Antiproliferative and apoptosis effect of Lactobacillus acidophilus on HT-29 cells accompanied by subG1 cycle arrest and modulation of mTOR/p62/FAS/Caspase8/Bax pathway

doi:10.21203/rs.3.rs-4709833/v1

Download PDF

Research Article

Antiproliferative and apoptosis effect of Lactobacillus acidophilus on HT-29 cells accompanied by subG1 cycle arrest and modulation of mTOR/p62/FAS/Caspase8/Bax pathway

https://doi.org/10.21203/rs.3.rs-4709833/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Lactobacillus acidophilus is the most commonly used probiotic that is paving the preventive and biotherapeutic methods for colorectal cancer. However, the mechanisms underlying its remedial utility are largely unknown.

The cell viability of the HT-29 cell line under concentrations (10⁸,10⁹ and 10¹⁰ cfu/ml) of L. acidophilus Sonicated Extract (LSE) screened out, using the MTT assay at 24 and 72 hours. The apoptosis and cell cycle arrest were assessed via flow cytometry. A possible signaling pathway of mTOR/p62/FAS/Caspase8/Bax was examined using qRT-PCR.

The LSE was found as an active cell apoptosis inducer and cell proliferation inhibitor (IC50 value as 10⁸ cfu/ml after 72 hr) in a time and dose-dependent manner. Cell cycle analysis demonstrated subG1 phase arrest. Disclosing mTOR/p62/FAS/Caspase8/Bax expression, revealed another one mechanism underlying LSE-induced apoptosis while leading to cell cycle arrest. LSE upregulated the expression of the Fas death receptor along with caspase8 and Bax-mediated apoptosis genes while suppressing the anti-apoptotic mTOR and p62 expression.

The results suggest that LSE has a property in the treatment of colorectal cancer by interfering with multiple cellular functions which depends on the bacterial dose and time administered.

Probiotic

Anticancer

Colorectal cancer

Signaling pathway

Colorectal cancer (CRC) is one the most common type, deadliest cancer worldwide [1, 2]. Lactic acid bacteria and Bifidobacteria are promising for human health and carry out the majority of metabolic activities. A variety of beneficial mechanisms have been identified from probiotics, including their anti-carcinogenic, anti-inflammatory and pharmacotherapeutics properties, maintaining healthy intestinal flora, reinforcing immune function [3, 4] and enhancing the quality as well as quantity components of the gut microbiota [5].

At the genus level, Lactobacillus species tends to decline inflammatory signals in CRC [6, 7]. For example, orally consumption of Lactobacillus casei protects mice against CRC progression through lessening the IL-22 cytokine (play part in of cancer cell proliferation) and upregulation of caspase-7 and caspase-9 [8].

A study by Tukemez et al. showed that exopolysaccharides (EPSs) produced by Lactobacillus spp have an anti-tumor activity. EPSs induced apoptosis and decreased cell proliferation via raising the protein expression of Bax and Caspase-3 following the reduction of Survivin and Bcl-2 proteins [9]. Other genes that are involve in cancer and was also considered in this study were Mammalian target of rapamycin (MTOR) and p62/sequestosome 1 (p62). mTOR and p62 proteins can activate oncogenic signaling pathways and increase proliferation of colorectal carcinoma, thus have a crucial role in cancer biology and was also shown to overexpressed in human cancers of the brain, breast, gastric, and colon [10, 11]. Flow cytometry analysis in papillary thyroid cancer (PTC) cells indicated that the expression of Bax (apoptosis-related protein) was increased when p62 was knocked out [12].

According to the data description above, the Lactobacillus sp. play a critical factor in CRC. Therefore, we hypothesized that L. acidophilus Sonicated Extract (LSE) may capable of decreasing the p62-MTOR- mediated cell proliferation, increase the apoptosis and its FAS/Caspase8/Bax-mediated pathways. Also to determine cell cycle arrest in HT-29 cells through LSE which is important for developing new treatments or cure for CRC.

Culture condition and preparation of supernatant extract

The freeze-dried form of L. acidophilus (ATCC 4356; Iranian Biological Research Center, Iran) was cultured in MRS agar. Bacterial colonies were transferred to MRS Broth and cultured overnight. L. acidophilus sonicated extract (LSE) was prepared according to Soltan Dllal etal [13]. Briefly 1ml of the overnight culture was sub-cultured in to 50 mL of MRS broth at 37°C. At various time points, the absorbance was measured at 600 nm (OD600) until reached 1 (corresponding to ~ 10⁹ cfu/ml). The bacterial suspension then centrifuged at 3,000 rpm for 5 min at 4°C. After discarding the supernatant, a 1-ml aliquot of L. acidophilus at a concentration of 10⁹ cfu/ml was lysed using ultrasonicator (Hielscher). 0.22-µm filtration membrane (Bioyfil) then used for sterilization. In the next step, this solution was mixed with RPMI1640 medium containing 10% FBS and a concentration of 10% (10⁸ cfu/ml) was also prepared.

Cell line

HT29 Human CRC cells (No. IBRC C10097) was purchased from the Iranian Biological Resource Center, cultured in RPMI with 0.1% penicillin-streptomycin, 10% FBS (Gibco; Thermo Fisher Scientific, Inc.), and 1% Glutamine (Gibco; Thermo Fisher). The cells were cultured in a CO2 incubator (HEPA class 100; Thermo Fisher Scientific, Inc).

In Vitro Cytotoxicity using MTT Assay

In order to test the cell toxicity of the obtained LSE, MTT assay was performed. 5 \(\:\times\:\)10⁴ cells were seeded in 96-well plates. Then cells were treated with 10⁸,10⁹ and 10¹⁰ cfu/ml concentrations of LSE for 24 and 72 hours. Each concentration was experimented with at least three times on each cell line. MRS containing RPMI1640 medium was used as control. After incubation, MTT solution (Sigma) was added (0.5 mg/mL per each 96-well plate) and incubated for 4 hours in the dark. Following an incubation with DMSO for 20 min, the absorbance was measured at 570 nm using a plate reading spectrophotometer (BIO–RAD). The percentage of viable cells was obtained from the equation: % Cell viability = (mean OD of toxicant treated cells– blank OD / mean OD of negative control– blank OD) × 100. IC50 (50% of growth inhibition) LSE concentration were determined in various incubation times.

Apoptosis Detection

The apoptosis was identified using FITC Apoptosis Detection kit (BD Biosciences), as reported by the manufacturer's protocol. HT-29 cells were seeded in 6–well cell culture plates at a density of 1 × 10⁶ cells/well and left to adhere overnight. Then the cells were treated with 10⁸ and 10⁹ CFU/mL LSE for 24 and 72 h. MRS containing RPMI medium was used as control. Following treatment, cells were trypsinized, washed thoroughly with cold PBS. Cells were subsequently resuspended in 1X Binding Buffer and transferred to a 5 ml culture tube. Cells were labeled by adding FITC Annexin V (5 µl) and propidium iodide (PI) (5 µl) in each sample. Finally, apoptotic cells were detected by FACSCalibur flow cytometer (San Jose, CA, USA). Further analysis was performed with FLOWJO (version 7.6, USA). The following formula was used to calculate Apoptotic index (AI) (%) = 100 × early apoptotic cells (AnnexinV⁺) /total viable and early apoptotic cells (AnnexinV⁺ plus AnnexinV⁻) [14].

Cell Cycle Analysis

HT-29 cells (1 × 10⁶ cells/6-well plates) were treated with LSE at a concentration of 10⁸ cfu/ml for 24 and 72 h. MRS containing RPMI1640 medium was used as negative control. After incubation, the cells were washed in PBS and centrifuged at 1800 rpm for 8 min. Cells were resuspended in 5 ml ice-cold 70% ethanol and fixed for 1 h at 4°C. Next, cell suspensions were washed in PBS and stained with PI solution (PBS containing 50 µg/ml PI, 50 µg/ml RNase A) for 30 min in the dark. Finally, flow cytometry was performed using BD FACSCalibur system. Each group was performed three times.

Quantitative Real-Time PCR

It was followed the MIQE guidelines [15]. The expression of the mtor, p62, caspase8, FAS and BAX genes was quantified by RT-qPCR. RNA was isolated using the RNX-PLUS reagent (Sinaclon, Iran, EX6101), followed as reported by the manufacturer's protocol. Best quality of RNA (OD ~ 1.9-2) was then used for cDNA synthesis. 2 − 1 µL of RNA (500 ng/20µl) reverse transcribed using the easy cDNA synthesis kit (Parstous, Iran, A101161). The cDNA safely stored at -20˚C.

qPCR performed using RealQ Plus 2x Master Mix Green kit (Ampliqon, Denmark, A323402) on an MyGo Pro real-time PCR instrument (IT-IS Life Science). The qRT-PCR program was set to predenaturation step at 95°C for 1 min, followed by 40 cycles of denaturation at 95 °C for 15 s and 72 °C for 30s. Primers were designed using IDT and Primer 3 online software. The primer sequences are listed in Table 1.

The relative expression levels were normalized by housekeeping genes GAPDH and HPRT (reference). Cq values were recorded. Livak method (\(\:{2}^{-\varDelta\:\varDelta\:CT})\:\)for analyzing the relative changes in gene expression [16] which is described as follows ΔΔC_T(target) = (C_{T target}−C_{T ref}) −(C_{T control} − C_{T ref}) and ΔΔC_T(control) = (C_{T control} − C_{T ref}) _control − mean (C_{T control} − C_{T ref}).

Table 1

The primer sequences of p62, mTOR, Caspase8, FAS, Bax, GAPDH and HPRT1 genes.
Gene Name	Primer sequence	Product length (bp)	Tm	Primer length	Designed on
P62	F: TGATTGAGTCCCTCTCCCAGAT	100	58.6	20	Exon 5, exon 7
P62	R: GCCGCTCCGATGTCATAGTT	100	58.7	20	Exon 5, exon 7
mTOR	F: CTGATTCTCACAACCCAGCG	129	58.9	20	Exon 5, exon 6
mTOR	R: ATCATCCCGATTCATGCCCT	129	58.9	20	Exon 5, exon 6
Casp8	F: CGGGGATACTGTCTGATCATCA	128	59.1	22	Exon 7, exon 8
Casp8	R: TCAAAGGTCGTGGTCAAAGC	128	56.7	20	Exon 7, exon 8
Bax	F: TTTCTGACGGCAACTTCAACTG	127	59	20	Exon 4, exon 5
Bax	R: TCCAATGTCCAGCCCATGA	127	58.7	20	Exon 4, exon 5
GAPDH	F: GTGGTCTCCTCTGACTTCAAC	96	57.9	21	Exon 7, exon 8
GAPDH	R: GGAAATGAGCTTGACAAAGTGG	96	58	22	Exon 7, exon 8
HPRT1	F: AAGGGTGTTTATTCCTCATGGAC	105	58.40	20	Exon 2, exon 3
HPRT1	R: AGCACACAGAGGGCTACAA	105	58.55	20	Exon 2, exon 3

Statistical analysis

Statistical analysis was performed using GraphPad Prism version 8.0. Independent sample t test (unpaired Student’s t test) was conducted for the comparison of two conditions. The statistical differences among the groups were assessed by one-way ANOVA and tukey’s multiple comparisons test. Data are presented as mean ± SEM out of three independent experiments. Values were considered significantly different at a P value p < 0.05. *p < .05, **p < .01, and ***p < .001 and ****p < .0001.

Decrease of HT-29 cell viability via LSE

The growth-inhibitory effect of LSE on HT-29 cells was examined in vitro, using the MTT assay. As shown in Fig. 1, co-incubation of HT29 cells with 10⁸, 10⁹ and 10¹⁰ CFU/mL LSE for 24 hours decreased the viable cells to 87.8%, 74.7% and 61.3% respectively. This reduction reached to 47.3% and 30.4% after 72h respectively. In this regard, LSE reduce the HT29 colon cell survival in a concentration- and time-dependent manner. The inhibitory concentration (IC50) of LSE was approximately 10⁸ cfu/ml after 72 hr.

Flow Cytometry Analysis: LSE trigger apoptosis in HT–29 Cells

Annexin V/PI staining was checked with flow cytometry to investigate the apoptosis-inducing effect of LSE. As illustrated in Fig. 2, LSE induced HT‑29 cell apoptosis compared to the untreated control cells which was consistent with the anti-proliferation results. The number of apoptotic cells was increased from a dose and time-dependent aspect. The maximum amount of apoptosis was observed after 72h, which more than 50% of HT29 cells had undergone apoptosis by 10⁸ and 10⁹ cfu/ml concentration of LSE (Fig. 2.e, 2.f).

LSE induces subG₁ cell cycle arrest

Cell proliferation arrest was further evaluated by measuring cell cycle profile. HT-29 cells were incubated with 10⁹ cfu/ml concentration of LSE. At 24 and 72 hr after treatment, the cells were stained with PI. Next, cell cycle distribution at 4 phases (apoptotic sub-G1, G1, S, and G2) was analyzed by flow cytometry. An obvious increase in the cell percentage at the sub-G1 phase was observed by comparing with control (p ≤ 0.05) after 24 and 72 hr. Precisely, Figure. 3 indicated significantly higher percentage of treated cells in subG1 (13%) phase (cell cycle arrest in subG1) with a concomitant reduction at DNA synthesis in S and G2 phase after 24h. After 72h, the percentages of sub-G1 phase (apoptotic cells) were also significantly increased to 58% which shows noticeable subG1 arrest. The results also exhibited a lower proportion of cells in the G1, S and G2 phases (72h) toward the control which illustrated no cell cycle arrest at G1/S/G2 phases in HT-29 cells. Taken together, LSE provoke growth arrest at subG1 phase of the cell cycle at 24 and 72 h.

Gene expression analysis of mTOR/p62/Caspase8/Bax apoptosis- related genes modulated by LSE

Since we found that LSE probably blocked proliferation of HT-29 cells by inducing cell cycle arrest at sub-G1 which leads to apoptotic cell death, we wondered if the hypothetical mTOR/p62/Caspase8/Bax apoptosis- related pathway may involve.

Gene expression was normalized by GAPDH and HPRT reference genes. However, high fluctuations were observed in the expression of hprt1, which affected the results of the 2^−ΔΔCt method. Therefore, in final calculations, the GAPDH gene was used as a reference gene. Treatment with LSE resulted in a down-regulation of mTOR (~ 8-fold) and P62 (~ 8-fold). On the other hand, a significant upregulation occurred in Caspase8 (~ 4-fold), Bax (~ 11-fold) and FAS (~ 5-fold) expression at 10⁹ cfu/ml concentration after 24 h (Fig. 4).

CRC is a commonly diagnosed form of cancer and continues to increase every year. Genetic factors and more importantly extrinsic (e.g., environmental) reasons that alter the gut microbiota can actuate the risk of cancer. On the contrary, Manipulating the intestinal microbiome with host-friendly bacteria would confer anticancer benefits because of beneficial antioxidant and anti-inflammatory metabolites they produce [2, 8]. Notably, probiotics can modulate cancers via their ability to inhibit the growth of cancer cells, induction of apoptosis and block the cell cycle [17].

Results from the cytotoxicity assay provided evidence for anti-proliferative effects of L. acidophilus sonicated extract (LSE) against colon carcinoma in a concentration (10⁸, 10⁹ and 10¹⁰ CFU/mL) and time-dependent (24 hr and 72 hr) manner.

Several recent studies have illustrated the anti-proliferative effects of various probiotic extracts [2, 18]. A blend of probiotics including B. longum, B. bifidum, L.acidophilus, L. plantarum decreased the ability of migration, invasion and proliferation of the CT26 cells. Moreover, oral usage of these probiotic mixture suppressed tumor growth in BALB/c mice and increased tumor immunity [19].

In addition, our flow cytometry findings suggested that the growth inhibitory effect of LSE is relevant to cell-cycle stop. After the incubation of cells with LSE (10⁹ cfu/ml), a significant subG1 cell-cycle arrest was observed at 24h. Meanwhile, LSE significantly caused growth arrest in the subG1 after 72 h with a simultaneous reduction of cells in the G1, S and G2 phases. Taken together, the induction of HT29 cell cytotoxicity occurred through growth arrest at subG1 phase but it could also be due to apoptosis. In our flow cytometry experiments, we also came to the conclusion that LSE induced a remarkable decline of viable cells percentage over time and dose. The results revealed that LSE (10⁸ and 10⁹ cfu/ml) enhanced apoptotic cell death by 18–23% after 24h and 55–70% after 72h.

In other potentially relevant work, the supernatant of L. acidophilus had apoptotic effect on Caco-2 cell line, induce down regulation of Survivin, an inhibitor of apoptosis, and postpone CRC progression [20, 21]. Also, a recent study by Jan etal, shows that consumption of high-doses of L. paracasei and L. reuteri probiotics had inhibitory effect on pancreatic cancer cells and pancreatic cancer BALB/C model [22].

As mentioned above, LSE triggers apoptosis. To further validate the mechanism by which LSE induced the apoptosis, we propose a hypothetical signaling pathway through mTOR/p62/Caspase8/Bax FAS pathway and investigated the effect of LSE on these gene’s expression. Interestingly, LSE induced cell apoptosis via the activation of Bax, caspase8 and Fas-mediated apoptotic pathway while inhibiting the expression of anti-apoptotic mTOR and p62 genes. The reason for proposing this route comes back to preceding studies. Previously, Nakayama et al. showed that p62 significantly promoted the cancer cell proliferation. Also, primary tumor samples of patients with CRC express higher levels of p62 compared with normal colon tissues [23, 24]. Moreover, Duran et al. reported that p62 promoted tumorigenesis by mTORC1 compartmentalization and activation [25]. mTORC1 inhibitors can stimulate internal pathway for apoptosis, upregulating the expression levels of Bax and caspase- 9/3. The activated caspase-9/3 pathway then activates pro-caspase-8 resulting in activation for apoptosis [26]. Meanwhile, extrinsic apoptosis is mediated by death receptors such as Fas and TNF related apoptosis ligands. Zhou etal, demonstrated that Lactobacillus plantarum suppressive efficacy may be mediated via the activation of Fas/Fasl-mediated apoptotic pathway. Fas/Fasl complex develop the death-inducing signaling complex (DISC) and stimulate Casp8 which leads to the activation of downstream caspases, like Caspase-3 [27, 28] (Fig. 5).

In conclusion, we have uncovered a possible mechanism that controls LSE -induced apoptosis while leading to cell cycle arrest in subG₁ phase via mTOR/p62/Caspase8/Bax/FAS signaling pathway. Also, from a therapeutic point of view, the observed anti-proliferative and cytotoxic efficacy exerted by LSE on HT29 colon cancer cell line could represent an effective strategy for further studies on CRC therapy.

Conflict of Interest

All authors – none to declare.

Funding

None to declare

Acknowledgements

The authors thank Shoheila Zamanlui, Zahra Shahi, Arash Abednezhad and Sara Karimi for their skilled research assistance. The authors are grateful to the Microbiology, Molecular biology laboratories and Tissue Engineering Research Institute of Islamic Azad University of Central Tehran Branch.

Declaration of originality and copyrights

I Declare that current article is original and has not been submitted for publication, in part or in whole, to any other national or international journal.

Klimeck L, Heisser, T., Hoffmeister, M. and Brenner, H., (2023) Colorectal cancer: A health and economic problem. Best Practice & Research Clinical Gastroenterology 101839
Dai R, Kelly BN, Ike A, Berger D, Chan A, Drew DA, Ljungman D, Mutiibwa D, Ricciardi R, Tumusiime G (2024) The Impact of the Gut Microbiome, Environment, and Diet in Early-Onset Colorectal Cancer Development. Cancers 16: 676
Lu K, Dong S, Wu X, Jin R, Chen H (2021) Probiotics in Cancer. Frontiers in Oncology 11: 408
Lamichhane P, Maiolini M, Alnafoosi O, Hussein S, Alnafoosi H, Umbela S, Richardson T, Alla N, Lamichhane N, Subhadra B (2020) Colorectal cancer and probiotics: are bugs really drugs? Cancers 12: 1162
Ma T, Shen X, Shi X, Sakandar HA, Quan K, Li Y, Jin H, Kwok L-Y, Zhang H, Sun Z (2023) Targeting gut microbiota and metabolism as the major probiotic mechanism-An evidence-based review. Trends in Food Science & Technology
Sugimura N, Li Q, Chu ESH, Lau HCH, Fong W, Liu W, Liang C, Nakatsu G, Su ACY, Coker OO (2021) Lactobacillus gallinarum modulates the gut microbiota and produces anti-cancer metabolites to protect against colorectal tumourigenesis. Gut
Zhao J, Liao Y, Wei C, Ma Y, Wang F, Chen Y, Zhao B, Ji H, Wang D, Tang D (2023) Potential ability of probiotics in the prevention and treatment of colorectal cancer. Clinical Medicine Insights: Oncology 17: 11795549231188225
Torres-Maravilla E, Boucard A-S, Mohseni AH, Taghinezhad-S S, Cortes-Perez NG, Bermúdez-Humarán LG (2021) Role of Gut Microbiota and Probiotics in Colorectal Cancer: Onset and Progression. Microorganisms 9: 1021
Tukenmez U, Aktas B, Aslim B, Yavuz S (2019) The relationship between the structural characteristics of lactobacilli-EPS and its ability to induce apoptosis in colon cancer cells in vitro. Scientific reports 9: 1-14
Hua H, Kong Q, Zhang H, Wang J, Luo T, Jiang Y (2019) Targeting mTOR for cancer therapy. Journal of hematology & oncology 12: 1-19
Liang X, Yao J, Cui D, Zheng W, Liu Y, Lou G, Ye B, Shui L, Sun Y, Zhao Y (2023) The TRAF2-p62 axis promotes proliferation and survival of liver cancer by activating mTORC1 pathway. Cell Death & Differentiation 30: 1550-1562
Yu F, Ma R, Liu C, Zhang L, Feng K, Wang M, Yin D (2021) SQSTM1/p62 Promotes Cell Growth and Triggers Autophagy in Papillary Thyroid Cancer by Regulating the AKT/AMPK/mTOR Signaling Pathway. Frontiers in oncology 11: 1015
Dallal MMS, Mojarrad M, Baghbani F, Raoofian R, Mardaneh J, Salehipour Z (2015) Effects of probiotic Lactobacillus acidophilus and Lactobacillus casei on colorectal tumor cells activity (CaCo-2). Archives of Iranian medicine 18: 0-0
Prieto A, Díaz D, Barcenilla H, García‐Suárez J, Reyes E, Monserrat J, San Antonio E, Melero D, de la Hera A, Orfao A (2002) Apoptotic rate: a new indicator for the quantification of the incidence of apoptosis in cell cultures. Cytometry: The Journal of the International Society for Analytical Cytology 48: 185-193
Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, Mueller R, Nolan T, Pfaffl MW, Shipley GL (2009) The MIQE Guidelines: M inimum I nformation for Publication of Q uantitative Real-Time PCR E xperiments. In: Editor (ed)^(eds) Book The MIQE Guidelines: M inimum I nformation for Publication of Q uantitative Real-Time PCR E xperiments. Oxford University Press, City.
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. methods 25: 402-408
Ghanavati R, Asadollahi P, Shapourabadi MB, Razavi S, Talebi M, Rohani M (2020) Inhibitory effects of Lactobacilli cocktail on HT-29 colon carcinoma cells growth and modulation of the Notch and Wnt/β-catenin signaling pathways. Microbial pathogenesis 139: 103829
Dolati M, Tafvizi F, Salehipour M, Movahed TK, Jafari P (2021) Inhibitory effects of probiotic Bacillus coagulans against MCF7 breast cancer cells. Iranian Journal of Microbiology 13: 839-847
Shang F, Jiang X, Wang H, Chen S, Wang X, Liu Y, Guo S, Li D, Yu W, Zhao Z (2020) The inhibitory effects of probiotics on colon cancer cells: In vitro and in vivo studies. Journal of Gastrointestinal Oncology 11: 1224
Isazadeh A, Hajazimian S, Shadman B, Safaei S, Bedoustani AB, Chavoshi R, Shanehbandi D, Mashayekhi M, Nahaei M, Baradaran B (2020) Anti-cancer effects of probiotic lactobacillus acidophilus for colorectal cancer cell line caco-2 through apoptosis induction. Pharmaceutical Sciences 27: 262-267
Ha SZ, Xiang; Yu, Jun (2024) Probiotics intervention in colorectal cancer: From traditional approaches to novel strategies. Chinese Medical Journal 137: 8-20
Zhu Z, Yi B, Tang Z, Chen X, Li M, Xu T, Zhao Z, Tang C (2023) Lactobacillus casei combined with Lactobacillus reuteri alleviate pancreatic cancer by inhibiting TLR4 to promote macrophage M1 polarization and regulate gut microbial homeostasis. BMC cancer 23: 1044
Nakayama S, Karasawa H, Suzuki T, Yabuuchi S, Takagi K, Aizawa T, Onodera Y, Nakamura Y, Watanabe M, Fujishima F (2017) p62/sequestosome 1 in human colorectal carcinoma as a potent prognostic predictor associated with cell proliferation. Cancer medicine 6: 1264-1274
Lei C, Zhao B, Liu L, Zeng X, Yu Z, Wang X (2020) Expression and clinical significance of p62 protein in colon cancer. Medicine 99
Duran A, Amanchy R, Linares JF, Joshi J, Abu-Baker S, Porollo A, Hansen M, Moscat J, Diaz-Meco MT (2011) p62 is a key regulator of nutrient sensing in the mTORC1 pathway. Molecular cell 44: 134-146
Yan J, Xie Y, Si J, Gan L, Li H, Sun C, Di C, Zhang J, Huang G, Zhang X (2021) Crosstalk of the Caspase Family and Mammalian Target of Rapamycin Signaling. International Journal of Molecular Sciences 22: 817
Al-Aamri HM, Irving HR, Bradley C, Meehan-Andrews T (2021) Intrinsic and extrinsic apoptosis responses in leukaemia cells following daunorubicin treatment. BMC cancer 21: 1-10
Ying-Hao Han YW, Seung-Jae Lee, Mei-Hua Jin, Hu-Nan Sun & Taeho Kwon (2023) Regulation of anoikis by extrinsic death receptor pathways. Cell Communication and Signalin 21: 227 doi: 10.1186/s12885-023-11557-z

No competing interests reported.

Download PDF

Reviewers agreed at journal
31 Jul, 2024
Reviews received at journal
20 Jul, 2024
Reviewers agreed at journal
20 Jul, 2024
Reviewers invited by journal
12 Jul, 2024
Editor assigned by journal
10 Jul, 2024
Submission checks completed at journal
10 Jul, 2024
First submitted to journal
09 Jul, 2024

You are reading this latest preprint version

Antiproliferative and apoptosis effect of Lactobacillus acidophilus on HT-29 cells accompanied by subG1 cycle arrest and modulation of mTOR/p62/FAS/Caspase8/Bax pathway

Status:

Version 1

Abstract

Figures

Introduction

Materials and Methods

Culture condition and preparation of supernatant extract

Cell line

In Vitro Cytotoxicity using MTT Assay

Apoptosis Detection

Cell Cycle Analysis

Quantitative Real-Time PCR

Statistical analysis

Results

Flow Cytometry Analysis: LSE trigger apoptosis in HT–29 Cells

LSE induces subG₁ cell cycle arrest

Gene expression analysis of mTOR/p62/Caspase8/Bax apoptosis- related genes modulated by LSE

Discussion

Conclusion

Declarations

References

Additional Declarations

Status:

Version 1

Antiproliferative and apoptosis effect of Lactobacillus acidophilus on HT-29 cells accompanied by subG1 cycle arrest and modulation of mTOR/p62/FAS/Caspase8/Bax pathway

Status:

Version 1

Abstract

Figures

Introduction

Materials and Methods

Culture condition and preparation of supernatant extract

Cell line

In Vitro Cytotoxicity using MTT Assay

Apoptosis Detection

Cell Cycle Analysis

Quantitative Real-Time PCR

Statistical analysis

Results

Flow Cytometry Analysis: LSE trigger apoptosis in HT–29 Cells

LSE induces subG1 cell cycle arrest

Gene expression analysis of mTOR/p62/Caspase8/Bax apoptosis- related genes modulated by LSE

Discussion

Conclusion

Declarations

References

Additional Declarations

Status:

Version 1

LSE induces subG₁ cell cycle arrest