil. The number of nodes and connections in the ecological network were the highest in Brazil, while the Brazilian tobacco interaction network had the highest average clustering coefficient, average connectivity and the smallest average path distance, which indicated that the distance between nodes in the Brazilian tobacco bacterial–fungal interaction network was shorter but the connections were tighter, the network structure formed was more stable, and the communities had stronger functional characteristics.

Studies have shown that microbial community composition shapes metabolic activities⁴⁶, and the growth of species enhances competition for nutrient utilization among them, shaping environments dominated by competitive relationships⁴⁷. Based on the types of node interactions in the network in this study, it can be concluded that both inter- and intracommunity interactions in tobacco from the three regions were dominated by negative interactions, indicating that tobacco microbes were mostly antagonistic to each other. Competitive relationships form among nodes when the species composition is diverse, the stability of ecological networks increases with increasing complexity, and an increase in negative correlation among species also enhances the stability of networks⁴⁸.

The total nitrogen, nicotine and starch contents of Chenzhou tobacco were greater than those of Zimbabwean and Brazilian tobacco, and the total sugar and reducing sugar contents of the Brazilian and Zimbabwean tobacco were greater than those of the Chenzhou tobacco. The alpha diversity indices of the bacterial communities in Chenzhou tobacco were lower than those in the Brazilian and Zimbabwean tobacco, and the alpha diversity indices of the fungal communities were greater than those in the Brazilian and Zimbabwean tobacco. Bacterial–fungal interactions were more complex in the Brazilian and Zimbabwean tobacco, and competition dominated the microbial ecological network of burnt-sweetness-type tobacco. The composition of Chenzhou tobacco was similar to that of the Brazilian tobacco at the bacterial genus and fungal phylum levels, among which Sphingomonas were significantly enriched in Brazil tobacco, and they were also the key genera in the network of Chenzhou tobacco and are able to participate in the degradation of polyphenols and aromatic compounds. Aromatic compound content and cellulose degradation were significantly greater in the Brazilian and Zimbabwean tobacco than in Chenzhou tobacco. Because Chenzhou and Brazil have the same latitudinal profiles, there are similarities in the structure, composition and functional flora of the microbial communities of tobacco from Chenzhou and Brazil. The present study provides theoretical support for selecting cultivation regions for Chinese burnt-sweetness-type tobacco and tobacco mellowing.

Acknowledgements

The authors gratefully acknowledge the support from the Key Project of Science and Technology of Yunnan Tobacco Industry Co., Ltd. (2022539200340098).

Data availability

The data that support the findings of this study are available from the corresponding author upon reasonable request. Raw 16S rRNA and ITS gene sequences were submitted to the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) under accession number PRJNA1131320, and PRJNA1131322.

Author contributions

Z. and J.L. participated in planning, data analysis and writing-first draft, Q.T. participated in planning, design research and investigation, X.Y. participated in planning and design research design research, methodology, Z.L., W.L. for data analysis, writing-review and editing. D.K. and L.J. designed and implemented the model, generating all the results and visualizations. This study was proposed by Q.T., Y.J. and X.J., and J.L. supervised the whole process of the study. All authors read and approved the draft.

Conflict-of-interest statement

Li Zhengfeng, Xia Yuzhen, Wang Luoping, Duan Kai, Yao Jianhua and Xia Jianjun are employed by China Tobacco Yunnan Industrial CO.,LTD. We declare that we have no financial and personal relationships with other people or organizations that can inappropriately influence our work. There is no professional or other personal interest of any nature or kind in any product, service and/or company that could be construed as influencing the position presented in, or the review of, this manuscript.

Ning, Y. et al. Tobacco microbial screening and application in improving the quality of tobacco in different physical states. Bioresources Bioprocess. 10 10.1186/s40643-023-00651-6 (2023).
Zhang, Y. et al. Analysis of differences in tobacco leaf microbial communities after redrying in Chinese provinces and from abroad. Amb Express. 13 10.1186/s13568-023-01580-5 (2023).
Yan, T. et al. Unraveling the Difference in the Composition/Content of the Aroma Compounds in Different Tobacco Leaves: For Better Use. Journal of Chemistry doi: (2022). 10.1155/2022/3293899 (2022).
Su, C. et al. Diversity and phylogeny of bacteria on Zimbabwe tobacco leaves estimated by 16S rRNA sequence analysis. Appl. Microbiol. Biotechnol. 92, 1033–1044. 10.1007/s00253-011-3367-3 (2011).
Ren, M. et al. Effects of fermentation chamber temperature on microbes and quality of cigar wrapper tobacco leaves. Appl. Microbiol. Biotechnol. 107, 6469–6485. 10.1007/s00253-023-12750-7 (2023).
Xue, F. et al. Metagenomic insight into the biodegradation of biomass and alkaloids in the aging process of cigar. Bioresources Bioprocess. 10 10.1186/s40643-023-00667-y (2023).
Zhang, G. et al. Metabolomics reveals the effects producing region and fermentation stage on substance conversion in cigar tobacco leaf. Chem. Biol. Technol. Agric. 10 10.1186/s40538-023-00444-1 (2023).
Wen, C. et al. High throughput screening of key functional strains based on improving tobacco quality and mixed fermentation. Front. Bioeng. Biotechnol. 11 10.3389/fbioe.2023.1108766 (2023).
Liu, F. et al. Microbial community and metabolic function analysis of cigar tobacco leaves during fermentation. Microbiologyopen. 10 10.1002/mbo3.1171 (2021).
Zhang, L. Y. et al. Study on tobacco quality improvement and bacterial community succession during microbial co-fermentation. Ind. Crops Prod. 208 10.1016/j.indcrop.2023.117889 (2024).
Zhang, G. et al. Changes in physicochemical properties and microbial community succession during leaf stacking fermentation. Amb Express. 13 10.1186/s13568-023-01642-8 (2023).
Zhang, Q. et al. Microbial and enzymatic changes in cigar tobacco leaves during air-curing and fermentation. Appl. Microbiol. Biotechnol. 107, 5789–5801. 10.1007/s00253-023-12663-5 (2023).
Hu, W. et al. Study on the chemical compositions and microbial communities of cigar tobacco leaves fermented with exogenous additive. Sci. Rep. 12 10.1038/s41598-022-23419-y (2022).
Wu, X. et al. Study on the correlation between the dominant microflora and the main flavor substances in the fermentation process of cigar tobacco leaves. Front. Microbiol. 14 10.3389/fmicb.2023.1267447 (2023).
Di Giacomo, M. et al. Microbial community structure and dynamics of dark fire-cured tobacco fermentation. Appl. Environ. Microbiol. 73, 825–837. 10.1128/aem.02378-06 (2007).
Li, Y. H., Ding, M., Wang, J., Xu, G. J. & Zhao, F. A novel thermoacidophilic endoglucanase, Ba-EGA, from a new cellulose-degrading bacterium, Bacillus sp.AC-1. Appl. Microbiol. Biotechnol. 70, 430–436 (2006).
Pen, J. et al. Production of active Bacillus licheniformis alpha-amylase in tobacco and its application in starch liquefaction. Bio/technology (Nature Publishing Company). 10, 292–296. 10.1038/nbt0392-292 (1992).
Ma, L., Wang, Y., Wang, X. & Lu, X. Solid-State Fermentation Improves Tobacco Leaves Quality via the Screened Bacillus subtilis of Simultaneously Degrading Starch and Protein Ability. Appl. Biochem. Biotechnol. 196, 506–521. 10.1007/s12010-023-04486-x (2024).
Huang, S. et al. Effects of Bacillus subtilis subsp. on the microbial community and aroma components of flue-cured tobacco leaves based on metagenome analysis. Arch. Microbiol. 204 10.1007/s00203-022-03347-1 (2022).
Qiu, F. et al. Effects of Saccharomyces cerevisiae on microbial community and flavor metabolites in solid-state fermentation of strong-flavor Baijiu. Food Bioscience. 59 10.1016/j.fbio.2024.103925 (2024).
Zhao, S. et al. Dynamic changes in fungal communities and functions in different air-curing stages of cigar tobacco leaves. Front. Microbiol. 15 10.3389/fmicb.2024.1361649 (2024).
Hu, B. et al. The effect of flue-curing procedure on the dynamic change of microbial diversity of tobaccos. Sci. Rep. 11 10.1038/s41598-021-84875-6 (2021).
Yao, L. et al. Application of yeast in plant-derived aroma formation from cigar filler leaves. Front. Bioeng. Biotechnol. 10 10.3389/fbioe.2022.1093755 (2022).
Watcharawipas, A. & Runguphan, W. Red yeasts and their carotenogenic enzymes for microbial carotenoid production. FEMS Yeast Res. 23 10.1093/femsyr/foac063 (2023).
Xiao, Y. et al. Evolution trend of soil fertility in tobacco-planting area of Chenzhou, Hunan Province, China. Open. Life Sci. 17, 1568–1578. 10.1515/biol-2022-0509 (2022).
Li, J., Zhao, Y., Qin, Y. & Shi, H. Influence of microbiota and metabolites on the quality of tobacco during fermentation. BMC Microbiol. 20 10.1186/s12866-020-02035-8 (2020).
Huang, J. et al. Bacterial diversities on unaged and aging flue-cured tobacco leaves estimated by 16S rRNA sequence analysis. Appl. Microbiol. Biotechnol. 88, 553–562. 10.1007/s00253-010-2763-4 (2010).
Deng, Y. et al. Molecular ecological network analyses. BMC Bioinform. 13 10.1186/1471-2105-13-113 (2012).
Dai, J. et al. Production of Highly Active Extracellular Amylase and Cellulase From Bacillus subtilis ZIM3 and a Recombinant Strain With a Potential Application in Tobacco Fermentation. Front. Microbiol. 11 10.3389/fmicb.2020.01539 (2020).
Zhang, Y. et al. Screening, identification, and mechanism analysis of starch-degrading bacteria during curing process in tobacco leaf. Front. Bioeng. Biotechnol. 12 10.3389/fbioe.2024.1332113 (2024).
Grether-Beck, S. et al. Structural analysis and molybdenum-dependent expression of the pAO1-encoded nicotine dehydrogenase genes of Arthrobacter nicotinovorans. Mol. Microbiol. 13, 929–936. 10.1111/j.1365-2958.1994.tb00484.x (1994).
Zhou, J., Cheng, Y., Yu, L., Zhang, J. & Zou, X. Characteristics of fungal communities and the sources of mold contamination in mildewed tobacco leaves stored under different climatic conditions. Appl. Microbiol. Biotechnol. 106, 131–144. 10.1007/s00253-021-11703-2 (2022).
Pan, Z. et al. Formation mechanism analysis of cover collapse sinkholes in Wugaishan Town, Chenzhou City, Hunan province, China. Environ. Earth Sci. 81 10.1007/s12665-022-10171-9 (2022).
Oliveira, U. et al. Modelling Highly Biodiverse Areas in Brazil. Sci. Rep. 9 10.1038/s41598-019-42881-9 (2019).
Ren, W. et al. Enhanced remediation of PAHs-contaminated site soil by bioaugmentation with graphene oxide immobilized bacterial pellets. J. Hazard. Mater. 433 10.1016/j.jhazmat.2022.128793 (2022).
Asimakoula, S., Marinakos, O., Tsagogiannis, E. & Koukkou, A. I. Phenol Degradation by Pseudarthrobacter phenanthrenivorans Sphe3. Microorganisms 11, doi: (2023). 10.3390/microorganisms11020524
Li, J. et al. Autochthonous bioaugmentation with non-direct degraders: A new strategy to enhance wastewater bioremediation performance. Environ. Int. 136 10.1016/j.envint.2020.105473 (2020).
Huang, H., Lin, J., Wang, W. & Li, S. Biopolymers Produced by Sphingomonas Strains and Their Potential Applications in Petroleum Production. Polymers. 14 10.3390/polym14091920 (2022).
Ma, Y. et al. Microbial Degradation of Chlorogenic Acid by a Sphingomonas sp Strain. Appl. Biochem. Biotechnol. 179, 1381–1392. 10.1007/s12010-016-2071-2 (2016).
Tao, J. et al. Metagenomic insight into the microbial degradation of organic compounds in fermented plant leaves. Environ. Res. 214 10.1016/j.envres.2022.113902 (2022).
Wang, Y., Dong, J., Jin, Z. & Bai, Y. Analysis of the action pattern of sequential a-amylases from B. stearothermophilus and B. amyloliquefaciens on highly concentrated soluble starch. Carbohydr. Polym. 320 10.1016/j.carbpol.2023.121190 (2023).
Zhang, M. et al. Analyzing microbial community and volatile compound profiles in the fermentation of cigar tobacco leaves. Appl. Microbiol. Biotechnol. 108 10.1007/s00253-024-13043-3 (2024).
Zhang, Q., Geng, Z., Li, D. & Ding, Z. Characterization and discrimination of microbial community and co-occurrence patterns in fresh and strong flavor style flue-cured tobacco leaves. Microbiologyopen. 9 10.1002/mbo3.965 (2020).
Li, R. R. et al. Application Potential of Baijiu Non- Saccharomyces Yeast in Winemaking Through Sequential Fermentation With Saccharomyces cerevisiae. Front. Microbiol. 13 10.3389/fmicb.2022.902597 (2022).
Zheng, Z. et al. Integrated network analysis reveals that exogenous cadmium-tolerant endophytic bacteria inhibit cadmium uptake in rice. Chemosphere. 301 10.1016/j.chemosphere.2022.134655 (2022).
Ren, M. et al. Effects of microbes and metabolites on tobacco quality in Humi characteristic fermentation of cigar tobacco leaf. Process Biochem. 143, 186–197. 10.1016/j.procbio.2024.05.008 (2024).
Wu, X. et al. Profiling the role of microorganisms in quality improvement of the aged flue-cured tobacco. BMC Microbiol. 22 10.1186/s12866-022-02597-9 (2022).
Wagner, A. Competition for nutrients increases invasion resistance during assembly of microbial communities. Mol. Ecol. 31, 4188–4203. 10.1111/mec.16565 (2022).

Competing interest reported. Yes, the authors have competing interests as defined by Nature Research, or other interests that might be perceived to influence the results and/or discussion reported in this paper.

Supplementaryinformation.docx

Download PDF

Reviews received at journal
03 Oct, 2024
Reviewers agreed at journal
23 Sep, 2024
Reviews received at journal
14 Sep, 2024
Reviewers agreed at journal
12 Sep, 2024
Reviewers agreed at journal
05 Sep, 2024
Reviewers invited by journal
03 Sep, 2024
Editor assigned by journal
02 Sep, 2024
Editor invited by journal
27 Aug, 2024
Submission checks completed at journal
27 Aug, 2024
First submitted to journal
05 Jul, 2024

You are reading this latest preprint version

Similarity in the microbial community structure of tobacco from geographically similar regions

Status:

Version 1

Abstract

Figures

1 Introduction

2 Methods

2.1Experimental design and sample collection

2.2 Tobacco chemical composition analysis

2.3 Microbial detection of tobacco

2.4 Sequencing data analysis

2.5 Construction of the molecular ecological network for bacterial-fungal interaction

2.6 Data analysis

3 Results

3.1 Chemical composition of tobacco

3.2 Tobacco microbial community diversity

3.3 Tobacco microbial community composition

3.4 RMT network

3.5 Tobacco microbial community function

3.6 Effects of the microbial community on tobacco quality

4 Discussion

5 Conclusions

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1