Empagliflozin inhibits PASMCs Phenotypic transition via downexpressing SYK and attenuates artery remodeling in MCT-induced pulmonary arterial hypertension

doi:10.21203/rs.3.rs-4695907/v1

Download PDF

Research Article

Empagliflozin inhibits PASMCs Phenotypic transition via downexpressing SYK and attenuates artery remodeling in MCT-induced pulmonary arterial hypertension

https://doi.org/10.21203/rs.3.rs-4695907/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Purpose

Pulmonary arterial hypertension (PAH) is a serious cardiovascular disease that ultimately leads to right heart failure and even death due to pulmonary artery remodeling. The purpose of this study was to investigate the effects of the sodium glucose cotransporter 2 inhibitor empagliflozin (EMPA) on rats with PAH and its direct effects on pulmonary artery smooth muscle cells (PASMCs).

Methods

PAH was induced in rats by injection of monocrotaline (MCT) (40 mg/kg), followed by treatment with EMPA (10 mg/kg/day) or physiological saline alone for four weeks. The effects of EMPA on the structure and function of the heart, pulmonary artery, and right heart were evaluated via echocardiography, histology, and ELISAs. The proliferation, migration, and phenotypic transition of cells in the pulmonary blood vessels were determined through WB. PDGF-BB was applied to stimulate the proliferation and migration of PASMCs, and the effect of EMPA on PASMCs was evaluated using scratch assays, Transwell assays, colony formation assays, and WB. Moreover, the regulation of SYK by EMPA was assessed. Overexpression of SYK and treatment of PASMCs with EMPA were performed to determine the effects of EMPA on proliferation, migration, and phenotypic transformation.

Results

Cardiac ultrasound, HE staining, Masson staining, and ELISAs revealed that EMPA alleviates pulmonary artery and right ventricular remodeling and dysfunction in rats with PAH. EMPA normalized the hemodynamic parameters and structure of pulmonary arterioles, including vascular wall thickness, CVF, and heart failure marker levels. In the presence of platelet-derived growth factor (PDGF)-BB, EMPA inhibited the proliferation and migration of PASMCs and the phenotypic transition of PASMCs. SYK overexpression stimulated the proliferation and phenotypic transition of PASMCs. EMPA treatment also inhibited the proliferation and phenotypic transition of PASMCs caused by SYK overexpression.

Conclusion

Our study first demonstrates that EMPA inhibits PASMC phenotypic transition by downregulating SYK, thereby exerting an antiproliferative effect on MCT-induced PAH.

Pulmonary arterial hypertension

Empagliflozin

SYK

Phenotypic transition

Pulmonary hypertension (PH) is a serious cardiovascular disease characterized by acute vasoconstriction, phenotypic transformation, and vascular remodeling that results in lumen stenosis and even autochthonous thrombus^[1]. Global data show that the incidence rate of pulmonary hypertension in adults is approximately 1%, and the rate in people over 65 years old is as high as 10% at present^[2]. The phenotypic transition of PASMCs, which leads to vascular remodeling, is the most important feature of vascular remodeling. Carcinoid changes, such as increased proliferation and migration of pulmonary artery smooth muscle cells and reduced apoptosis, are the pathological and physiological basis of pulmonary arterial hypertension^[3]. However, the current commonly used pulmonary arterial hypertension-targeted drugs are not effective for vascular remodeling; thus, treatment methods that can reverse pulmonary artery vascular remodeling in clinical practice are urgently needed^[4].

SGLT-2i has become a popular cardiovascular drug in recent years, and its cardioprotective effect has been established through studies such as DAPA-HF and EMPA-REG^[5–7]. Research has shown that SGLT-2i can promote arterial vascular compliance to reduce vascular pressure through weight loss, blood pressure reduction, inhibition of vascular inflammation, reduction of oxidative stress, alleviation of endothelial dysfunction, reduction of foam cell formation, prevention of platelet activation and other mechanisms^{[8, 9]}. Moreover, empagliflozin directly acts on vascular smooth muscle through various pathways and targets, inhibiting the proliferation and migration of smooth muscle cells^[10]. Although a few studies have indicated that empagliflozin has a therapeutic effect on pulmonary arterial hypertension, further research is needed to elucidate its effect and mechanism^[11].

Empagliflozin was shown to inhibit proliferation through inflammatory pathways such as the NLRP3/IL-1 pathway in vascular smooth muscle^[12]. The protein encoded by SYK is a member of the nonreceptor tyrosine kinase Src family and catalyzes the phosphorylation of substrate protein tyrosine residues^[13]. This protein plays an important role in adaptive immune receptor signaling and is also an important target in the immune inflammatory pathway^[14]. Studies have shown that the inhibition or knockout of SYK significantly prevented SMC proliferation and migration induced by PDGF-BB^{[15, 16]}, while other studies have confirmed that SYK promotes proliferation and migration of PASMCs induced by PDGF-BB. Moreover, SYK inhibitors reduced the proliferation and migration of PASMCs, thereby exerting a protective effect on pulmonary arterial hypertension^[17]. Thus, this study explored the therapeutic effect of empagliflozin on the pulmonary arterial smooth muscle phenotypic transition by targeting the SYK protein.

2.1 Animal model and treatment

All experiments were conducted using male Sprague‒Dawley rats (220–250 g) from Beijing Vital River Laboratory Animal Technology Co., Ltd., and the procedures were approved by The First Clinical Hospital affiliated with the Harbin Medical University Animal Care Committee. In the disease group, PAH was induced in the rats by a single intraperitoneal injection of MCT (60 mg/kg, MCE, USA) on Day 0. A parallel group of rats in the control group was injected with an equal volume of saline. Rats assigned to treatment evaluation studies were treated with empagliflozin (10 mg/kg per day) for 28 days starting on Day 1. These rats underwent heart function assessments on Day 28, after which they were euthanized, and their hearts and lungs were harvested for histological examination.

2.2 Echocardiography

Echocardiography assessments were performed on Day 28. After the rats were anesthetized, their chest hair was shaved, and they were placed in a supine position on an operation board. A Philip CX50 ultrasound device (Philips Ultrasound, Inc.) with a 12.0 MHz linear array transducer was used for M-mode, two-dimensional, and pulsed-wave Doppler measurements. The heart rate (HR) was recorded using a synchronized electrocardiograph during the ultrasonic examination. The right ventricular end diastolic diameter (RVEDD) was calculated to assess RV function. Pulmonary arterial acceleration time (PAAT), pulmonary arterial ejection time (PET) and mean pulmonary artery pressure (mPAP) were used to assess the structural remodeling and function of the pulmonary artery in PAH patients. All parameters were acquired by a blinded echocardiologist who was unaware of the experimental groups.

2.3 Histological examination

The lungs were harvested after hemodynamic measurements. The lung tissue was embedded in a paraffin block, sectioned into 5 µm slices, and stained with hematoxylin and eosin (H&E) and Masson’s trichrome (MT). The pulmonary artery structure was assessed by H&E staining, the degree of pulmonary artery fibrosis was evaluated by MT staining, and the collagen volume fraction (CVF) was calculated using the following formula: CVF % = blue area/total area ×100%.

2.4 ELISA analysis

Rat BNP ELISA kits (Shanghai Enzyme Linked Biotechnology Co., Ltd., China) and ST-2 ELISA kits (Shanghai Enzyme Linked Biotechnology Co., Ltd., China) were used to determine the concentrations of BNP and ST-2 according to the manufacturer’s instructions. Plasma and serum samples were collected, diluted, incubated in microplate-coated plates, washed, microplate labeled, and color rendered sequentially according to the manufacturer’s instructions. A microplate reader was used to determine the absorbance of each well at 450 nm. With these data, we constructed a standard sample concentration-absorbance curve and calculated the FUT8 concentration of the samples according to the absorbance of each well.

2.5 Cell culture and treatment

PASMCs were purchased from Procell Life Science & Technology Co. (Wuhan), and cultured in Dulbecco's modified essential medium (DMEM, HyClone, USA) supplemented with 10% fetal bovine serum (HyClone, USA) and 1% penicillin-streptomycin (HyClone, USA) at 37°C with humidified 95% air and 5% CO2. PASMCs were incubated with platelet-derived growth factor-BB (PDGF-BB, 20 ng/mL, Shanghai Biyuntian Biotechnology Co., Ltd., China) for 24 h to induce PASMC proliferation.

In the experiment, the cells were divided into a control group (con), a PDGF-BB group (PDGF-BB), a con with EMPA group (150 µg/mL, no: HY-15409, MCE, USA), and a PDGF-BB + EMPA group. In the overexpression experiment, the cells were divided into the control group, PDGF-BB + OENC group, PDGF-BB with OESYK (SYK, spleen tyrosine kinase) group (PDGF-BB + OESYK), and PDGF-BB with empagliflozin and OESYK (PDGF-bb + EMPA + OESYK) group. Both plasmids were obtained from Genecreat.cn (China). Before treatment, the cells in each group were cultured in low-glucose medium overnight (12 h) and then placed in fresh glucose medium. All groups of cells were collected for further examination after 24 h of treatment.

2.6 Cell migration analysis

The migration of PASMCs was determined with a wound healing assay and Transwell chambers (24-well, 8-µm pore size, Corning). In the wound healing assay, PASMCs were plated in 6-well plates to 90% confluence. After overnight starvation in serum-free conditions, wounds were created with a 200 µl sterile pipette tip. Then, the PASMCs were exposed to HMGB1, and images were obtained at 0 h and 24 h post-wounding. The areas were randomly selected, and the widths of the wounded areas were measured. In the Transwell assay, PASMCs were seeded in the upper chambers with serum-free medium, and the lower chambers were filled with complete medium with or without HMGB1. After incubation for 24 h, the cells in the upper chambers were removed, and the cells that migrated were stained with 0.3% crystal violet, followed by counting under an inverted microscope.

2.7 Cell proliferation assay

Cell proliferation was evaluated by using a Cell Counting Kit-8 (CCK-8) assay, colony formation assay, and Western blot analysis to determine the expression of the cell proliferation marker proliferating cell nuclear antigen (PCNA). Specifically, PASMCs were seeded in 96-well plates in triplicate and cultured for 24 h. Subsequently, different treatments and interventions were administered to the cells. After the treatments, CCK-8 reagent (10 µL) was added to each well, and the plates were incubated at 37°C for 3 h. The optical density at 450 nm was then measured using a spectrophotometer (BioTek, USA). This experiment was independently repeated three times.

Cells in the logarithmic growth phase of each group were digested with EDTA + 0.25% trypsin, blown into single cells, and suspended in DMEM supplemented with 10% fetal bovine serum. A total of ~ 200 cells were inoculated in a 10 cm cell culture dish containing 10 ml of DMEM + 10% FBS, and the cells were evenly dispersed by gentle rotation. The cells were placed in an incubator at 37°C, 5% CO2 and saturated humidity for 10–14 days. Cell growth was observed over time during culture, and the culture was stopped when macroscopic clones appeared in the culture dish. The supernatant was discarded, and the cells were carefully washed twice with PBS. The cells were fixed with 5 ml of methanol for 15 min at room temperature and then stained with Giemsa solution for 15–30 min at room temperature. Each treatment was run in triplicate, and the colonies were counted with an optical microscope (Olympus Corporation) at 10× magnification.

2.8 Reverse transcription (RT)-PCR amplification and RT‒qPCR

Total RNA was isolated from pulmonary arteries and PASMCs. Briefly, RNA extraction was carried out using the FastPure Cell/-Tissue Total RNA Isolation Kit V2 (Vazyme, Nanjing, China), and cDNA synthesis was performed using the Hifair® III 1st Strand cDNA Synthesis Kit (TransGen Biotech Co., Ltd., China) following the manufacturer’s instructions. The specific rat primers utilized for PCR amplification are listed in Table 1.

RT‒qPCR was conducted with Green qPCR SuperMix (TransGen Biotech Co., Ltd., China) on a LightCycler® 96 System (Roche Diagnostics, Mannheim, Germany). The amplified products were separated on 2% agarose gels with TAE buffer and visualized using 0.5 µg/ml ethidium bromide. The relative gene expression was calculated using the 2^-ΔΔCt method and normalized to that of GAPDH.

Table 1

Primer sequences for PCR
Gene	Primer sequence	Product length
SYK-Rat-F	CTTGGTCACCAGGTGGAATAAT	126
SYK-Rat-R	GCTCATAGGGATTGAAGGACAC
GAPDH-Rat-F	GGTGGACCTCATGGCCTACAT	121
GAPDH-Rat-R	CTCTCTTGCTCTCAGTATCCTTGCT

2.9 Western blotting analysis

As we previously described, 11 proteins were isolated by using RIPA lysis buffer and separated by 10% and 15% SDS‒PAGE. After the proteins were transferred to the PVDF membranes, the membranes were probed with the following antibodies: SM-MHC (1:250, ABclonal Technology Co., Ltd., USA), SM-22α (1:250, ABclonal Technology Co., Ltd., USA), SYK (1:750, ABclonal Technology Co., Ltd., USA), α-SMA (1:1000Affinity Biosciences, Ltd.), OPN (1:1000, ABclonal Technology Co., Ltd., USA), IL-6 (1:1000, ABclonal Technology Co., Ltd., USA), PCNA (1:1000, ABclonal Technology Co., Ltd., USA), cleaved caspase-3 (1:1000, Cell Signaling Technology, MA, USA), Bax (1:1000, Abcam Plc, USA), Bcl-2 (1:1000, PTM BioLab, Inc.), and GADPH (1:10000, ABclonal Technology Co., Ltd., USA). Bioluminescence was detected with Image Lab software (Bio-Rad, CA, USA) and quantified by ImageJ software.

2.10 Statistical analysis

The values are presented as the mean ± standard deviation (SD). Statistical significance among multiple experimental groups was determined using one-way ANOVA followed by Tukey’s post hoc test with GraphPad Prism 9 (GraphPad Software, Inc., San Diego, CA). P < 0.05 was considered to indicate statistical significance.

3.1 Empagliflozin normalizes the cardiac structure and function of MCT-treated rats with PAH and reduces MCT-induced vascular remodeling

Compared with those in the control group, the mPAP, RVEDD, and PAAT/PET values in the MCT group were greater. HE staining revealed thickening of pulmonary artery smooth muscle, disordered cell arrangement, and inflammatory cell infiltration in the MCT-treated rats with PAH. Masson staining revealed an increase in the degree of pulmonary artery fibrosis, thickening and fibrosis of smooth muscle tissue, and an increase in the collagen volume fraction (CVF) of the pulmonary artery in the MCT group. The above results indicate that the MCT-induced PAH rat model was successfully established. After the intraperitoneal injection of MCT, empagliflozin was administered by gavage for 28 days. Cardiac ultrasound revealed that empagliflozin reduced the mPAP and RVEDD and increased the PAAT/PET in the MCT-treated rats with PAH (Fig. 1A、D-F). HE staining revealed that pulmonary artery smooth muscle thickening was reduced, the cell arrangement was orderly, and inflammatory infiltration was reduced (Fig. 1B). Masson staining revealed a reduction in pulmonary artery fibrosis, a decrease in the collagen volume fraction, and a decrease in the occurrence and development of pulmonary arterial hypertension (Fig. 1C、G). We used ELISAs to measure the levels of BNP and ST-2 in the three groups of rats and found that the MCT group had a significant increase in BNP and ST-2, which decreased after treatment with empagliflozin (Fig. 1H、I) .

3.2 Empagliflozin impairs proliferation, migration, apoptosis resistance, and phenotypic conversion in the rat lung

WB analysis of the ratio of Bax/Bcl-2 and cleaved caspase-3 in lung tissue confirmed that empagliflozin promoted the apoptosis of pulmonary artery cells (Fig. 2A-C) .

WB revealed the upregulation of α-SMA, SM-MHC, and SM22α expression and the downregulation of OPN and PCNA expression, confirmed the phenotypic transformation of pulmonary artery cells from a contractile phenotype to a synthetic phenotype (Fig. 2F-L), and detected IL-6 expression, indicating that empagliflozin can alleviate the pulmonary artery inflammatory response (Fig. 2D、E) .

3.3 Empagliflozin impairs the proliferation, migration, apoptosis resistance, and phenotypic conversion of PASMCs

To investigate the protective mechanism of empagliflozin in vitro, we treated PASMCs with PDGF-BB to establish a cell model. First, CCK-8, cell scratch, Transwell migration, and cell colony formation assays were used to evaluate the proliferation of PASMCs (Fig. 3A-D、O). Research has shown that 20 ng/ml PDGF-BB induces significant PASMC proliferation, while the administration of 150 µg/mL empagliflozin significantly inhibited PDGF-BB-induced proliferation(Fig. 3E-G). WB revealed the upregulation of α-SMA, SM-MHC, SM22α and IL-6expression, while the downregulation of OPN and PCNA expression confirmed that empagliflozin inhibited the PASMC phenotypic transformation and inflammatory response induced by PDGF-BB(Fig. 3H-N).

3.4 Regulation of the SYK protein by empagliflozin in vivo and in vitro

Given that empagliflozin may regulate pulmonary artery smooth muscle cells through the SYK protein, we used WB to determine the expression of SYK in vivo and in vitro. SYK protein expression was upregulated in the MCT-treated rats and PASMC models(Fig. 4A-F).

The application of empagliflozin can downregulate the expression of SYK, and the in vivo and in vitro experimental results were consistent, indicating that empagliflozin has an inhibitory effect on SYK. Therefore, overexpression of the SYK protein was successfully detected in PASMCs using qPCR(Fig. 4G).

3.5 Empagliflozin impairs proliferation, migration, apoptosis resistance, and phenotypic conversion in PASMCs overexpressing SYK

PASMCs overexpressing SYK were treated with empagliflozin, and we found that the proliferation of the SYK-overexpressing PASMCs was stronger in the PDGF-BB group than in the PDGF-BB group, while empagliflozin still inhibited the proliferation of SYK-overexpressing PASMCs. We determined the ratio of Bax/Bcl-2 and the expression of cleaved caspase-3 through WB, CCK-8, cell scratch, Transwell migration, and cell cloning assays and found that empagliflozin inhibits the antiapoptotic effect of PASMCs overexpressing SYK(Fig. 5A-G、O). WB revealed the upregulation of α-SMA, SM-MHC, and SM22α expression, while the downregulation of OPN, PCNA, and IL-6 expression confirmed that empagliflozin inhibited phenotypic transformation in the PASMCs overexpressing SYK(Fig. H-N).

We investigated the therapeutic effect of empagliflozin on rats with MCT-induced PAH and proposed hypotheses on and confirmed the effect of empagliflozin on the phenotypic transformation of pulmonary artery smooth muscle cells. Although empagliflozin has been proven to have multiple cardiac protective mechanisms, there is relatively little research on its effect on pulmonary arterial hypertension. Only a few studies have confirmed the association between empagliflozin and the treatment of pulmonary arterial hypertension, and no specific mechanism or target of action has been identified.

The main pathological and physiological changes in pulmonary arterial hypertension are phenotypic transformation of pulmonary arteries, which leads to cell proliferation and migration, especially in pulmonary smooth muscle^[18]. Pulmonary arterial hypertension-targeted drugs that are commonly used in clinical practice cannot to affect the phenotypic transformation of smooth muscle cells. This study confirmed through the indicators of PAAT/PET, mPAP, and RVEDD that after 28 days of treatment with empagliflozin, a therapeutic effect on pulmonary arterial hypertension was observed^[19]. Moreover, HE and Masson staining revealed that the effect on smooth muscle cells was significant, and the same effect was observed in the PASMC model. Moreover, through the detection of indicators such as α-SMA, SM22α, and SM-MHC in the smooth muscle contraction phenotype, as well as the detection of the synthetic phenotypic markers OPN and PCNA, we directly demonstrated that empagliflozin can exert therapeutic effects by inhibiting the phenotypic transition of smooth muscle cells^{[20, 21]}. For the first time, we showed that empagliflozin exerts an inhibitory effect on phenotype transition through SYK. Through WB detection, we found that empagliflozin also has an inhibitory effect on SYK and inhibits the phenotypic transition of PASMCs induced by SYK. Empagliflozin was shown to inhibit the expression of IL-6 in animal and cell models, indicating that empagliflozin also inhibits the inflammatory response of smooth muscle cells, as demonstrated through the detection of IL-6, and has an inhibitory effect on the occurrence and development of PAH.

As the first SGLT-2i to be studied for its therapeutic effect on pulmonary arterial hypertension, empagliflozin has been confirmed to have a therapeutic effect on MCT-induced PAH in rats, but its mechanism of action, especially its direct effect on the phenotypic transition of smooth muscle cells, has not been described^[22]. This study focused on the phenotypic transformation of smooth muscle cells, attempting to elucidate the therapeutic mechanism of empagliflozin and validate it in a cell model. Moreover, we will continue to further explore and search for possible targets of empagliflozin.

SYK is expressed in multiple organs of mice, with the highest expression in the spleen, heart, mammary gland, thymus, and some lymphocyte lines^[23]. SYK is also expressed in nonhematopoietic cells, including epithelial cells and vascular endothelial cells. This molecule plays an important role in various immune-related pathways, including the PI3K-AKT, Ras-ERK, PLC-γ-NFAT, Vav1 Rac, and IKK NF-κB pathways^[24]. Therefore, intervention targeting SYK can affect the cellular processes of related signaling pathways, such as phagocytosis, cytokine production, degranulation, proliferation, B-cell maturation, osteoclastogenesis, and platelet activation. Information on the role of SYK in cardiovascular disease is accumulating. Research shows that SYK is involved in the pathogenesis and progression of hypertrophic cardiomyopathy (HCM), diabetic cardiomyopathy (DCM), coronary heart disease (CHD) and arterial thrombosis^[25], but it is rarely reported in pulmonary hypertension. Previous studies have reported that PDGF-BB can activate SYK and induce smooth muscle cell proliferation and migration in RASMCs. However, only a few reports in PASMCs have shown that SYK inhibitors can inhibit the proliferation and migration of PASMCs induced by PDGF-BB^[26]. This study verified that the SYK protein promotes PASMC proliferation and migration through overexpression of SYK. Moreover, empagliflozin can inhibit this effect, confirming that one of the targets of empagliflozin for treating pulmonary arterial hypertension is SYK.

In summary, this study indicated that empagliflozin has a therapeutic effect on MCT-induced PAH in rats and that this therapeutic effect involves inhibiting the phenotypic transformation of pulmonary artery smooth muscle and inhibiting vascular remodeling. These findings were confirmed in the cell model. In cell models, SYK promoted PDGF-BB-induced phenotypic transition in PASMCs, while empagliflozin inhibited the expression of the SYK protein and ultimately inhibited PDGF-BB-induced phenotypic transition. Based on these results, we believe that empagliflozin can play a crucial role in the treatment of MCT-induced PAH in rats via inhibition of the SYK pathway.

Ethics approval

All procedures involving rats and experimental protocols were approved by the Harbin Medical University Animal Care and Use Committee.

Conflicts of interest

The authors declare that they have no competing interests.

Consent to participate

All authors agreed with the content and that all gave explicit consent to submit

Consent for publication

(include appropriate statements)

Funding

The authors declare that no funds, grants, or other support were received during the preparation of this manuscript.The authors have no relevant financial or non-financial interests to disclose.

Author Contributions

All authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Yuchen Duan,Hong Wang, Guanghui Li,Haoran Jing. The first draft of the manuscript was written by Yuchen Duan and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.

Availability of data and material

Data will be made available on request.

Lechartier B, Berrebeh N, Huertas A, Humbert M, Guignabert C, Tu L. Phenotypic Diversity of Vascular Smooth Muscle Cells in Pulmonary Arterial Hypertension: Implications for Therapy. Chest. 2022;161(1):219–31.
Humbert M, Kovacs G, Hoeper MM, et al. 2022 ESC/ERS Guidelines for the diagnosis and treatment of pulmonary hypertension. Eur Heart J. 2022;43(38):3618–731.
Thenappan T, Ormiston ML, Ryan JJ, Archer SL. Pulmonary arterial hypertension: pathogenesis and clinical management. BMJ. 2018;360:j5492.
Ruopp NF, Cockrill BA. Diagnosis and Treatment of Pulmonary Arterial Hypertension: A Review. JAMA. 2022;327(14):1379–91.
Vaduganathan M, Docherty KF, Claggett BL, et al. SGLT-2 inhibitors in patients with heart failure: a comprehensive meta-analysis of five randomised controlled trials. Lancet. 2022;400(10354):757–67.
Zinman B, Wanner C, Lachin JM, et al. Empagliflozin, Cardiovascular Outcomes, and Mortality in Type 2 Diabetes. N Engl J Med. 2015;373(22):2117–28.
Wiviott SD, Raz I, Bonaca MP, et al. Dapagliflozin and Cardiovascular Outcomes in Type 2 Diabetes. N Engl J Med. 2019;380(4):347–57.
Cherney DZ, Perkins BA, Soleymanlou N, et al. The effect of empagliflozin on arterial stiffness and heart rate variability in subjects with uncomplicated type 1 diabetes mellitus. Cardiovasc Diabetol. 2014;13:28.
Lopaschuk GD, Verma S. Mechanisms of Cardiovascular Benefits of Sodium Glucose Co-Transporter 2 (SGLT2) Inhibitors: A State-of-the-Art Review. JACC Basic Transl Sci. 2020;5(6):632–44.
Zhang W, Li X, Li M, et al. Empagliflozin inhibits neointimal hyperplasia through attenuating endothelial-to-mesenchymal transition via TAK-1/NF-κB pathway. Eur J Pharmacol. 2023;954:175826.
Chowdhury B, Luu AZ, Luu VZ, et al. The SGLT2 inhibitor empagliflozin reduces mortality and prevents progression in experimental pulmonary hypertension. Biochem Biophys Res Commun. 2020;524(1):50–6.
Sukhanov S, Higashi Y, Yoshida T, et al. The SGLT2 inhibitor Empagliflozin attenuates interleukin-17A-induced human aortic smooth muscle cell proliferation and migration by targeting TRAF3IP2/ROS/NLRP3/Caspase-1-dependent IL-1β and IL-18 secretion. Cell Signal. 2021;77:109825.
Mócsai A, Ruland J, Tybulewicz VL. The SYK tyrosine kinase: a crucial player in diverse biological functions. Nat Rev Immunol. 2010;10(6):387–402.
Wang L, Aschenbrenner D, Zeng Z, et al. Gain-of-function variants in SYK cause immune dysregulation and systemic inflammation in humans and mice. Nat Genet. 2021;53(4):500–10.
Gao Z, Cao L, Luo Q, et al. Spleen tyrosine kinase modulates the proliferation and phenotypes of vascular smooth muscle cells induced by platelet-derived growth factor. DNA Cell Biol. 2011;30(3):149–55.
Gao ZX, Cao LL, Luo Q, et al. [Role of spleen tyrosine kinase in phenotypic modulation of vascular smooth muscle cell induced by platelet-derived growth factor-BB]. Zhonghua Er Ke Za Zhi. 2010;48(6):460–4.
Seo HH, Kim SW, Lee CY, et al. A spleen tyrosine kinase inhibitor attenuates the proliferation and migration of vascular smooth muscle cells. Biol Res. 2017;50(1):1.
Jia Z, Wang S, Yan H, et al. Pulmonary Vascular Remodeling in Pulmonary Hypertension. J Pers Med. 2023;13(2):366.
Methia N, Latreche S, Ait Mokhtar O, Monsuez JJ, Benkhedda S. Assessment for Pulmonary Artery Hypertension Using Clinical and Echocardiographic Criteria in Patients With Systemic Sclerosis. Am J Med Sci. 2016;352(4):343–7.
Gallardo-Vara E, Ntokou A, Dave JM, Jovin DG, Saddouk FZ, Greif DM. Vascular pathobiology of pulmonary hypertension. J Heart Lung Transpl. 2023;42(5):544–52.
Chakraborty R, Chatterjee P, Dave JM, et al. Targeting smooth muscle cell phenotypic switching in vascular disease. JVS Vasc Sci. 2021;2:79–94.
Chen X, Yu X, Lian G, et al. Canagliflozin inhibits PASMCs proliferation via regulating SGLT1/AMPK signaling and attenuates artery remodeling in MCT-induced pulmonary arterial hypertension. Biomed Pharmacother. 2024;174:116505.
Li M, Wang P, Zou Y, et al. Spleen tyrosine kinase (SYK) signals are implicated in cardio-cerebrovascular diseases. Heliyon. 2023;9(5):e15625.
Cooper N, Ghanima W, Hill QA, Nicolson PL, Markovtsov V, Kessler C. Recent advances in understanding spleen tyrosine kinase (SYK) in human biology and disease, with a focus on fostamatinib. Platelets. 2023;34(1):2131751.
Liang K, Ma N, Luo S, Niu W, Wang Y, Bu P. The Expression and Clinical Significance of Spleen Tyrosine Kinase in Patients with Coronary Heart Disease. Med Sci Monit. 2019;25:2112–21.
Lee CK, Lee HM, Kim HJ, et al. Syk contributes to PDGF-BB-mediated migration of rat aortic smooth muscle cells via MAPK pathways. Cardiovasc Res. 2007;74(1):159–68.

Download PDF

Editorial decision: Requires Complete Revision
12 Aug, 2024
Reviewers agreed at journal
28 Jul, 2024
Reviewers invited by journal
25 Jul, 2024
Editor assigned by journal
25 Jul, 2024
First submitted to journal
17 Jul, 2024

You are reading this latest preprint version

Empagliflozin inhibits PASMCs Phenotypic transition via downexpressing SYK and attenuates artery remodeling in MCT-induced pulmonary arterial hypertension

Status:

Version 1

Abstract

Figures

Introduction

Materials and methods

Results

Discussion

Declarations

Ethics approval

Consent to participate

Funding

Author Contributions

Availability of data and material

References

Status:

Version 1