Unveiling Clonostachys rosea bioactives: Investigating antifungal potential against Fusarium oxysporum through in vitro and in silico studies

doi:10.21203/rs.3.rs-4702114/v1

Download PDF

Research Article

Unveiling Clonostachys rosea bioactives: Investigating antifungal potential against Fusarium oxysporum through in vitro and in silico studies

https://doi.org/10.21203/rs.3.rs-4702114/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Fusarium spp. pose significant threats to agriculture by causing wilt in various crops like ridge gourd. This study identifies Fusarium isolates from wilted ridge gourd plants and evaluates Clonostachys rosea's biocontrol potential. Twelve isolates were characterized using molecular and morphological analyses, revealing nine Fusarium oxysporum, two Fusarium brachygibbosum, and one Fusarium equiseti. Pathogenicity tests confirmed that F. oxysporum isolates were highly virulent, while other two species were weakly pathogenic. Antagonistic assays demonstrated that C. rosea significantly inhibited the growth of Fusarium spp. up to 71.59%. Microscopic analysis revealed its mycoparasitic activity, involving hyphal encirclement and degradation of Fusarium hyphae. Metabolite profiling through GC-MS characterized 44 bioactive compounds, including fatty acids, alcohols, amines, thiols, triazoles, and hydrazines. Molecular docking analysis revealed high binding affinities of these metabolites with key fungal proteins, suggesting potential mechanisms of antifungal action. C. rosea demonstrates potential as a biocontrol agent, with its antifungal metabolites providing new insights and strategies for managing Fusarium wilt in ridge gourd.

Clonostachys rosea

Fusarium spp.

antifungal activity

bioactive metabolites

molecular docking

Fungal pathogens present a formidable challenge to global agriculture, causing substantial economic losses and jeopardizing food security through reducing crop yields. Fusarium spp., is notorious for its broad host range and ability to induce wilt diseases, manifests through symptoms such as leaf yellowing, wilting, and vascular discoloration, ultimately leading to plant mortality (Summerell, 2019). Its adaptability and genetic variability enable it to infect various crops, including cucurbit plant (Geiser et al., 2013).

Luffa species, origination from Asia and cultivated extensively in tropical and subtropical regions, are valued for their nutritional richness, including vitamins, minerals, antioxidants, and bioactive phenolic compounds, making them crucial for dietary diversity and nutritional security (Manikandaselvi et al., 2016). However, Fusarium wilt significantly impairs luffa production, particularly in warmer seasons, posing significant challenges to agricultural sustainability. Managing Fusarium wilt is complex due to the pathogen's resilience in soil and its tendency to develop resistance against chemical fungicides. While various strategies, including chemical, physical, and biological methods, have been explored (Martyn, 2014), chemical control proves costly and environmentally harmful, with potential adverse effects on human health (Lopez Aranda et al., 2016). Despite the promise shown by several microbial agents, like Bacillus, Pseudomonas, Trichoderma, and Penicillium for Fusarium wilt control, they often fall short of providing sufficient efficacy under field conditions (Raza et al., 2017); emphasizing the pressing need for sustainable alternatives in combating this destructive plant disease.

In pursuit of eco-friendly solutions, microbial biocontrol agents have emerged as promising alternatives. Clonostachys rosea, renowned for its diverse biocontrol mechanisms, has captured significant attention. These mechanisms encompass competition, parasitism, antibiosis, and the induction of systemic resistance in plants (Jensen, 2022). It exhibits versatility, activity as a mycoparasite (Barnett and Lilly, 1962), entomopathogen (Toledo et al., 2006), and as nematophage (Iqbal et al., 2018; Shravani et al., 2024). Significantly, it produces novel biomolecules with antifungal properties (Sun et al., 2020), offering natural alternatives to synthetic fungicides and addressing challenges such as fungicide resistance and environmental pollution. Understanding the mechanisms underlying the antifungal activity C. rosea and elucidating the structure and function of these biomolecules are critical steps in harnessing their full potential for sustainable disease management in agriculture.

This study aims to contribute to this understanding through morpho-molecular characterization of Fusarium species affecting ridge gourd and exploring C. rosea's antifungal metabolites. Molecular docking analysis will further illuminate how these metabolites interact with Fusarium proteins, providing insights into potential applications for sustainable fungal disease management in agriculture.

2.1. Fungal strain and culture maintainance:

The C. rosea strain TNAU CrN01 (GenBank accession MT605141) used in this study was sourced from the Department of Nematology, TNAU, Coimbatore. The morphological traits were observed and confirmed through molecular identification using Cetyltrimethylammonium bromide (CTAB) method (Fig S1 and S2). The cultures were maintained on potato dextrose agar (PDA) medium at a temperature of 25 ± 2°C, with regular sub-culturing to ensure consistency.

2.2. Pathogen isolation and characterization:

Twelve Fusarium isolates were obtained from wilt-infested ridge gourd plants collected from various locations in Coimbatore, Tamil Nadu (Table 1) and identified based on morphological criteria described by Leslie and Summerell (2008) and Summerell et al. (2003). Pure cultures were obtained through subculturing using the hyphal tip culture method and stored on PDA slants at 4°C and at −20°C for future use. To determine the growth rate of each fungal isolate, the radial growth of mycelium was measured every two days till one week post-inoculation. This was achieved by recording the diameter along two perpendicular lines traced on the underside of the Petri dishes. Genomic DNA extraction followed the CTAB method outlined by Mostafa (2022). Subsequently, PCR amplification was conducted using ITS-1 (5’ TCCGTAGGTGAACCTGCCG 3’) and ITS-4 (5’ TCCTCCGCTTATTGATATGC 3’) primers, and the resulting amplicons were sequenced at Eurofins Labs Ltd., Bangalore, India. Sequence data were analyzed using NCBI BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi) for species identification and deposited in NCBI GenBank. To elucidate the phylogenetic relationships among the fungal isolates, a neighbor-joining phylogenetic tree was constructed using MEGA11 software., a phylogenetic tree was constructed using the neighbor-joining method in MEGA11 software.

2.3. Pathogenicity test:

Pathogenicity tests involved root-prune-inoculating ridge gourd seedlings with Fusarium spore suspensions, following the methodology described by Bindal et al. (2023). Each Fusarium isolate was used to inoculate 12 seedlings of susceptible ridge gourd cultivars arranged in four replications using a randomized complete block design (RCBD). Plants were assessed visually for disease symptoms at 7, 14, and 21 days post-inoculation using a 0-5 disease severity rating (DSR) scale: 0 = no symptoms; 1 = slight wilting and dehydration on the first true leaf; 2 = wilting with two or three leaves yellowing or drying; 3 = stunted growth, significant leaf yellowing, slight vine decay; 4 = severe vine decay and browning; 5 = entire plant brown/dead with no green leaves. To confirm Koch’s postulates, the inoculated fungi were re-isolated from infected plants.

2.4. Evaluation of antagonistic activity of C. rosea against Fusarium:

a. Dual confrontation assay:

The antagonistic efficacy of C. rosea against the pathogen was assessed using dual culture method as adapted from Yassin et al. (2021). Petri dishes filled with PDA were inoculated with 5 mm mycelia discs of Fusarium, positioned 1 cm away from the edge. Similarly, discs of C. rosea were placed 1 cm away on the opposite side of the same Petri plate under aseptic conditions. The plates were then incubated at 26 ± 0.5°C for 5 days, with the experiment replicated four times for accuracy and reproducibility. Percent growth inhibition (PI) was calculated using the formula PI = (A − B)/A × 100, where ‘A’ represents the mycelial growth of the pathogen in the control plate, ‘B’ denotes the mycelial growth of the pathogen in the treatment plate, and ‘PI’ indicates the percentage inhibition of mycelial growth by C. rosea.

b. Antifungal potency of the culture filtrates

Initially, mycelial plugs (5 mm diameter) of C. rosea were cultured in PDB for 7 days on a rotary shaker at room temperature. Following incubation, culture filtrates were collected by filtration through a 0.2 μm pore size filter. Petri dishes containing Potato Dextrose Agar (PDA) were inoculated with 500 μl of the filtrates and allowed to air dry under a laminar flow hood. Each Fusarium species was then inoculated onto both treated and control plates without filtrate, with four replicates per combination. Plates were subsequently incubated under suitable conditions, and the inhibitory effects of C. rosea culture filtrates on Fusarium growth were assessed through visual observation and measurement of fungal growth inhibition. for each combination of Fusarium and C. rosea culture filtrate to evaluate the inhibitory effects (Olowe et al., 2022).

c. Secondary metabolite extraction and testing of antifungal biomolecules against Fusarium spp.:

Culture filtrate of C. rosea from PDB was used to extract metabolites following Rabha et al. (2015). The crude extract was dissolved in methanol (1 mg/mL) and stored at 4°C. Antimicrobial activity against Fusarium spp. was evaluated using the well diffusion method. Wells (5 mm diameter) were created on PDA plates, filled with 50 µl of the extract, while methanol served as a control. Fusarium mycelial discs were centrally inoculated on each plate and incubated at 28 ± 2°C for seven days. Percent inhibition of fungal growth was calculated based on observed changes in mycelial growth over the incubation period (Jeeva and Krishnamoorthy, 2018). Each experiment was performed in quadruplicate to ensure robustness of the findings.

2.5. Mycoparasitic relationships of C. rosea against Fusarium sp.:

The mycoparasitic activity of C. rosea against F. oxysporum was assessed using the slide culture method. Both organisms were inoculated 1 cm apart on microscopic slides coated with a thin layer of Potato Dextrose Agar (PDA), and incubated at 28°C for 3–5 days. Following incubation, slides were examined under a light microscope to observe mycoparasitic interactions, including coil formation, penetration structures, and hyphal wall disintegration, indicating the interaction between C. rosea and Fusarium spp. (Naglot et al., 2015).

2.6. Metabolic characterization of C. rosea biomolecules and in silico molecular docking:

The compounds underwent analysis using Gas Chromatography and Mass Spectrometry (GC-MS) Metabolites detected were compared against NIST 14 standards, and compounds showing a mass spectral similarity greater than 90% were identified as potential active compounds (Kaur et al., 2020). These biomolecules were subjected to molecular docking against six essential proteins crucial for F. oxysporum virulence: succinate dehydrogenase, eubricol 14-alpha-demethylase, beta-tubulin, E3 ubiquitin-protein ligase, DASH complex subunit, and acetolactate synthase. Molecular docking analysis was performed using the software, BIOVIA Discovery Studio Visualizer (DS4.5, Accelrys, Inc., San Diego, CA, USA, 2008) to explore interactions between the ligand structures of C. rosea compounds and the target proteins of Fusarium spp., aiming to identify potential inhibitory effects of these compounds on the pathogen. Protein sequences were sourced from UNIPROT (https://www.uniprot.org/) and assessed for homology based on criteria such as >60% query coverage and percent identity. Sequences meeting these criteria underwent comparative modeling. Sequences with <30% query coverage or lacking a suitable template structure underwent ab-initio modeling. Table S9 furnishes comprehensive details regarding the function and BLASTP queries conducted for each selected protein target. Protein modeling was performed using SWISS-MODEL server(https://swissmodel.expasy.org/) and I-TASSER server (https://zhanglab.ccmb.med.umich.edu/I-TASSER/) , ensuring quality assessment with parameters such as GMQE score for SWISS-MODEL and C-score for I-TASSER. Structural validation was conducted using Ramachandran plots on the Structural Analysis and Verification Server (SAVES, Meta server) to confirm residues within favored regions (>90%)(Table S10; Fig S3 and S4). Ligands were sourced in two-dimensional structure (SDF format) from PubChem. Docking studies utilized the CDock module to determine maximum binding affinity indicated by negative "C docker energy (kcal/mole)". Docked conformations were visualized using Biovia Discovery Studio Client version 2022 for detailed analysis.

2.7. Statistical analysis:

Qualitative data including observations on aerial mycelium, colony color, reverse color, and marginal shapes were documented. Quantitative measurements such as radial growth, growth rate, and percent inhibition (PI) were conducted using metric units. Statistical analysis was performed using SPSS version 26.0 (Statistical Package for the Social Sciences), employing analysis of variance (ANOVA). Mean separations were determined using Duncan’s Multiple Range Test, with significance level at p ≤ 0.05.

In this study, twelve isolates retrieved from wilted ridge gourd plants were meticulously characterized and assigned to three species using both molecular data and microscopy: F. oxysporum (nine isolates), F. brachygibbosum (two isolates), and F. equiseti (one isolate) (Table 1; Fig 1).Each species exhibited distinct morphological traits, particularly in terms of colony pigmentation, growth rate, and aerial mycelium thickness. Cultures on PDA typically achieved diameters of up to 90 mm within 7 to 12 days at 28°C in darkness, although growth rates varied among isolates. Notably, F. oxysporum isolates (F11 and F12) displayed the highest growth rates at 2.58 cm/day and 2.31 cm/day, respectively, while other isolates exhibited average growth rates ranging from 1.40 cm/day to 1.90 cm/day. F. brachygibbosum isolates (F1 and F6) demonstrated growth rates between 1.86 cm/day and 0.95 cm/day. Similarly, F. equiseti isolate F2 exhibited a growth rate of 2.08 cm/day, comparable to F. oxysporum isolates. The isolates showed a diverse colony colors, ranging from violet to pale white and varied mycelial growth patterns. Hyphae were 2.1–4.97 µm in width, hyaline and septate. Sporulation occurred within a few days after transferring colonies to fresh plates, yielding three types of vegetative spores: microconidia, macroconidia, and chlamydospores, with varying proportions among species (Fig S5). Microconidia, typically lacking septa, varied in shape from oval to kidney-shaped, while macroconidia, characterized by their falcate shape, generally possessed three or five septa. Chlamydospores, formed within or on older mycelium, featured one or two round cells with thick walls for protection against degradation and antagonists. Conidiophores, also hyaline and occasionally branched, bore abundant microconidia. Microscopic analysis confirmed the classification of all cultures within the genus Fusarium (Table 2). Amplification of the ITS1 and ITS4 regions, including the 5.8S rDNA gene, produced bands approximately 550 bp in size (Fig 2a). ITS sequencing and genealogical concordance confirmed species identities, with sequence similarities to GenBank entries ranging from 90-100%. These sequences were deposited in NCBI GenBank. Phylogenetic analysis highlighted species diversity but did not correlate with virulence, emphasizing morphological characteristics among descendant taxa (Fig 2b).

Pathogenicity assessments showed that F. oxysporum isolates were highly pathogenic. Symptoms initially appeared as yellowing of outer leaves, progressing to browning, wilting, and eventual plant death, with visible vascular discoloration upon root examination. Isolates of F. brachygibbosum and F. equiseti caused leaf discoloration and necrosis, followed by brown stem rot, but demonstrated weaker pathogenicity (Fig S6). Symptoms from these isolates became evident around the 15th day post-inoculation. The fungi re-isolated from diseased plants consistently matched the original inoculated strains, fulfilling Koch's postulates, which were not observed in non-virulent isolates (Fig 3a & 3b).

Antagonistic experiments confirmed the potent inhibition of Fusarium strains by the C. rosea isolate. Significant (p < 0.05) percentage inhibitions were observed in dual culture, culture filtrate, and secondary metabolites assays against Fusarium spp. (F. oxysporum, F. equiseti, and F. brachygibbosum), with the highest inhibition recorded against F. oxysporum (71.59%, 53.82%, and 56.09% respectively). Growth of F. equiseti and F. brachygibbosum was also significantly inhibited, with inhibition rates ranging from 31% to 56% (Fig 4a & 4b). C. rosea displayed parasitic behavior towards F. oxysporum, involving encircling, shrinking, and eventual degradation of the pathogen hyphae (Fig 5). Subsequent GC-MS analysis of antifungal biomolecules identified 44 metabolites, among which 24 showed high retention times and substantial area percentages. These metabolites span diverse chemical classes viz., fatty acids, alcohols, amines, thiols, triazoles, and hydrazines. Noteworthy compounds identified include 2-Nonadecanone 2,4-dinitrophenylhydrazine, cis-10-Heptadecenoic acid, cis-9-Hexadecenoic acid, 1-Propanol, 2-amino-2-methyl, 2-Nonanol, 11-Tetradecyn-1-ol, cis-13-Eicosenoic acid, 4-Trifluoroacetoxytetradecane, 1-Dodecanol, 1-Hexadecanol, cis-Vaccenic acid, and tert-Hexadecanethiol (Table 3; Fig S7 & S8).

Molecular docking analysis revealed significant binding affinities of these metabolites with various protein targets. Specifically, cis-13-Eicosenoic acid showed the highest binding affinity with Succinate dehydrogenase (-68.6523 kcal/mol) and Eubricol 14-alpha-demethylase (-39.9809 kcal/mol). 2-Nonadecanone 2,4-dinitrophenylhydrazine exhibited strong interactions with Eubricol 14-alpha-demethylase (-43.2458 kcal/mol) and B-tubulin (-35.4395 kcal/mol). Additionally, 4-Trifluoroacetoxytetradecane bound effectively with E3 Ubiquitin ligase (-33.1485 kcal/mol), 1-Propanol, 2-amino-2-methyl with E3 Ubiquitin ligase (-30.1295 kcal/mol) and DASH complex (-29.7839 kcal/mol), and 2-Nonanol with acetolactate synthase (-28.1071 kcal/mol). Carbendazim, a widely used fungicide, was used as a reference compound to assess binding affinity alongside other compounds. It exhibited interactions with various protein targets, although these interactions generally showed less binding affinities (Table 4; Fig 6). The docked complexes revealed a range of interactions, including hydrogen bonds with backbone and side chain residues, hydrophobic interactions, van der waals forces, pi-pi stacking, alkyl interactions, pi-alkyl interactions, pi-cation interactions, attractive charge interactions, salt bridges, pi-pi stacked interactions, and pi-lone pair interactions. These results indicate a complex interaction between the identified biomolecules and fungal proteins crucial for metabolic pathways. Comparisons with carbendazim underscore the unique characteristics and potential pharmacological relevance of these natural compounds. Further research on the specific mechanisms and efficacy of these metabolites could lead to the development of novel biocontrol strategies against fungal pathogens in agriculture.

C. rosea, a filamentous fungus recognized for its biocontrol potential, employs diverse mechanisms to combat F. oxysporum. It competes with the pathogen for nutrients and space, thereby impeding its colonization in plant roots (Lopez-Diaz et al., 2017). Additionally, C. rosea produces a range of secondary metabolites such as gliotoxin and clonorosein, along with volatile organic compounds like 6-pentyl-α-pyrone, which exhibit potent antifungal properties by disrupting fungal cell membranes and inducing oxidative stress (Wu et al., 2018). These metabolites not only directly inhibit F. oxysporum's growth and spore germination but also induce systemic resistance in plants, enhancing their defense responses against fungal infections (Hansson et al., 2012). Such multifaceted mechanisms highlight C. rosea's potential as a sustainable alternative to chemical fungicides in agriculture. In response to the escalating threat of drug-resistant fungal pathogens, our study focused on exploring the antagonistic potential of C. rosea against F. oxysporum through metabolite analysis, complemented by molecular docking analysis to elucidate its mechanisms in disease prevention.

Through morphological and DNA analysis via ITS sequencing, we identified F. oxysporum,F. equiseti, and F. brachygibbosum in ridge gourd plants, confirming their pathogenicity. All tested isolates exhibited typical morphological features of pathogenic Fusarium species (Edel-Hermann and LeComte, 2019). Pathogenicity tests specifically highlighted formae speciales of F. oxysporum as the primary agents responsible for wilt in luffa plants, whereas, other two species were only occasional or minor threats. These results underscore the variable pathogenic potentials of different Fusarium species affecting luffa, emphasizing the necessity for targeted approaches in disease management. These findings align with previous research documenting the diverse pathogenic behaviors of Fusarium species across cucurbit plants (Chehri et al., 2011; Renteria-Martinez et al., 2015; Asma et al., 2018; Bindal et al., 2023). Our findings illustrate that C. rosea effectively inhibits Fusarium spp., achieving inhibition rates ranging from 31.87% to 71.59%, depending on the specific methods employed. Previous studies have also highlighted the antagonistic capabilities of Clonostachys species against Fusarium spp. For instance, strains like UDC-222 and C. rosea have shown inhibition of up to 23% against F. circinatum and 65% against F. oxysporum hyphae in vitro (Moraga-suazo et al., 2011; Mahmoud, 2016). Other strains of Clonostachys have demonstrated significant inhibition against various Fusarium pathogens, indicating their broad potential for biocontrol (Bahadoor et al., 2023; Belingheri et al., 2024).

Microscopic examination in our study confirmed the mycoparasitic behavior of C. rosea against Fusarium mycelia, involving coiling around and penetrating their cell walls. This dual action suggests a combination of mechanical and enzymatic activities leading to the disintegration of pathogen mycelia, demonstrating effective hyphal parasitism. Consistent with previous research, C. rosea has been recognized for its mycoparasitic capabilities in combating Fusarium species (Chtterton and Punja, 2009; Tian et al., 2014; Karlsson et al., 2015). The gene expression studies further emphasize the crucial role of secondary metabolites in facilitating these mycoparasitic interactions (Nygren et al., 2018). Consequently, we identified secondary metabolites responsible for the antifungal activity, highlighting the multifaceted mechanisms employed by C. rosea in combatting fungal pathogens.

The metabolite analysis aimed to elucidate the biochemical pathways and interactions underlying C. rosea's antagonistic activity against F. oxysporum. From C. rosea, 44 biomolecules were identified, with 24 showing high retention area and peak area percentage. These metabolites span diverse chemical classes, including fatty acids, alcohols, amines, thiols, triazoles, indoline, steroids, and hydrazines, known for their wide-ranging bioactive properties such as antimicrobial, insecticidal, antioxidant, antifungal, and anti-inflammatory effects. Key compounds, such as cis-vaccenic acid, cis-9-hexadecenoic acid, and eicosapentaenoic acid (fatty acids); 1-dodecanol, 2-nonanol, and 1-hexadecanol (alcohols); 2-nonadecanone 2,4-dinitrophenylhydrazine (hydrazines); tert-hexadecanthiol (amines), exhibit potent antimicrobial and antifungal activities against Fusarium species (Jeeva and Krishnamoorthy, 2018; Khan et al., 2018; Ponnuswamy et al., 2018; Zhao et al., 2019; Sama et al., 2021; Oviya et al., 2022). Moreover, cis-vaccenic acid and 9,12-octadecadienoic acid have been found to exhibit antimicrobial properties against various pathogens (Hamlal and Subban, 2012). Notably, Compounds with 1,2,4-triazole and tertiary amine moieties have demonstrated antifungal activity against various pathogens (Sui et al., 2017). Amines and their derivatives disrupt fungal hyphae, reduce mycelial growth, and restrict spore germination and germ tube elongation, thereby effectively combating phytopathogenic fungi (Hueck et al., 1966). Recent studies have also highlighted the antimicrobial activity of volatile amine derivatives against key fungal pathogens (Chobe et al., 2014). Indole compounds play a crucial role in plant defense and act as antifungal agents against necrotrophic pathogens sucha s Fusarium spp. (Shen et al., 2018; Angarita-Rodriguez et al., 2019). Collectively, these bioactive compounds from various classes likely contribute to inhibiting the growth of F. oxysporum. Our metabolite profiling of C. rosea extracts provides insights into their antifungal effects, setting the stage for further investigations into their specific roles and mechanisms. This research holds promise for developing innovative strategies to combat fungal drug resistance effectively.

Computational modeling, particularly molecular docking approaches, offers valuable insights into the mechanisms of antifungal molecules that hinder fungal infection processes. By predicting the binding of molecules to protein active sites critical for fungal infection, these methods aid in identifying potential antifungal agents and comprehending their modes of action at a molecular level. This approach enables researchers to screen and prioritize compounds based on their ability to interact with specific fungal proteins involved in virulence and pathogenicity, thereby facilitating the development of targeted antifungal therapies (Toubi et al., 2019). In this study, molecular docking was employed to assess the binding interactions between active molecules derived from C. rosea extracts with six key proteins of F. oxysporum. The results highlighted that compounds such as 1-hexadecanol, 4-trifluoroacetoxytetradecane,2-nonadecanone, 2,4-dinitrophenylhydrazine, cis-13-eicosenoic acid, cis-vaccenic acid, and 2-nonanol bound with these F. oxysporum proteins, which play pivotal roles in various cellular processes controlling fungal virulence. Studies have underscored the significance of specific pathogenicity proteins like Succinate dehydrogenase, eubricol 14-alpha-demethylase, b-tubulin, E3 ubiquitin-protein ligase, DASH complex subunit, and acetolactate synthase in fungal pathogenesis and their potential as targets for disease control (Kersher et al., 2006; Chatterji et al., 2011; Fan et al., 2013; Zhang et al., 2019; Shao et al., 2022; Song et al., 2021). These findings are consistent with previous research utilizing molecular docking to elucidate the antifungal mechanisms of various compounds against fungal proteins (Rampersad et al., 2020). Recent studies have also highlighted the role of hydrogen bonds and hydrophobic interactions in the interaction of diacylhydrazine compounds with Succinate dehydrogenase, suggesting phenol and diacylhydrazine moieties as potential pharmacophores for bioactivity (Zhao et al., 2021).

Our findings contribute to the understanding of the multifaceted mechanisms employed by C. rosea in combating fungal pathogens, paving the way for innovative approaches to overcoming fungal drug resistance. Future research should focus on the specific roles and mechanisms of these bioactive compounds and validate them through in vitro and in vivo studies, as well as RT-PCR techniques. This comprehensive approach could potentially lead to the development of new antifungal agents and sustainable disease management strategies in agriculture.

This research underscores C. rosea's efficacy as a potent biocontrol agent against F. oxysporum, utilizing mycoparasitism and diverse bioactive metabolites. The characterization and pathogenicity tests of Fusarium isolates highlight the significant threat posed to ridge gourd plants by F. oxysporum. Identification of key antifungal metabolites, with strong binding affinities to essential fungal proteins, positions C. rosea as a promising natural alternative to chemical fungicides. This approach not only promotes sustainable agricultural practices but also addresses challenges linked to drug-resistant fungal pathogens. Overcoming implementation challenges and enhancing farmer adoption will be pivotal in realizing C. rosea's full potential in sustainable agriculture, ultimately boosting crop yields and resilience against diseases.

PDA

Potato Dextrose Agar

PDB

Potato Dextrose Broth

DNA

Deoxyribonucleic acid

CTAB

Cetyltrimethylammonium bromide

PCR

Polymerase chain reaction

NCBI

National Center for Biotechnology Information

BLAST

Basic Local Alignment Search Tool

ITS

Internal transcribed spacer

GC-MS

Gas Chromatography and Mass Spectrometry

NIST

National Institute of Standards and Technology

GMQE

Global Mean Quality Estimation

I-TASSER

Iterative Threading ASSEmbly Refinement

UniProt

Universal Protein Resource

C-score

Confidence score

Ethics approval and consent to participate:

Not applicable

Consent for publication:

Not applicable

Availability of data and materials:

All data and materials generated for the current study are available in the manuscript and its supplementary information files, and the corresponding author has no objection to the availability of data and materials

Competing interests:

The authors declare that they have no competing interests.

Funding:

The authors did not receive support from any organization for the submitted work.

Author Contributions:

NS, JI and GJ conceptualized the research; JI, AS and KE helped in GC MS sample preparation and analysis; VS performed in vitro study and molecular docking experiments and illustrated the docking files. VS, NS and GJ drafted the manuscript. The authors read and approved the final manuscript.

Acknowledgements:

The authors wish to thank Department of Nematology and Department of Plant pathology, Centre for Plant protection studies, Tamil Nadu Agricultural University, Coimbatore, India for providing laboratory facilities for identification of biocontrol fungi and Fusarium isolates. The authors acknowledge Department of Plant Molecular Biology and Bioinformatics and Department of Biotechnology, Centre for Plant Molecular Biology and Biotechnology, Tamil Nadu Agricultural University, Coimbatore, India for providing facilities for GC-MS analysis and molecular docking analysis.

Angarita-Rodríguez, A., Quiroga, D., & Coy-Barrera, E. (2019). Indole-containing phytoalexin-based bioisosteres as antifungals: In vitro and in silico evaluation against Fusarium oxysporum. Molecules, 25 (1), 45. https://doi.org/10.3390/molecules25010045
Asma, A., Shamarina, S., Baity, S.N., & Izzati, M.N.A. (2018). Characterisation and pathogenicity of Fusarium species isolated from luffa (Luffa acutangula L. Roxb.). Malaysian Applied Biology, 47 (5), 63-69.
Bahadoor, A., Robinson, K. A., Loewen, M. C., & Demissie, Z. A. (2023). Clonostachys rosea ‘omics profiling: identification of putative metabolite-gene associations mediating its in vitro antagonism against Fusarium graminearum. BMC genomics, 24(1), 352. https://doi.org/10.1186/s12864-023-09463-6
Barnett, H. L., & Lilly, V. G. (1962). A destructive mycoparasite, Gliocladium roseum. Mycologia, 54(1), 72-77.https://doi.org/10.1080/00275514.1962.12024980
Belingheri, L. M. E., Medel-Ortiz, R., Salinas-Castro, A., & Trejo, A. D. (2024). In vitro antagonism of Clonostachys sp. against disease associated fungi in economically important crops. Mexican Journal of Phytopathology, 42(3), 23. https://doi.org/10.18781/R. MEX.FIT.2401-1
Bindal, S., Sheu, Z. M., Kenyon, L., Taher, D., & Rakha, M. (2023). Novel sources of resistance to fusarium wilt in Luffa species. Frontiers in Plant Science, 14, 1116006.https://doi.org/10.3389/fpls.2023.1116006
Chatterji, B. P., Jindal, B., Srivastava, S., & Panda, D. (2011). Microtubules as antifungal and antiparasitic drug targets. Expert opinion on therapeutic patents, 21(2), 167-186 .https://doi.org/10.1517/13543776.2011.545349
Chatterton, S., & Punja, Z. K. (2009). Chitinase and β-1, 3-glucanase enzyme production by the mycoparasite Clonostachys rosea f. catenulata against fungal plant pathogens. Canadian journal of microbiology, 55(4), 356-367. https://doi.org/10.1139/w08-156
Chehri, K., Salleh, B., Yli-Mattila, T., Reddy, K. R. N., & Abbasi, S. (2011). Molecular characterization of pathogenic Fusarium species in cucurbit plants from Kermanshah province, Iran. Saudi journal of biological sciences, 18(4), 341-351. https://doi.org/10.1016/j.sjbs.2011.01.007
Chobe, S. S., Adole, V. A., Deshmukh, K. P., Pawar, T. B., & Jagdale, B. S. (2014). Poly (ethylene glycol)(PEG-400): A green approach towards synthesis of novel pyrazolo [3, 4-d] pyrimidin-6-amines derivatives and their antimicrobial screening. Archives of Applied Science Research, 6(2), 61-66.
Edel-Hermann, V., & Lecomte, C. (2019). Current status of Fusarium oxysporum formae speciales and races. Phytopathology, 109(4), 512-530.https://doi.org/10.1094/PHYTO-08-18-0320-RVW
Geiser, D. M., Aoki, T., Bacon, C. W., Baker, S. E., Bhattacharyya, M. K., Brandt, M. E., ... & Zhang, N. (2013). One fungus, one name: defining the genus Fusarium in a scientifically robust way that preserves longstanding use. Phytopathology, 103(5), 400-408. https://doi.org/10.1094/phyto-07-12-0150-le
Hansson, D., Menkis, A., Olson, Å., & Stenlid, J. (2012). Clonostachys as a potential biocontrol agent against Fusariumredolentum and other forest pathogens. Biological Control, 61(3), 134-140.
Hemlal, H., & Ravi, S. (2012). GC-MS, HPTLC and Antimicrobial analysis of Root extracts of Pseudarthria viscida Wight and Arn and Desmodium gangeticum (Linn) DC. International Research Journal of Biological Sciences, 1(5), 57-65.
Hueck, H. J., Adema, D. M., & Wiegmann, J. R. (1966). Bacteriostatic, fungistatic, and algistatic activity of fatty nitrogen compounds. Applied microbiology, 14(3), 308-319.https://doi.org/10.1128/am.14.3.308-319.1966
Iqbal, M., Dubey, M., McEwan, K., Menzel, U., Franko, M. A., Viketoft, M., et al., (2018). Evaluation of Clonostachys rosea for control of plant-parasitic nematodes in soil and in roots of carrot and wheat. Phytopathology, 108(1), 52-59. https://doi.org/10.1094/phyto-03-17-0091-r
Jeeva, S., & Krishnamoorthy, A. S. (2018). Antifungal Potential of Myco-molecules of Coprinopsis cinerea (Schaeff) S. Gray s. lat. against Fusarium spp. Madras Agricultural Journal, 105 (1-3), 56-60.
Jeeva S, Krishnamoorthy AS (2018). Antifungal Potential of Myco-molecules of Coprinopsis cinerea (Schaeff) S. Gray s. lat. against Fusarium spp. Madras Agricultural Journal 105 (1-3): 56-60 http://dx.doi.org/10.29321/MAJ.2018.000102
Funck Jensen, D., Dubey, M., Jensen, B., & Karlsson, M. (2022). Clonostachys rosea to control plant diseases. Cambridge: Burleigh Dodds Science Publishing
Karlsson, M., Durling, M. B., Choi, J., Kosawang, C., Lackner, G., Tzelepis, G. D et al., (2015). Insights on the evolution of mycoparasitism from the genome of Clonostachys rosea. Genome biology and evolution, 7(2), 465-480.https://doi.org/10.1093/gbe/evu292
Kaur, N., Arora, D. S., Kalia, N., & Kaur, M. (2020). Bioactive potential of endophytic fungus Chaetomium globosum and GC–MS analysis of its responsible components. Scientific Reports, 10(1), 18792. https://doi.org/10.1038/s41598-020-75722-1.
Khan, N., Martínez-Hidalgo, P., Ice, T. A., Maymon, M., Humm, E. A., Nejat, N., et al., (2018). Antifungal activity of Bacillus species against Fusarium and analysis of the potential mechanisms used in biocontrol. Frontiers in microbiology, 9, 2363. https://doi.org/10.3389%2Ffmicb.2018.02363
Leslie, J. F., & Summerell, B. A. (2008). The Fusarium laboratory manual. John Wiley & Sons.
López-Aranda, J. M., Domínguez, P., Miranda, L., de los Santos, B., Talavera, M., Daugovish, O., et al., (2016). Fumigant use for strawberry production in Europe: the current landscape and solutions. International Journal of Fruit Science, 16(sup1), 1-15. https://doi.org/10.1080/15538362.2016.1199995
Lopez-Diaz, C., Rahjoo, V., Hermosa, R., & Monte, E. (2017). Trichoderma as Clonostachys as biocontrol agents against Fusarium wilt: prospects, mechanisms and molecular markers. Fungal Biology Reviews, 31(2), 96-108.
Mahmoud, A. F. A. (2016). Evaluation of certain antagonistic fungal species for biological control of faba bean wilt disease incited by Fusarium oxysporum. Journal of Phytopathology and Disease Management, 1-14. https://ppmj.net/index.php/ppmj/article/view/53
Manikandaselvi, S., Vadivel, V., & Brindha, P. (2016). Review on Luffa acutangula L.: Ethnobotany, phytochemistry, nutritional value and pharmacological properties. Int J Curr Pharm Rev Res, 7(3), 151-5.
Martyn, R.D. (2014). Fusarium wilt of watermelon: 120 years of research. Horticultural reviews, 42, 349-442.https://doi.org/10.1002/9781118916827.ch07
Moraga-Suazo, P., Opazo, A., Zaldúa, S., González, G., & Sanfuentes, E. (2011). Evaluation of Trichoderma spp. and Clonostachys spp. strains to control Fusarium circinatum in Pinus radiata seedlings. Chilean journal of agricultural research, 71(3), 412.
Mostafa, Y. S., Alamri, S. A., Alrumman, S. A., Hashem, M., Taher, M. A., & Baka, Z. A. (2022). In vitro and in vivo biocontrol of tomato Fusarium wilt by extracts from brown, red, and green macroalgae. Agriculture, 12(3), 345. https://doi.org/10.3390/agriculture12030345
Naglot, A., Goswami, S., Rahman, I., Shrimali, D. D., Yadav, K. K., Gupta, V. K., et al., (2015). Antagonistic potential of native Trichoderma viride strain against potent tea fungal pathogens in North East India. The plant pathology journal, 31(3), 278. https://doi.org/10.5423%2FPPJ.OA.01.2015.0004
Nygren, K., Dubey, M., Zapparata, A., Iqbal, M., Tzelepis, G. D., Durling, M. B., et al., (2018). The mycoparasitic fungus Clonostachys rosea responds with both common and specific gene expression during interspecific interactions with fungal prey. Evolutionary applications, 11(6), 931-949. https://doi.org/10.1111%2Feva.12609
Olowe, O. M., Nicola, L., Asemoloye, M. D., Akanmu, A. O., Sobowale, A. A., & Babalola, O. O. (2022). Characterization and antagonistic potentials of selected rhizosphere Trichoderma species against some Fusarium species. Frontiers in Microbiology, 13, 985874. https://doi.org/10.3389/fmicb.2022.985874
Oviya, R., Thiruvudainambi, S., Ramamoorthy, V., Vendan, R. T., & Vellaikumar, S. (2022). Gas Chromatography Mass Spectrometry (GCMS) analysis of the antagonistic potential of Trichoderma hamatum against Fusarium oxysporum f. sp. cepae causing basal rot disease of onion. Journal of Biological Control, 36(1), 17-30.http://dx.doi.org/10.18311/jbc/2022/30754
Ponnusamy, R., Vaikuntavasan, P., Subramanian, R., Mathiyazhagan, K., Palanisamy, M., & Ayyanar, K. (2018). Molecular detection of antimicrobial peptide genes and identification of antifungal compounds of Bacillus sp. against Fusarium oxysporum f. sp. cubense causing wilt in banana. Current Journal of Applied Science and Technology, 28(2), 1-8.https://doi.org/10.9734/CJAST/2018/42299
Rabha, A. J., Sharma, G. D., Naglot, A., & Gogoi, H. K. (2015). GC-MS analysis of secondary metabolites of endophytic Colletotrichum gloeosporioides isolated from Camellia sinensis (L) O. Kuntze. International Journal of Innovative Research in Science & Engineering , 3 (11), 2347-3207.
Rampersad, S.N. (2020). Pathogenomics and Management of Fusarium Diseases in Plants. Pathogens, 9 (5), 340. https://doi.org/10.3390/pathogens9050340
Raza, W., Ling, N., Zhang, R., Huang, Q., Xu, Y., & Shen, Q. (2017). Success evaluation of the biological control of Fusarium wilts of cucumber, banana, and tomato since 2000 and future research strategies. Critical reviews in biotechnology, 37(2), 202-212. https://doi.org/10.3109/07388551.2015.1130683
Rentería-Martínez, M. E., Meza-Moller, A., Guerra-Camacho, M. A., Romo-Tamayo, F., Ochoa-Meza, A., & Moreno-Salazar, S. F. (2015). First report of watermelon wilting caused by Fusarium brachygibbosum in Sonora, Mexico. Plant Disease, 99(5), 729-729. https://doi.org/10.1094/PDIS-10-14-1073-PDN
Sama, H., Sombié, P. A. E. D., Guenne, S., Soura, H. B., & Hilou, A. (2021). Antifungal potential and fatty acid profile of two Jatropha curcas (Euphorbiaceae) oils. Journal of Agriculture and Food Research, 6, 100244. http://dx.doi.org/10.1016/j.jafr.2021.100244
Shao, S., Li, B., Sun, Q., Guo, P., Du, Y., & Huang, J. (2022). Acetolactate synthases regulatory subunit and catalytic subunit genes VdILVs are involved in BCAA biosynthesis, microscletotial and conidial formation and virulence in Verticillium dahliae. Fungal Genetics and Biology, 159, 103667. https://doi.org/10.1016/j.fgb.2022.103667
Shen, Q., Liu, L., Wang, L., & Wang, Q. (2018). Indole primes plant defense against necrotrophic fungal pathogen infection. PLoS One, 13(11), e0207607.https://doi.org/10.1371%2Fjournal.pone.0207607
Shravani, V., Nallusamy, S., Govindasamy, J., Eswaran, K., Iruthayasamy, J., & Annaiyan, S. (2024). Unravelling the potent nematotoxic compounds from Clonostachys rosea effective against root knot nematode, Meloidogyne incognita-an in-vitro and in-silico approach. Physiological and Molecular Plant Pathology, 131, 102279. https://doi.org/10.1016/j.pmpp.2024.102279
Sui, G., Zhang, W., Zhou, K., Li, Y., Zhang, B., Xu, D., et al., (2017). Trialkylamine derivatives containing a triazole moiety as promising ergosterol biosynthesis inhibitor: design, synthesis, and antifungal activity. Chemical and Pharmaceutical Bulletin, 65(1), 82-89. https://doi.org/10.1248/cpb.c16-00732
Summerell, B.A. (2019). Resolving Fusarium: Current status of the genus. Annual Review of Phytopathology, 57, 323-339. https://doi.org/10.1146/annurev-phyto-082718-100204
Summerell, B. A., Salleh, B., & Leslie, J. F. (2003). A utilitarian approach to Fusarium identification. Plant disease, 87(2), 117-128. http://dx.doi.org/10.1094/PDIS.2003.87.2.117
Sun, Z. B., Li, S. D., Ren, Q., Xu, J. L., Lu, X., & Sun, M. H. (2020). Biology and applications of Clonostachys rosea. Journal of applied microbiology, 129(3), 486-495. https://doi.org/10.1111/jam.14625
Tian, T., Li, S. D., & Sun, M. H. (2014). Synergistic effect of dazomet soil fumigation and Clonostachys rosea against cucumber Fusarium wilt. Phytopathology, 104(12), 1314-1321. https://doi.org/10.1094/phyto-11-13-0297-r
Toledo, A. V., Virla, E., Humber, R. A., Paradell, S. L., & Lastra, C. L. (2006). First record of Clonostachys rosea (Ascomycota: Hypocreales) as an entomopathogenic fungus of Oncometopia tucumana and Sonesimia grossa (Hemiptera: Cicadellidae) in Argentina. Journal of Invertebrate Pathology, 92(1), 7-10. https://doi.org/10.1016/j.jip.2005.10.005
Toubi, Y., Abrigach, F., Radi, S., Souna, F., Hakkou, A., Alsayari, A., et al., (2019). Synthesis, antimicrobial screening, homology modeling, and molecular docking studies of a new series of Schiff base derivatives as prospective fungal inhibitor candidates. Molecules, 24(18), 3250. https://doi.org/10.3390/molecules24183250
Wu, Y., Zeng, H., Li, Y., Yu, D., Zhang, R., & Zeng, L. (2018). The biocontrol efficacy of Clonostachys rosea in field and its mechanisms against Fusarium oxysporum in cucumber. Applied Soil Ecology, 129, 140-147.
Yassin, M. T., Mostafa, A. A. F., Al-Askar, A. A., Sayed, S. R., & Rady, A. M. (2021). Antagonistic activity of Trichoderma harzianum and Trichoderma viride strains against some fusarial pathogens causing stalk rot disease of maize, in vitro. Journal of King Saud University-Science, 33(3), 101363. https://doi.org/10.1016/j.jksus.2021.101363
Zhang, A., Yue, Y., Yang, Y., Yang, J., Tao, K., Jin, H., & Hou, T. (2019). Discovery of N-(4-fluoro-2-(phenylamino) phenyl)-pyrazole-4-carboxamides as potential succinate dehydrogenase inhibitors. Pesticide biochemistry and physiology, 158, 175-184. https://doi.org/10.1021/acs.jafc.3c01429
Zhao, S., Lin, G., Duan, W., Zhang, Q., Huang, Y., & Lei, F. (2021). Design, synthesis, and antifungal activity of novel longifolene-derived diacylhydrazine compounds. ACS omega, 6(13), 9104-9111. https://doi.org/10.1021%2Facsomega.1c00217
Zhao, Y.J., Liu, Y., Wang, Y., Xing, G.F., Wang, Y. (2019). Use of 2-Nonanol Derivative in Preparing Medicine for Inhibiting Fusarium graminearum Growth, Inhibiting Fusarium graminearum Sub Spore Germination, Inhibiting Fusarium graminearum and Preventing Wheat Scab of Fusarium graminearum. Chinese Patent CN107258783.(In Chinese).

Table 1. BLASTN identification of Fusarium isolates recovered from wilted ridge gourd plants

Isolates	*Fusarium* spp.	Pigmentation on PDA	Colony growth rate (cm/day ± S.E.)^a	Spore Size (µm)		Septations		Chlamydospores Diameter (µm)	Hyphal diameter (µm)
				Microconidia (L × B)	Macroconidia (L × B)	Microconidia	Macroconidia
F1	F. brachygibbosum	White	1.86 ± 0.01	8.90 × 2.88	21.14 × 1.28	Aseptate	3-6	4.26	2.10
F2	F. equiseti	White	2.08 ± 0.01	4.18× 3.17	12.72 × 1.69		3-5	4.06	2.30
F3	F. oxysporum	White to brown	1.63 ± 0.01	4.25×3.05	16.52×1.9		3-5	4.20	2.65
F4	F. oxysporum	Pale violet	1.42 ± 0.01	10.26 × 4.35	13.67 × 1.39		3-4	2.57	2.84
F5	F. oxysporum	White to brown	1.40 ± 0.01	7.45 × 3.49	23.59 × 2.98		5-7	4.05	2.03
F6	F. brachygibbosum	White to pale violet	0.95 ± 0.01	8.42 × 2.38	17.30 × 2.17		2-3	3.42	3 00
F7	F. oxysporum	White	1.09 ± 0.01	6.52×2.47	19.24×5.01		3-4	2.69	3.56
F8	F. oxysporum	White	1.72 ± 0.01	13.33 × 6.62	24.79 × 5.03		2-4	3.65	4.97
F9	F. oxysporum	Cottony white to reddish	1.91 ± 0.01	9.68 × 3.63	15.30×1.50		3-4	3.92	2.37
F10	F. oxysporum	White	1.88± 0.01	4.18× 3.17	12.72 × 1.69		3-5	4.27	3.24
F11	F. oxysporum	White	2.58 ± 0.05	12.77 × 5.02	27.69 × 3.82		3-4	4.73	2.24
F12	F. oxysporum	White and pinkish mycelium	2.31 ± 0.01	8.90 × 2.88	21.14 × 1.28		3-4	4.26

Table 2: Microscopic analysis and identification of Fusarium spp. from ridge gourd plants

S. No.	Isolate	Collection site	GPS Co-ordinates		*Fusarium* spp.	NCBI Accession
S. No.	Isolate	Collection site	Latitude (^oN)	Longitude (^oE)	*Fusarium* spp.	NCBI Accession
1.	F1	Vettaikaranpudur	10.5451	76.8882	F. brachygibbosum	OR526740
2.	F2	Vettaikaranpudur	10.5580	76.9227	F. equiseti	OR526742
3.	F3	Sethumadai	10.5107	76.8807	F. oxysporum	PP267172
4.	F4	Madampatti	10.9704	76.5102	F. oxysporum	PP267177
5.	F5	Madampatti	10.9739	76.8617	F. oxysporum	PP296391
6.	F6	Kuppanur	10.9559	76.8545	F. brachygibbosum	PP267178
7.	F7	Kuppanur	10.9463	76.8704	F. oxysporum	PP273444
8.	F8	Perur	10.9308	76.8656	F. oxysporum	PP267183
9.	F9	Thondamuthur	11.0168	76.9558	F. oxysporum	PP267184
10.	F10	Thondamuthur	11.0168	76.9558	F. oxysporum	PP296425
11.	F11	Narasipuram	11.0168	76.9558	F. oxysporum	PP267165
12.	F12	Narasipuram	10.0168	76.9558	F. oxysporum	PP158948.1

^aIsolates were grown on PDA for five days at 28 ± 1 °C in the dark. Values represent the average size calculated from six representative spores or hyphae.

Table 3: Metabolite profiling of C. rosea interaction with F. oxysporum ( isolate F11)

Chemical class	CID	Compound	RT	Area%	Molecular formula	Molecular weight (g/mol)	Properties
Thiol	109858	tert-Hexadecanethiol	25.457	0.641	C₄₈H₉₉AuS₃	969.50	antitumoral, antioxi- dant, insecticidal and antifungal activities antitumoral, antioxi- dant, insecticidal and antifungal activities Antitumoral, antioxidant, insecticidal, antifungal activities
Fatty acid	5282761	cis-Vaccenic acid	23.832	0.759	C₁₈H₃₄O₂	282.50	Insecticide, Antifungal
	5312518	cis-13-Eicosenoic acid	11.362	0.375	C₂₀H₃₈O₂	310.50	Anti-inflammatory
	6122992	9-Octadecen-12-ynoic acid	4.444	0.710	C₁₈H₃₀O₂	278.40	Insecticide, nematicide, 5-alpha reductase inhibitor, antioxidant, free radical scavenger peroxidase substrate, reductant and lipid peroxidase inhibitor
	445638	cis-9-Hexadecenoic acid	4.129	0.436	C₁₆H₃₀O₂	254.41	Antifungal, antioxidant and antimicrobial, nematicidal
	5312435	cis-10-Heptadecenoic acid	3.414	0.514	C₁₇H₃₂O₂	268.40	Antifungal
	446284	cis-5,8,11,14,17-Eicosapentaenoic acid	6.380	0.624	C₂₀H₃₀O₂	302.50	Antimicrobial, Antibacterial
Alcohol	2682	1-Hexadecanol	21.851	0.915	C₁₆H₃₄O	242.44	Antimicrobial
	8193	1-Dodecanol	17.929	1.450	C₁₂H₂₆O	186.33	Antifungal, insecticide, antibacterial
	5364952	Z,Z-2,5-Pentadecadien-1-ol	5.925	0.551	C₁₅H₂₈O	224.38	Antimicrobial
	12367	2-Nonanol	5.504	0.442	C₉H₂₀O	144.25	Antifungal
Alkane	543276	4-Trifluoroacetoxytetradecane	13.773	1.241	C₁₆H₂₉F₃O₂	310.39	Antioxidant
Steroid	22213932	Cholestan-3-ol, 2-methylene-,	8.581	0.435	C₂₈H₄₈O	400.70	Antimicrobial, anti-inflammatory
Ester	538153	11-Tetradecyn-1-ol, acetate	8.481	0.508	C₁₆H₂₈O₂	252.39	Antimicrobial, antioxidant
Aldehyde	5367669	14-Octadecenal	5.660	0.487	C₁₈H₃₄O	266.50	No activity reported
Alkanolamine	11807	1-Propanol, 2-amino-2-methyl-	5.199	0.886	C₉H₁₃NO	151.20	Antimicrobial
Triazole	9257	4H-1,2,4-Triazole	4.339	0.741	C₂H₃N₃	69.07	Antioxidant, antifungal
Alkene	5362863	Z,Z,Z-4,6,9-Nonadecatriene	4.019	0.501	C₁₉H₃₄	262.50	No activity reported
Hydrazine	9601657	2-Nonadecanone 2,4-dinitrophenylhydrazine	3.329	0.505	C₂₅H₄₂N₄O₄	462.60	Antifungal, antimicrobial
Indolines	7054	1H-Indole-2,3-dione	3.098	0.480	C₈H₅NO₂	147.13	Antimicrobial
Aromatic piperidine	8082	Hexahydropyridine	3.073	0.548	C₅H₁₁N	85.15	No activity reported
Acid	591969	7,7-Dibromobicyclo[2.2.1]heptane-1-carboxylic acid, methyl ester	3.904	0.488	C₉H₁₂Br₂O₂	312.00	No activity reported
Acid	31250	Propanoic acid, 3,3'-thiobis-, didodecyl ester	7.720	0.391	C₃₀H₅₈O₄S	514.799	Antioxidant, anti-inflammatory
Amine	71311714	2-Linoleoyl-1-palmitoyl-sn-glycero-3-phosphoethanolamine	4.209	0.403	C₃₉H₇₄NO₈P	716.00	No activity reported

Table 4: Binding affinities of C. rosea biomolecules with Fusarium sp. protein targets

Protein

Ligand name

H-Bond formed with interaction distance

-C Docker energy (kcal/mol)

E3 Ubiquitin ligase

1-Hexadecanol

11-Tetradecyn-1-ol

1-Propanol, 2-amino-2-methyl-

4-Trifluoroacetoxytetradecane

2-Nonanol

9-Octadecen-12-ynoic acid

Carbendazim

GLN 426 (2.05)

ASP 416 (2.54)

ALA 374 (1.89); ASP 416 (1.93)

GLU 426 (2.15, 2.29)

TYR 404 (2.19); VAL 403 (2.48)

GLN 371 (3.00)

ASP 416 (2.56)

29.1017

29.5723

30.1295

33.1485

24.1582

24.5534

19.2903

Eubricol 14-alpha-demethylase

1-Hexadecanol

cis-9-Hexadecenoic acid

4-Trifluoroacetoxytetradecane

2-Nonadecanone 2,4dinitrophenylhydrazine

9-Octadecen-12-ynoic acid

cis-13-Eicosenoic acid

Carbendazim

TYR 105 (1.96); SER 361 (1.92)

ARG 364 (5.86)

ARG 364 (2.21); TYR 119(2.29)

HIS 360 (2.44); SER 361 (2.40)

ARG 364 (2.43)

TYR 119 (2.02)

ARG 364 (1.99, 1.83)

36.1381

32.5257

33.3898

43.2458

37.2577

39.9809

19.945

B-tubulin

1-Hexadecanol

4-Trifluoroaetoxytetradecane

2-Nonadecanone 2,4 dinitrophenylhydrazine

cis-13-Eicosenoic acid

1-Dodecanol

cis-Vaccenic acid

Carbendazim

GLY 360 (2.01, 3.00)

TYR 227 (2.04); ARG 276 (3.57)

ARG 359 (2.93)

GLN 22 (2.60)

THR 274 (1.94)

ARG 276 (2.11)

GLY 360 (2.63, 2.50)

28.5868

28.6824

35.4395

27.1474

25.557

22.1716

15.2291

DASH complex

1-Hexadecanol

1-Propanol, 2-amino-2-methyl

4-Trifluoroacetoxytetradecane

2-Nonadecanone 2,4dinitrophenylhydrazine

tert-Hexadecanethiol

11-Tetradecyn-1-ol

Carbendazim

GLU 1075 (2.80); THR 1100 (2.10)

MET 1076 (1.80); GLU 1079 (1.89)

GLU 1080 (2.01); VAL 1025 (2.57); GLU 1079 (2.78)

HIS 1022 (2.21)

ASP 1024 (2.24)

ARG 1102 (2.26)

MET 1076 (2.01); GLU 1079 (2.28); ARG 1102 (2.68)

28.5406

29.7839

26.5377

26.2189

23.8531

24.419

11.1733

Succinate dehydrogenase

1-Hexadecanol

cis-9-Hexadecenoic acid

cis-10-Heptadecenoic acid

cis-Vaccenic acid

cis-13-Eicosenoic acid

9-Octadecen-12-ynoic acid

Carbendazim

SER 93 (3.87)

ALA 457 (2.14)

ALA 457 (2.11); ARG 454 (2.89); ARG 342 (2.51)

ALA 457 (2.19); ARG 342 (4.61)

ALA 457 (2.04); ARG 454 (2.25); ARG 342 (2.59)

ALA 457 (2.13); ARG 342 (3.00)

ALA 257 (2.77)

51.1392

60.8763

63.1851

65.5102

68.6523

62.9812

27.1516

Acetolactate synthase

1-Hexadecanol

11-Tetradecyn-1-ol

2-Nonanol

1-Propanol, 2-amino-2-methyl

1-Dodecanol

Carbendazim

TZD 12 (2.58)

ARG 369 (2.13)

ARG 369 (1.89); GLN 329 (2.42)

ASP 371 (1.75)

ARG 369 (2.24)

ARG 369 (2.98)

21.6062

25.4841

28.1071

21.8201

20.0715

16.2687

Suppl.docx

Download PDF

Reviewers agreed at journal
23 Jul, 2024
Reviewers invited by journal
22 Jul, 2024
Editor invited by journal
14 Jul, 2024
Editor assigned by journal
12 Jul, 2024
First submitted to journal
09 Jul, 2024

You are reading this latest preprint version

Unveiling Clonostachys rosea bioactives: Investigating antifungal potential against Fusarium oxysporum through in vitro and in silico studies

Status:

Version 1

Abstract

Figures

1. Introduction

2. Material and Methods

3. Results

Discussion

Conclusion

Abbreviations

Declarations

References

Tables

Supplementary Files

Status:

Version 1