Effectiveness of Salivary Sampling for the Detection and Quantification of Aggregatibacter actinomycetemcomitans and its JP2 Genotype in Periodontitis Patients

doi:10.21203/rs.3.rs-4695910/v1

Download PDF

Research Article

Effectiveness of Salivary Sampling for the Detection and Quantification of Aggregatibacter actinomycetemcomitans and its JP2 Genotype in Periodontitis Patients

https://doi.org/10.21203/rs.3.rs-4695910/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Aim

The objective of this study was to evaluate the use of unstimulated saliva in detecting Aggregatibacter actinomycetemcomitans and its JP2 genotype, and to compare the saliva, subgingival and mucosa membrane occurrence of this periopathogen in patients diagnosed with advanced periodontitis.

Materials and Methods

One hundred and fifty-six patients (mean age: 54.03 ± 03 years) with advanced forms of periodontitis (stage-III/IV) were sampled. Unstimulated saliva, buccal cheek mucosa and pooled subgingival plaque samples were collected. Identification of A. actinomycetemcomitans and its JP2 genotype was performed using polymerase chain reaction. A descriptive analysis and chi-square test evaluation were performed.

Results

A. actinomycetemcomitans was isolated from 32% of the subjects. A total of 468 samples were obtained, 156 from unstimulated saliva, buccal cheek mucosa surfaces, and pooled subgingival plaque samples. A. actinomycetemcomitans was isolated from 23.07% of unstimulated saliva samples, 19.87% of buccal cheek swab samples, and 17.30% of subgingival samples. The total 468 samples were negative for the JP2 genotype of A. actinomycetemcomitans in this cohort of patients.

Conclusions

These results suggest that in advanced periodontitis, unstimulated saliva is representative of pooled subgingival plaque/buccal cheek samples and its use is adequate in the oral detection of A. actinomycetemcomitans in a cohort of patients with stage-III and IV periodontitis.

Clinical Relevance:

Data related to the oral colonization of periopthogens can be crucial to the diagnosis, vaccination, maintenance, and treatment of advanced forms of periodontitis. A. actinomycetemcomitans is a key periopathogen implicated in the pathogenesis of periodontitis. In the presence of inflammation, advanced bone loss and deep periodontal pocketing, saliva samples seem to be an effective and conservative alternative to other methods of sampling in detecting the presence of A. actinomycetemcomitans.

A. actinomycetemcomitans

Periodontitis

Plaque

Saliva

Periodontitis is a common multifactorial oral disease in which oral bacteria play an important role in initiation and progression. The oral cavity provides an environment for more than 700 bacterial species, only small part of that known to be periopathogen, can cause inflammation in the tooth supporting apparatus in susceptible individuals [1]. Periodontitis is linked to other chronic inflammatory disorders including, cardiovascular disease, rheumatoid arthritis, and cancer [2, 3]. A. actinomycetemcomitans is a facultative anaerobic, gram-negative, dysbiotic bacterium that reside in the oral cavity, and is a major etiological agent of periodontitis [4]. A. actinomycetemcomitans possess a wide range of molecules responsible for causing host immunity dysregulation. Molecules like leukotoxin (LtxA) and cytolethal distending toxins (CDT) made up the pathogenicity of A. actinomycetemcomitans [5]. Strain JP2 which belong to serotype b of A. actinomycetemcomitans is clinically relevant in the risk of periodontitis [6]. A recent publication revealed that A. actinomycetemcomitans used as intra-nasal vaccine may be effective in preventing the colonization of periodontopathic bacteria in the oral cavity and extra-oral organs [7]. A. actinomycetemcomitans is one of seven-gram negative bacteria that can be used in the diagnosis and monitoring of periodontitis [8]. Gold standard of periodontitis diagnosis is based largely on periodontal examination, patient history, and radiographic imaging [9, 10]. However, these methods are invasive, time consuming, costly, and may risk missing the diagnosis of emerging periodontitis. Therefore, using a saliva sample can help to operate a rapid, molecular-based and non-invasive platform (OralDisk) for detecting periopathogens [11].

As the role of A. actinomycetemcomitans and its JP2 genotype in future vaccines and molecular diagnostics widens, it become very important to evaluate the effectiveness of saliva in the oral detection of this periopathogen. Therefore, the objective of this study was firstly, to evaluate the effectiveness of unstimulated saliva in the oral detection of A. actinomycetemcomitans and its JP2 genotype. Secondly, to compare saliva presence to the subgingival and extra-crevicular occurrence of this periopathogen in patients with advanced form of periodontitis.

2.1 Research Subjects

156 consecutive patients with periodontitis, aged between 26 and 86 years old, were recruited to two private periodontal practices in Perth city, Western Australia between June and November 2022 to take part in the present study. For mor information in regarding the recruitment process please refer to the previous published study [12].

2.2 Clinical Examination

Periodontal, radiographic, and photographic examinations were carried out by one experienced periodontist (NK). In each patient, the examination included measurement and scoring of series of different parameters characterizing periodontitis. For mor information in regarding the recruitment process please refer to the previous publish study [12].

2.3 Case Definition of Periodontitis

Cases with periodontitis were defined according to the 2018 classification of periodontal and peri-implant diseases and conditions [12].

2.4 Samples Collection

Samples of unstimulated saliva, cheek swab and subgingival plaque samples were collected from each subject. Subjects were asked to refrain from eating and drinking one hour prior to saliva collection. About 2 ml of expectorated whole saliva will be collected from each subject (156 samples). In each patient’s subgingival plaque samples were collected. The pooled subgingival plaque samples were collected using sterile universal mini-curette after air drying the area carefully and removing any food debris. The subgingival plaque samples were collected from the most apical portion of the accessible pocket depth. For each patient, subgingival plaque samples were collected from four diseased and four health sites (two samples per quadrant). The total number of samples collected was 1248 subgingival plaque samples, these samples were pooled into 156 samples (one sample per patient). Cheek swabs were collected using sterile plastic applicator. All samples were collected in sterile ice-chilled 5.0 ml Eppendorf tubes (Eppendorf South Pacific Pty, Ltd, Australia). 0.9% sodium chloride was used in the Eppendorf tubes as preservative solution. All collected samples were stored immediately in a subzero (minus 20°C) facility on site. A courier with specialized freezing equipment was used for the transportation of the coded samples, all samples were sent from NK Periodontics practices in Western Australia to the Dental School, Department of Odontology, Umeå University, Sweden for subsequent processing and analysis by an experienced team of researchers.

2.5 Bacterial DNA Isolation

For DNA isolation from the samples, a GXT NA Extraction Kit® (Hain Lifescience, GmBH, Nehren, Germany) and an Arrow automated extraction instrument (Liaison IXT, DiaSorin Ltd., Ireland) were used, using procedures described earlier [13].

2.6 Quantification PCR

The amount of total extracted DNA was quantified using a NanoDrop (Thermo Fisher) instrument. For quantification of A. actinomycetemcomitans loads, suspensions of the reference strain HK1651 were treated as described and used for standard curves, i.e., by being serially diluted [13].

A Corbett Research Rotor-Gene 6000 Rotary Analyze instrument (QIAGEN, Valencia, CA, USA) was used for the quantification of the total concentration of A. actinomycetemcomitans loads in the samples, using qPCR. The cycling conditions used were according to Kirakodu method [14]. The oligonucleotide primers used were Forward: (5’-CTAGGTATTGCGAAACAATTTG-3’), and Reverse (5’-CCTGAAATTAAGCTGGTAATC-3’). A load of 100 A. actinomycetemcomitans cells per ml of sample was set as a positive result regarding presence of this bacterium.

2.7 Conventional PCR

For detection of the JP2 genotype, specific oligonucleotide primers targeting the leukotoxin promoter sequence of A. actinomycetemcomians were used [15]. Primers used for detection of the ltx promoter gene of A. actinomycetemcomitans were forward: (GCCGACACCAAAGACAAAGTCT), and Reverse (GCCCATAACCAAGCCACATAC).

2.8 Statistical Analysis

All data collected was coded and entered into a computer using Microsoft Excel (Microsoft Corporation, 2024, Redmond, WA, USA). The collected data was analysed using IBM SPSS Statistics software program version 29.0 (SPSS Inc., Chicago, IL, USA). The primary outcome was the presence of A. actinomycetemcomitans in saliva versus cheek swabs versus subgingival plaque samples using Wilcoxon test and analysis of variance. A descriptive analysis was performed, evaluating quantitative and qualitative variables, and presented in tables. Furthermore, a chi-square test was carried out to evaluate the relationship between different biodata, periodontal, radiographic and A. actinomycetemcomitans presence/absence. Confidence level was set at 95%. The significance level used was 5%. Sample size was calculated according to previous published paper [16].

2.9 Ethical Considerations

The approval to conduct the current study was given by the Human Ethics, Office of Research at The University of Western Australia (2022/ET000252).

A. actinomycetemcomitans was isolated from 32% (50) of the subjects (156). A total of 468 samples was obtained, 156 from saliva, cheek swabs, and pooled subgingival plaque samples. One hundred and six of the participants did not harbour the A. actinomycetemcomitans in the saliva, cheek swabs, and subgingival plaque area. The number of the positive subjects with A. actinomycetemcomitans saliva, cheek swabs, and subgingival plaque samples were 36 (23.07%), 31 (19.87%), and 27 (17.30%), respectively. There was no statistical significance difference between the presence of A. actinomycetemcomitans in the saliva samples and in the cheek swab samples. However, a significant higher occurrence was revealed in the saliva samples when compared to subgingival plaque samples (P = 0.035). Simple linear regression evaluated the correlation of occurrence of the A. actinomycetemcomitans among saliva, cheek swabs and subgingival plaque samples were statistical Significance among the three difference types of samples (P < 0.001).

Table 1 reveals the simultaneous and isolated detection of the A. actinomycetemcomitans from each patient at all sampled sites. The more frequent combined detection was observed in the saliva and subgingival plaque samples, while isolated detection was more frequent in the cheek swabs. In the whole 468 samples obtained, the JP2 genotype of A. actinomycetemcomitans was absent (Fig. 1).

Table 1

Frequency of *A. actinomycetemcomitans* detection.
Sampled sites		Number of patients
Simultaneous detection	Saliva, cheek swabs and subgingival plaque Saliva and cheek swab Saliva and subgingival plaque Cheek swab and subgingival plaque	16 20 23 17
Isolated detection	Saliva Cheek swab Subgingival plaque	9 10 3

Table 2 shows the A. actinomycetemcomitans-positive patients and their characteristics. The mean DNA concentration of A. actinomycetemcomitans in the saliva samples was 665.91 ng/µL (SD ± 35.88) in A. actinomycetemcomitans-positive patients (n = 36) compared to 0.008 ng/µL (SD ± 0.0708) in the A. actinomycetemcomitans-negative patients (n = 120). The mean DNA concentration of A. actinomycetemcomitans in cheek swabs was 435.59 ng/µL (SD ± 53.42) in A. actinomycetemcomitans-positive patients (n = 31) compared to 141.92 ng/µL (SD ± 22.70) in the A. actinomycetemcomitans-negative patients (n = 125). The mean DNA concentration of A. actinomycetemcomitans in pooled subgingival samples was 106.11 ng/µL (SD ± 20.06) in A. actinomycetemcomitans-positive patients (n = 27) compared to 8.50 ng/µL (SD ± 16.55) in the A. actinomycetemcomitans-negative patients (n = 129).

Table 2

*A. actinomycetemcomitans*-positive patients and their characteristics.
Patient/Variable	Sex	Age/Years	Origin	Aa saliva ng/µL	Aa cheek swabs ng/µL	Aa plaque ng/µL
Pt 1	F	70	Philippines	72,055	-	848,041
Pt 2	F	32	Philippines	-	119	-
Pt 3	M	30	Australia	-	1,956.5	-
Pt 4	M	40	Australia	-	511	-
Pt 5	F	63	Australia	-	219	-
Pt 6	M	48	Australia	19,950.5	2,679	22,379
Pt 7	F	56	England	1,075	161	-
Pt 8	F	48	Australia	606.50	-	10,401
Pt 9	F	40	New Zealand (Māori)	1,470	638.5	1,719
Pt 10	M	49	New Zealand (Māori)	8,530	-	1,680
Pt 11	M	56	Thailand	14,290	165.5	1,448
Pt 12	M	54	New Zealand (Māori)	2,500	-	303
Pt 13	M	35	Australia	3,810	-	-
Pt 14	M	68	Australia	9,820	570.5	365,681
Pt 15	F	51	Australia	5,124	-	-
Pt 16	M	34	Tonga	8,685	2,299.5	851
Pt 17	M	57	Canada	6,865	-	-
Pt 18	F	56	England	-	-	153
Pt 19	F	65	New Zealand (Māori)	13,910	247.5	10,651
Pt 20	M	57	Australia (Aboriginal)	4,115	-	-
Pt 21	M	39	England	2,415	-	577
Pt 22	F	40	Australia	26,620	1,219.5	153
Pt 23	M	57	Australia	2,065	-	-
Pt 24	M	33	Australia	1,710	-	-
Pt 25	M	64	Australia	1,050	-	-
P 26	F	71	Ireland	1,325	-	-
Pt 27	F	62	Kenya	76,820	2,716	381,842
Pt 28	F	36	Australia	2,195	559	4,624
Pt 29	M	40	Australia	-	-	340
Pt 30	M	57	Samoa	1,255	204	56,334
Pt 31	F	47	Palestine	411,735	604.5	46,227
Pt 32	M	40	Australia	54,790	153	184,822
Pt 33	M	75	Italy	-	-	132
Pt 34	M	56	South Africa	1,510	-	479,910
Pt 35	M	52	Sri Lanka	3,360	22,932	5,163
Pt 36	F	40	Philippines	-	105	-
Pt 37	F	52	England	120,725	23,264.5	-
Pt 38	F	60	South Africa	33,910	25,995	254,437
Pt 39	M	76	Ireland	-	105	-
Pt 40	F	69	England	-	133.50	-
Pt 41	M	62	England	-	945.5	-
Pt 42	F	40	Ireland	4,965	43,559	81,934
Pt 43	F	32	Australia	54,440	139.50	-
Pt 44	M	49	England	13,495	-	-
Pt 45	F	49	Greece	46,010	503.5	-
Pt 46	M	68	Australia	-	353	3,598
Pt 47	M	37	England	-	106.5	-
Pt 48	M	33	Australia	4,095	30,455.5	101,611
Pt 49	M	63	Australia	-	114.5	-
Pt 50	M	66	Australia	1,525	-	138.50

There was statistical significance between the absence of A. actinomycetemcomitans in all intra-oral sites and old patients (X² = 4.94, p = 0.026). Another statistical significance was revealed between the presence of A. actinomycetemcomitans and the lack of regular dental appointments (X² = 5.41, p = 0,020). Finally, statistical significance was found between the absence of A. actinomycetemcomitans in married participants (X² = 4.82, p = 0.028).

A. actinomycetemcomitans is a key periopathogen associated with periodontitis in terms of diagnosis, vaccination, and treatment. In the present study the prevalence of this bacterium was observed in 32% in the oral cavity of participants diagnosed with stage-III and IV periodontitis, this was higher than in our earlier study that looked at the subgingival population of A. actinomycetemcomitans only [16]. The prevalence of A. actinomycetemcomitans in our study is still below that in the African and Asian studies, however is still more than the European studies, these results must be interrupted with great caution, as we used samples from three different oral sources compared to other studies that used one or two sources [4, 17–25]. Regarding to the intraoral site of detection of this periopathogen, the saliva had the highest concentration followed with cheek swabs and pooled subgingival plaque samples. Some of the cheek swabs did not have enough bacterium concentration above the detection threshold (29 samples). Despite the large number of subgingival plaque samples (1248 samples) isolated from the 156 patients, only 27 of them was positive (17.30%), this was lower than the cheek swabs (31 subjects – 19.87%). Single, younger (below 40 years old) and patient with irregular dental attendance were more positive to A. actinomycetemcomitans. We could not compare the previous findings to any other studies due to lack of scientific literature in this regard.

The JP2 genotype of A. actinomycetemcomitans was not detected in the present study, this is in agreement with large number of studies in many countries across the globe [18, 26–31]

The absence of JP2 genotype of A. actinomycetemcomitans could be as result of the remoteness/isolation of Perth city in Western Australia. Another reason is the participation of older patients in this study, there is evidence that the JP2 genotype is associated with younger population [6]. However, in one study by Jensen and others, despite including 14 to 15 years old teenagers, the highly leutotx JP2 genotype of A. actinomycetemcomitans was not detected [20].

The result of this cross-sectional study in subjects with advanced periodontitis suggest that saliva is a representative of pooled subgingival plaque and cheek swabs samples, and its use is appropriate in the detection of A. actinomycetemcomitans. However, these results must be considered with caution and further analysis must be carried out.

CONFLICT OF INTEREST STATEMENT

The authors declare no conflicts of interest.

ETHICS STATEMENT

The approval to conduct the current study was given by the Human Ethics, Office of Research at The University of Western Australia (2022/ET000252).

FUNDING INFORMATION

The authors declare no funding information.

Author Contribution

All authors have made substantial contributions to the conception and design of the study. Nabil Khzam, Omar Kujan, Dorte Haubek, and Leticia Algarves Miranda were responsible for the study concept and design. Nabil Khzam, Anders Johansson, Aysen Arslan, Jan Oscarsson, and Zeinab Razooqi have been involved in data collection and data analysis. All authors have been involved in data interpretation, drafting the manuscript, and revising it critically and have given final approval of the version to be published.

DATA AVAILABILITY STATEMENT

The data supporting this study’s findings are available by emailing the corresponding author.

Paster, B.J., et al., The breadth of bacterial diversity in the human periodontal pocket and other oral sites. Periodontol 2000, 2006. 42: p. 80 − 7.
Orlandi, M., F. Graziani, and F. D'Aiuto, Periodontal therapy and cardiovascular risk. Periodontol 2000, 2020. 83(1): p. 107–124.
Nwizu, N., J. Wactawski-Wende, and R.J. Genco, Periodontal disease and cancer: Epidemiologic studies and possible mechanisms. Periodontol 2000, 2020. 83(1): p. 213–233.
Haubek, D., et al., Risk of aggressive periodontitis in adolescent carriers of the JP2 clone of Aggregatibacter (Actinobacillus) actinomycetemcomitans in Morocco: a prospective longitudinal cohort study. Lancet, 2008. 371(9608): p. 237 − 42.
Taieb, F., et al., The Enterobacterial Genotoxins: Cytolethal Distending Toxin and Colibactin. EcoSal Plus, 2016. 7(1).
Khzam, N., et al., Prevalence of the JP2 genotype of Aggregatibacter actinomycetemcomitans in the world population: a systematic review. Clin Oral Investig, 2022. 26(3): p. 2317–2334.
Nakao, R., et al., A bivalent outer membrane vesicle-based intranasal vaccine to prevent infection of periodontopathic bacteria. Vaccine, 2023. 41(30): p. 4369–4383.
Baumgartner, D., et al., OralDisk: A Chair-Side Compatible Molecular Platform Using Whole Saliva for Monitoring Oral Health at the Dental Practice. Biosensors (Basel), 2021. 11(11).
Listgarten, M.A., Periodontal probing: what does it mean? J Clin Periodontol, 1980. 7(3): p. 165 − 76.
Hefti, A.F., Periodontal probing. Crit Rev Oral Biol Med, 1997. 8(3): p. 336 − 56.
Mitsakakis, K., et al., Chair/bedside diagnosis of oral and respiratory tract infections, and identification of antibiotic resistances for personalised monitoring and treatment. Stud Health Technol Inform, 2016. 224: p. 61 − 6.
Khzam, N., et al., Prevalence of Subgingival Aggregatibacter actinomycetemcomitans: Descriptive Cross-Sectional Study. Pathogens, 2024. 13(7): p. 531.
Razooqi, Z., et al., Aggregatibacter actinomycetemcomitans and Filifactor alocis as Associated with Periodontal Attachment Loss in a Cohort of Ghanaian Adolescents. Microorganisms, 2022. 10(12).
Kirakodu, S.S., et al., Optimizing qPCR for the Quantification of Periodontal Pathogens in a Complex Plaque Biofilm. Open Dent J, 2008. 2: p. 49–55.
Poulsen, K., O.K. Ennibi, and D. Haubek, Improved PCR for detection of the highly leukotoxic JP2 clone of Actinobacillus actinomycetemcomitans in subgingival plaque samples. J Clin Microbiol, 2003. 41(10): p. 4829-32.
Nabil Khzam, O.K., Dorte Haubek, Aysen Arslan, Anders Johansson, Jan Oscarsson, Zeinab Ra-zooqi, Leticia Algarves Miranda, Prevalence of Subgingival Aggregatibacter actinomycetem-comitans: Descriptive Cross-Sectional Study. pathogens, 2024. 1.
Höglund Åberg, C., et al., Leukotoxic activity of Aggregatibacter actinomycetemcomitans and periodontal attachment loss. PLoS One, 2014. 9(8): p. e104095.
Elamin, A., et al., Prevalence of Aggregatibacter actinomycetemcomitans in Sudanese patients with aggressive periodontitis: a case-control study. J Periodontal Res, 2011. 46(3): p. 285 − 91.
Macheleidt, A., et al., Absence of an especially toxic clone among isolates of Actinobacillus actinomycetemcomitans recovered from army recruits. Clin Oral Investig, 1999. 3(4): p. 161-7.
Jensen, A.B., et al., Prevalence of Aggregatibacter actinomycetemcomitans and Periodontal Findings among 14 to 15-Year Old Danish Adolescents: A Descriptive Cross-Sectional Study. Pathogens, 2020. 9(12).
Hölttä, P., et al., Isolation frequency and serotype distribution of mutans streptococci and Actinobacillus actinomycetemcomitans, and clinical periodontal status in Finnish and Vietnamese children. Scand J Dent Res, 1994. 102(2): p. 113-9.
Höglund Åberg, C., et al., Progression of attachment loss is strongly associated with presence of the JP2 genotype of Aggregatibacter actinomycetemcomitans: a prospective cohort study of a young adolescent population. J Clin Periodontol, 2014. 41(3): p. 232 − 41.
Eick, S. and W. Pfister, Comparison of microbial cultivation and a commercial PCR based method fordetection of periodontopathogenic species in subgingival plaque samples. Journal of clinical periodontology, 2002. 29(7): p. 638–644.
Paolantonio, M., et al., Prevalence of Actinobacillus actinomycetemcomitans and clinical conditions in children and adolescents from rural and urban areas of central Italy. J Clin Periodontol, 2000. 27(8): p. 549 − 57.
Cortelli, S.C., et al., Detection of Actinobacillus actinomycetemcomitans in unstimulated saliva of patients with chronic periodontitis. J Periodontol, 2005. 76(2): p. 204-9.
Suprith, S., et al., Serotypes of Aggregatibacter actinomycetemcomitans in relation to periodontal status and assessment of leukotoxin in periodontal disease: A clinico-microbiological study. Journal of Indian Society of Periodontology, 2018. 22(3): p. 201–208.
Mínguez, M., et al., Characterization and serotype distribution of Aggregatibacter actinomycetemcomitans isolated from a population of periodontitis patients in Spain. Archives of Oral Biology, 2014. 59(12): p. 1359–1367.
Martinez-Martinez, R.E., et al., Characterization of periodontal biofilm in Down syndrome patients: a comparative study. J Clin Pediatr Dent, 2013. 37(3): p. 289 − 95.
Bandhaya, P., et al., Aggregatibacter actinomycetemcomitans serotypes, the JP2 clone and cytolethal distending toxin genes in a Thai population. J Clin Periodontol, 2012. 39(6): p. 519 − 25.
Sakellari, D., et al., Prevalence and distribution of Aggregatibacter actinomycetemcomitans serotypes and the JP2 clone in a Greek population. Journal of Clinical Periodontology, 2011. 38(2): p. 108–114.
Vieira, E.M., et al., Occurrence of Aggregatibacter actinomycetemcomitans in Brazilian Indians from Umutina Reservation, Mato Grosso, Brazil. J Appl Oral Sci, 2009. 17(5): p. 440-5.

No competing interests reported.

Download PDF

Editor assigned by journal
08 Jul, 2024
Submission checks completed at journal
08 Jul, 2024
First submitted to journal
06 Jul, 2024

You are reading this latest preprint version

Effectiveness of Salivary Sampling for the Detection and Quantification of Aggregatibacter actinomycetemcomitans and its JP2 Genotype in Periodontitis Patients

Status:

Version 1

Abstract

Aim

Materials and Methods

Results

Conclusions

Clinical Relevance:

Figures

1. INTRODUCTION

2. METHODS

2.1 Research Subjects

2.2 Clinical Examination

2.3 Case Definition of Periodontitis

2.4 Samples Collection

2.5 Bacterial DNA Isolation

2.6 Quantification PCR

2.7 Conventional PCR

2.8 Statistical Analysis

2.9 Ethical Considerations

3. RESULTS

4. DISCUSSION

5. CONCLUSIONS

Declarations

CONFLICT OF INTEREST STATEMENT

ETHICS STATEMENT

FUNDING INFORMATION

Author Contribution

DATA AVAILABILITY STATEMENT

References

Additional Declarations

Status:

Version 1