Comparative evaluation of various DNA extraction methods and analysis of DNA degradation levels in commercially marketed Chestnut Rose Juices and Beverages

doi:10.21203/rs.3.rs-4710868/v1

Download PDF

Research Article

Comparative evaluation of various DNA extraction methods and analysis of DNA degradation levels in commercially marketed Chestnut Rose Juices and Beverages

https://doi.org/10.21203/rs.3.rs-4710868/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Background

Food safety is a significant global study subject that is strongly intertwined with human life and well-being. The utilization of DNA-based methods for species identification is a valuable instrument in the field of food inspection and regulation. It is particularly significant for traceability purposes, as it enables the monitoring of a specific item at every level of the food chain regulation. However, obtaining amplifiable genomic DNA in this process is a significant obstacle in gene studies. To date, there is a lack of literature on DNA extraction from processed juice or beverages, and no data exist on simultaneous comparisons of various extraction processes. This study aimed to optimize, assess, and compare four distinct DNA extraction methods for isolating DNA from highly processed Chestnut rose juices or beverages. Furthermore, we also conducted a comparison and analysis of the extent of DNA degradation in Chestnut rose juice or beverage by utilizing the amplicon size.

Methods

The quantity and quality of the extracted DNA were assessed using NanoDrop One spectrophotometer, gel electrophoresis, and real-time PCR assays. An assessment was conducted on the processing time, labor intensity, and cost associated with each approach. The degree of DNA degradation in Chestnut rose juice or beverage was also assessed using TaqMan real-time PCR methods.

Results

It was demonstrated that the DNA was extracted using a non-commercial modified CTAB-based approach, resulting in a high concentration. However, the spectrophotometric results and real-time PCR analysis indicated poor DNA quality. The combination approach showed the greatest performance among the extraction methods, while being comparatively time-consuming and costly in contrast to the other methods. Additionally, the analytical findings of DNA degradation suggested that the integrity of sample DNA could be influenced by the intricacy of processing methods used by various manufacturers.

Conclusions

To achieve precise DNA quantification, selecting suitable extraction strategies for the given matrix is necessary. The combination approach was identified as the most effective DNA extraction technique and is suggested for extracting DNA from Chestnut Rose Juices and Beverages. This comparative assessment can be particularly valuable for extracting and identifying processed Juices and Beverages in a diverse range of food compositions.

food safety

DNA extraction methods

extent of DNA degradation

NanoDrop One spectrophotometer

gel electrophoresis

real-time PCR assays

Chestnut Rose Juices and Beverages

The focus on guaranteeing food quality and safety management has increased due to consumer concerns, corporate strategies, and government policy initiatives. In 1974, the United Nations Food and Agriculture Organization (FAO) raised global awareness for the first time during the World Food Summit by introducing the concept of "food security." Subsequently, nations worldwide placed significant emphasis on the advancement of this domain. In China, the 1995 food safety legislation granted the Ministry of Health the authority to supervise food safety by regulating food labeling, quality, safety, and packaging[1]. Ensuring food traceability from the farm to consumers, employing tests to identify and avoid food safety risks, and maintaining the integrity and quality of new food products are crucial components of a reliable agricultural supply chain management system[2]. Chestnut rose (Rosa roxburghii Tratt), commonly called Cili in China, is a fruit-bearing plant cultivated in the mountainous regions of southwest China. It thrives at elevations ranging from 500 to 2500 meters in provinces such as Guizhou, Sichuan, and Yunnan[3, 4]. Guizhou, which is the primary region for cultivating Chestnut roses in China, has experienced significant growth in this industry. By the end of 2022, the cultivation area has expanded to over 210 thousand hectares. Additionally, the yearly production of Chestnut rose fruit in Guizhou provinces has reached nearly 300,000 tons[5]. Scientists have discovered numerous nutritional and medicinal elements in the fruit, including phenolics, polysaccharides, triterpenoids, superoxide dismutase, proteins, vitamins, ascorbic acid, amino acids, fatty acids, and other organic acids. These components have been proven to possess antioxidant, antiatherogenic, hypoglycemic, anti-aging, and antitumor properties[6, 7]. In recent years, Chestnut rose fruit has been extensively used and harnessed in the food business to produce various types of Chestnut rose juices or beverages, owing to its potential nutritional and functional characteristics[7]. However, processed Chestnut rose juice or beverages are especially susceptible to fraudulent activities due to the market's large size, the great profitability of these items, and the challenges associated with identifying species in processed Chestnut rose products[8]. These fraudulent practices result in financial harm to consumers, and certain types of fraud, such as mislabeling or species substitution, can pose significant health risks (toxicity and allergenicity). Therefore, ensuring the traceability of raw materials derived from the Chestnut rose plant and preventing the adulteration of Chestnut rose in juices or beverages are crucial for safeguarding public health and promoting fair trade.

Currently, several techniques have been utilized to trace and identify the adulteration of processed products. The practice of morphological identification involves sensory assessment of shape, color, odor, and texture[9], as well as microscopic examination of tissue structure and arrangement of raw materials[10]. While these methods may be uncomplicated and inexpensive, their accuracy heavily relies on expertise and proficiency, making it challenging to distinguish between closely related alternatives. Additionally, several protein detection technologies are being utilized, including electrophoresis[11], chromatography[12], and immunology[13]. Furthermore, a range of spectrometric instruments, including high-performance liquid chromatography (HPLC)[14], liquid chromatography-tandem mass spectrometry (LC-MS-MS), nuclear magnetic resonance (NMR)[15], Fourier transform infrared spectrometer (FTIR Spectrometer)[16], and mass spectrometry (MS)[17], are utilized to examine metabolites in the processed products. While these methods were effective in analyzing the components in fruit juice, they were susceptible to various factors such as cultivar, growing region, harvest maturity[18], cultivation practices, storage atmosphere[19], climate, storage conditions[20], processing[21], and shipping[22], which could impact the accuracy of species identification[23]. In contrast, the PCR techniques, which are based on DNA, offer a viable alternative because of their exceptional sensitivity and specificity. These techniques enable the identification of minuscule quantities of DNA in raw materials and processed foods. DNA amplification methods are increasingly becoming recognized as valuable approaches in the field of food inspection and regulation. These methods are not only capable of detecting different species in fruit juice[24, 25] but also identifying instances of food adulteration[26, 27]. Their potential is vast and inspiring, promising a new era in food inspection and regulation and instilling hope for a safer and more authentic food supply.

However, the effectiveness of DNA amplification methods relies on the efficacy of DNA extraction protocols, which should yield a substantial amount of high-quality DNA. In addition to being efficient, appropriate extraction methods should also be user-friendly, economical, and time-saving. Ideally, these methods can be applied universally to minimize the need for several extraction procedures and calibrations in Real-time PCR, DNA quantification following gel electrophoresis, or spectrophotometric quantification. Undoubtedly, the utilization of PCR relies on the isolation of DNA from diverse dietary substances, which is frequently the most crucial stage. It is important to acknowledge that the quality of DNA extracted from food samples is influenced by various factors. These include the presence of PCR inhibitors such as polysaccharides, polyphenols, and proteins in the food matrices[28], as well as DNA polymerase inhibitors like tannins, alkaloids, and polyphenols[29]. The quality is also influenced by the extent of DNA damage, such as depurination, and the average length of the nucleic acid fragments obtained[30]. These aspects rely on the sample itself, the procedures used during food preparation, and the physical and chemical parameters of the extraction method employed. To be more precise, the presence of complex matrices in Chestnut rose juice or beverages, as mentioned beforehand, can hinder the amplification of isolated DNA. In addition, Chestnut rose juice or beverages have often undergone several processing stages, including mechanical, thermal, chemical, or enzymatic treatment, which have impacted the integrity of DNA. Once again, DNA exhibits a high susceptibility to acid due to the process of hydrolytic destruction. A comprehensive analysis using UFLC/Q-TOF-MS has identified a total of 13 organic acids in Chestnut rose fruit, including ascorbic acid, malic acid, lactic acid, gallic acid, citric acid, p-coumaric acid, protocatechuic acid, syringic acid, 9,12,15-octadecatrienoic acid, p-hydroxybenzoic acid, caffeic acid, and 9,12-octadecadienoic acid[31]. The acidity present in fruits enhances the pace of acid-catalyzed reactions during heat treatments[32]. Moreover, the Chestnut rose juice or beverages underwent a packaging and canning process that involved various thermal procedures and pressure application before being introduced to the global market. The filling medium is also recognized as the main cause of DNA degradation in canned food products[33]. Therefore, there is an urgent need for improved and efficient DNA extraction methodologies and more accurate methods to assess the quantity and quality of the extracted DNA and ensure the safety and authenticity of our food supply.

Numerous methods are available for extracting DNA, but only a few can be utilized to isolate DNA from processed food products, particularly in fruit juices or beverages. In addition, there has been limited comparison of various existing DNA extraction procedures in a comprehensive manner. In this current undertaking, the purity, quality, and quantity of DNA extracted from Chestnut rose juice or beverages were compared using two regularly used commercial methods, one non-commercial method, and one combined DNA extraction method. In particular, the quantity of isolated DNA was assessed using a nanodrop spectrophotometric technique. To assess the level of amplification of the isolated DNA, we conducted a conventional PCR and Real-time PCR (RT-PCR) analysis using specific primers for a nuclear ribosomal gene ITS2, which is specific to the Chestnut rose. In addition, we also critically assessed the handling technique, time consumption, expenses per preparation, and the convenience of establishing the extraction procedures in our laboratory. Furthermore, the degree of DNA degradation in Chestnut rose juice or beverage was measured using PCR amplification with primers that yielded amplicons of various sizes. This study will offer data support for identifying species in fruit juice and detecting adulterations in processed food.

Samples

This study collected individual samples from five Chestnut Rose Juice or Beverage producers located throughout Guizhou province. These samples were used to evaluate the DNA extraction methods described next. Table 1 lists the names, brief descriptions, brands, and manufacturers concerning each sample. We marked these five Chestnut Rose juice or beverages as C1, C2, C3, C4, and C5, respectively. The samples were kept at 4°C before processing for DNA extraction, marked as sample “C1”, “C2”, “C3”, “C4” and “C5”, respectively.

Table 1

Characteristics of the sample materials used in the study.
Sample Group	Description(content)	Sample ID	Manufacturer	Brand
Chestnut rose juice	100% Chestnut rose juice	C1	Guizhou Guiding Min Zi food Co., LTD	Cunzhangtuijian
Chestnut rose juice	100% Chestnut rose juice	C2	Guizhou Chuhao agricultural science and technology development Co., LTD	Chuhao
Chestnut rose juice	100% Chestnut rose juice	C3	Guizhou Hengmaoyuan Biotechnology Co., LTD	Fulangguo
Chestnut rose juice	100% Chestnut rose juice	C4	Guizhou Sanwongkwo Healthy Industry Co., LTD	Shanwangguo
Chestnut rose beverage	30% Chestnut rose juice	C5	Guizhou Hongcaijunong Investment Co., LTD	Ciliwang

DNA extraction methods

Total DNA was extracted from these samples using four distinct DNA extraction methods. Three repetitions of each sample were run to test the reactions' repeatability. In the analysis, two kits that were readily accessible on the market were used: Plant Genomic DNA Kit (abbreviated as PG) and Magnetic Plant Genomic DNA Kit (abbreviated as MPG) (TianGen™, Beijing, China). One previously published non-commercial method was also evaluated: the CTAB-based method (‘‘CTAB”)[34], which has been modified in our laboratory (abbreviated as MC). In addition, one combination of approaches was used in the evaluation: isopropyl alcohol precipitation combined with Processed Food DNA Extraction Kit (abbreviated as IPF) (TianGen™, Beijing, China). The four DNA extraction methods that were used for this investigation are listed in Table 2 along with their key features. All DNA extracts were suspended in a final volume of 50 µL elution buffer, and all extractions were carried out by a single individual in order to fairly assess and compare the performance of these extraction techniques.

Table 2

Key characteristics of the four selected DNA extraction procedures used in this study.
	Extraction protocol	Kit name abbreviation	Cell lysis	Extraction buffer	Elution buffer	DNA purification	Special advantages
Noncommercial method	Modified CTAB method	MC	CTAB	20g/L CTAB、1.4 mol/L NaCl、0.02 mol/L EDTA(pH8.0)、0.1 mol/L Tris-HCL(p H8.0)	50 µL TE (pH 8.0)	Isopropanol	economical; widely used
Commercial methods	Plant Genomic DNA Kit	PG	CTAB	700 µL 65°C preheated GP1 and 0.1% β-mercaptoethanol	50–200 ul TE	Spin Columns CB3	fast; simple; convenient; widely used
Commercial methods	Magnetic Plant Genomic DNA Kit	MPG	SDS, RNase A	400 ul buffer GPM and 5 ul RNase A (10 mg/ml)	50–100 ul TB	Isopropanol/MagAttract Suspension G	rapid and convenient
Combined method	isopropyl alcohol precipitation combined with Processed Food DNA Extraction Kit	IPF	Proteinase K, SDS	500 ul buffer GMO1 and 20 ul Proteinase K (20 mg/ml)	20–50 ul TE	Isopropanol	safe; convenient; excellent scalability and flexibility

Commercial method

For DNA extraction with PG and MPG methods, the samples (2 mL of juice or 5 mL of the beverage) were centrifuged at 12000 rpm for 5 minutes, and the supernatant was discarded. The deposit was managed according to the manufacturer's usual procedure.

Noncommercial method

The MC approach has three primary stages: sample extraction, DNA purification, and DNA precipitation.The genomic DNA extraction process involved pretreating samples (2 mL of juice or 5 mL of the beverage) using the following methods. The supernatant was transferred, and the sediment was combined with 700 µL of 2×CTAB extraction buffer (containing 20g/L CTAB, 1.4 mol/L NaCl, 0.02 mol/L EDTA at pH 8.0, and 0.1 mol/L Tris-HCL at pH 8.0). The mixture was vortexed for 10 to 20 seconds to disperse any clumps, followed by incubation at 65°C for one hour. The tube was then repeatedly inverted multiple times to ensure thorough mixing. Subsequently, an equivalent amount of a water-saturated mixture containing phenol, chloroform, and isoamyl alcohol in a ratio of 25:24:1 was introduced. The resulting solution was well mixed using vortexing and then subjected to centrifugation with a force of 12,000 times the acceleration due to gravity for a duration of 5 minutes. After that, the organic phase was disposed away, while the aqueous phase underwent a further extraction with 700µL of trichloromethane using identical procedures. The supernatant was collected and combined with an equal volume of isopropyl alcohol. The mixture was thoroughly mixed and then stored in a refrigerator at a temperature of -20 ℃ for a duration of 1 hour. Following this, the mixture was subjected to centrifugation at a speed of 12000 revolutions per minute for a duration of 5 minutes. The liquid portion above the sediment was removed, and the sediment was rinsed with 700 µL of 75% ethanol. The mixture was then stirred for 5 seconds using a vortex mixer and centrifuged at a speed of 12000 revolutions per minute for a duration of 2 minutes. The ethanol solution was carefully discarded, and this washing process was repeated. Finally, the cap was then opened, and the remaining ethanol solution was allowed to completely evaporate. The sediment was subsequently dissolved in a 50µL solution of TE (pH 8.0) and stored at a temperature of -20 ℃ for future use.

Combined method

The last one, the MC approach, has been adapted in our laboratory in the following manner: A volume of 2 mL of juice or 5 mL of the beverage was subjected to centrifugation at a speed of 10,000 revolutions per minute for a duration of 15 minutes. The resulting supernatant was discarded, and subsequently, 1 mL of a Tris.Cl buffer with a concentration of 0.1 M and a pH of 8.0 was added to these samples. This washing step was repeated three times, with each cycle involving vortexing to ensure thorough mixing, followed by centrifugation at 10,000 rpm for 15 minutes. After discarding the supernatant, the resulting precipitate was deemed suitable for further use. A total of 500 µL of Buffer GMO1 and 20 µL of Proteinase K (20 mg/ml) were introduced to the previously treated samples. The mixture was vigorously vortexed for a duration of 1 minute, followed by an incubation period at 56°C for 1 hour. Throughout this incubation, the samples were periodically shaken every 15 minutes. Subsequently, 200 µL of Buffer GMO2 was introduced and subjected to vortexing for a duration of 1 minute. The resulting samples were then maintained at ambient temperature (15–30°C) for a period of 10 minutes. Following centrifugation at a speed of 12,000 revolutions per minute (equivalent to approximately 13,400 times the force of gravity) for a duration of 5 minutes, the liquid portion devoid of sediment, known as the supernatant, was carefully transferred to a fresh centrifuge tube. Then, a volume equivalent to 0.7 of the supernatant was supplemented with isopropanol and thoroughly mixed using a vortex. In this experimental procedure, the mixing pre-cooling step was conducted at a temperature of -20 ℃ for a duration of 1 hour to induce the precipitation of DNA. The mixture underwent centrifugation at a speed of 12,000 revolutions per minute (equivalent to approximately 13,400 times the force of gravity) for a duration of 3 minutes, after which the supernatant was removed. Then, the manufacturer’s protocol was followed.

Spectrophotometer measurements

DNA concentration and quality were evaluated through various extraction approaches using UV-Vis spectroscopy, specifically with the NanoDrop One Thermo-Scientific spectrometer. The assessment of protein contamination was conducted by determining the ratio of absorbance at 260 nm to that at 280 nm. Similarly, guanidine contamination was assessed by calculating the absorbance ratio at 260 nm to that at 230 nm. Each experimental trial was conducted with a sample volume of 1 µL, and the elution buffers employed were either commercially available kits or sterile double-distilled water (dd H₂O), which served as the control.

PCR amplification

The internal transcribed spacer 2 (ITS2) of nuclear ribosomal DNA is widely utilized as a DNA marker in plant phylogenetic and DNA barcoding studies. It is highly suggested as a fundamental plant DNA barcode [35]. The researchers created and employed species-specific primers (forward primer F94: 5'- CACGACAATCGGTGGTTGTCA-3'; reverse primer R: 5'-GCATCGACGGATCGACACGTAT-3') targeting the DNA sequences of the ITS2 gene (Genbank Accession No. FJ358704, MH711604) in the Chestnut Rose. This approach amplified a PCR product of 94 base pairs in length. The DNA sequences were evaluated using the Blastn program, a similarity search tool provided by the National Centre for Biotechnology Information (NCBI) (http://blast.ncbi.nlm.nih.gov/Blast). This analysis validated the anticipated specificity of the primers following theoretical expectations. Subsequently, the primers were employed to amplify the DNA isolated from all matrices using all the investigated procedures. To assess the rate of DNA degradation in commercially available Chestnut Rose juice and beverages, we employed a universal reverse primer positioned in the downstream region of the ITS2 gene. Additionally, we utilized four different forward primers located in various upstream regions to generate DNA fragments of specific lengths, including 186 bp, 301 bp, 449 bp, and 500 bp. The primers were designed using SnapGene (version 7.0.2) software. The oligonucleotides were produced and refined by Beijing Tsingke Biotech Co., Ltd., a company specializing in biotechnology. Table 3 provides the primer sequences, annealing conditions, and amplicon size.

Table 3

Primers and probe specific for Chestnut rose juice and beverage.
Target	Primer and probe names	Sequence (5’–3’)	Annealing temp (°C)	Amplicon length (bp)
ITS2	F94	CACGACAATCGGTGGTTGTCA	57.57	94
	F186	TCGGGAGTTGGATGGGACG	59.48	186
	F301	CTTGGTGTGAATTGCAGAATCC	55.81	301
	F449	CCAAGGAACTTGAATGAAAGAGC	55.99	449
	F500	CTTGCGCTTGATCGACCCTC	59.5	500
	R	GCATCGACGGATCGACACGTAT	59.54
	P	FAM-AGAAAGCACTCGATCAACACGAGCG- BHQ	62.2

For polymerase chain reaction (PCR) analysis, reaction mixture was performed in a 25 µL reaction volume containing 12.5 µL of 2 × Taq PCR MasterMix (Solarbio Biotech, Beijing, China), 0.5 µL of each primer (10µmol/L), 2.0 µL template DNA, and 9.5 µL ddH₂O. The polymerase chain reaction (PCR) was conducted using the Veriti 96-Well Thermal Cycler. The process of DNA amplification was conducted utilizing the subsequent conditions: an initial denaturation step at a temperature of 94°C for a duration of 2 minutes, followed by 35 cycles consisting of denaturation at 94°C for 30 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 30 seconds. The amplification process concluded with a final extension step at 72°C for 2 minutes (Table 4). A PCR control was conducted using distilled water in place of DNA during the PCR reaction in order to assess and monitor any contamination in the PCR reagents. Following the process of PCR amplification, a volume of 5 µL was extracted from each PCR product and combined with an equal volume of DL500 DNA marker (manufactured by TaKaRa, Kyoto, Japan). This resulting mixture was subsequently loaded onto a 3.0% agarose gel. The gels were electrophoresed in a 1× TAE buffer supplemented with GoldView I nuclear staining dyes (Solarbio, Beijing, China) for a duration of 25 minutes at a voltage of 130 V.

Table 4

PCR programme for amplification of all used genes.
	Step		Temperature	Time
PCR	Initial denaturation		94°C	2 min
	35cycles	Denaturation	94°C	30 s
		Annealing	58°C	30 s
		Extension	72°C	30 s
	Final extension		72°C	3 min
	Cooling		4°C	∞
qPCR	UDG enzyme actiton		37°C	120 s
	Prenaturation		95°C	1 min
	40cycles	Denaturation	95°C	10 s
	40cycles	Annealing/Extension	60°C	20 s

Real-time PCR

This study also designed a real-time polymerase chain reaction (PCR) assay to target the internal transcribed spacer 2 (ITS2) region. This assay aimed to evaluate the presence of amplifiable DNA in extracts derived from Chestnut Rose samples. The sequences of primers mentioned above and probes employed are documented in Table 3. 5′-Ends of the probes were labeled with the reporter dye FAM (6-carboxyfluorescein), and 3′-ends were coupled to the black hole quencher I (BHQ I). The qPCR amplification was conducted using 96-well plates and analyzed using a LightCycler® 96 system manufactured by Roche in Germany. The polymerase chain reaction (PCR) reaction mixture was conducted with a final volume of 20 µL. This mixture consisted of 10 µL of 2 × TOROIVD® 5G qPCR Premix with UNG, 2 µl of the DNA sample, 0.5µL of each primer (10µM), 0.2µL of the specified probe (10µM), and ddH2O was added to reach a total volume of 20 µL. Standard cycling conditions included a UDG enzyme action at 37°C (120s) and a Prenaturation step at 95°C (1 min), followed by 40 cycles of denaturation at 95°C (10 s), annealing/ extension at 60°C (20 s). The experimental protocol involved conducting a series of cycling steps under standardized conditions. These conditions encompassed the activation of a UDG enzyme at a temperature of 37°C for a duration of 120 seconds, as well as a pre-denaturation phase at 95°C for a period of 1 minute. Subsequently, a total of 40 cycles were performed, each consisting of denaturation at 95°C for 10 seconds, followed by annealing and extension at 60°C for 20 seconds. Table 4 presents the Polymerase Chain Reaction (PCR) protocol employed for amplifying all the genes utilized in the study. In addition, positive controls were utilized by extracting DNA from the fruit of the Chestnut Rose plant. Distilled water was utilized as a control without the presence of a template. Fluorescence levels were assessed after each cycle. The Ct values acquired during the procedure evaluated the amplifiable DNA quantity obtained. In this context, smaller values are considered preferable.

Economic evaluation

An assessment was also conducted of each extraction approach in terms of the time and money required and the complexity of its operation. The necessary duration was determined by adding the times required for each protocol stage, such as centrifugations and incubations. The allocation of funds for the comprehensive analysis was determined in light of the current expenses for consumables and reagents in China (see Table 1 for the column ‘‘Reagents and consumables”). Concurrently, these computations were performed on four extracted samples. In the course of the comparison, the material prices for each method were also computed.

Statistical analysis

The experimental data for the various DNA extraction procedures were evaluated using a general linear model procedure, following the Psifidi et al. [36] model with certain changes. Each criterion for DNA evaluation (DNA Yield, two spectrophotometer measurements, real-time PCR findings) was evaluated individually. We conducted a more stringent statistical analysis, wherein, if the data failed to conform to a normal distribution, we attempted a logarithmic modification of the data to align it more closely with a normal distribution.

Y _ij = P_i + e_ij + µ + q_j (Model)

where Y_ij = DNA score by assessment criterion for the j^th sample of the i^th extraction procedure, P_i = effect of the i^th DNA extraction procedure (i = 1,…,4), e_ij = random residual, µ = overall mean, q_j= effect of the j^th sample.

Post-hoc analyses were conducted using least squares mean tests and a Bonferroni adjustment for multiple testing to compare various DNA extraction procedures for each evaluation criterion. A significance level of p < 0.05 was deemed as statistically significant. All analyses were conducted using IBM SPSS Statistics 20 (IBM, New York, NY, USA) and GraphPad Prism 5 (GraphPad Software, Inc., La Jolla, CA, USA).

Quality and concentration of the DNA extracted

The mean values of DNA Yield and absorbance ratios (A260/A280 and A260/A230), which reflect DNA purity and concentration, are displayed in Table 5 along with statistical comparisons. According to the DNA yield statistics, the combined method, namely, the IPF extraction method, yielded the largest DNA amounts from most given samples, with the non-commercial method (MC extraction method) coming in a close second. While the difference between the two approaches was not statistically significant (p > 0.05), both resulted in significantly higher DNA concentration compared to the commercial methods (PG and MPG) created protocols (p < 0.05).

Table 5

Evaluation and Comparison of genomic DNA concentration, purity and real-time PCR parameters (Ct value) obtained from different sample groups with the different extraction methods (MC: Modified CTAB method, PG: Plant Genomic DNA Kit, MPG: Magnetic Plant Genomic DNA Kit, IPF: isopropyl alcohol precipitation combined with Processed Food DNA Extraction Kit); Values are given as mean value ± standard deviation of triplicates.
Extraction method	DNA Yield¹ (ng/µL)	A260/A280²	A260/A230^1,2	Ct value³
MC	122.01 ± 29.3^a	1.57 ± 0.09^a	1.99 ± 0.09^a	25.83 ± 1.36^b
PG	14.26 ± 3.43^b	1.72 ± 0.19^a	1.43 ± 0.12^b	26.24 ± 1.40^b
MPG	11.23 ± 1.48^b	0.99 ± 0.07^b	0.54 ± 0.05^c	27.84 ± 1.25^a
IPF	187.62 ± 34.6^a	1.74 ± 0.08^a	2.14 ± 0.11^a	22.7 ± 1.60^c
¹ The ideal values are higher values.
² A260/A280 and A260/A230 are ratios of absorbances measured at 260 nm and 280 nm, and at 260 nm and 230 nm, respectively.
³ The ideal values are lower values.
^a,b,c,d Comparison of each column's values; Values with the same superscript differ from one another significantly (p < 0.05) but not statistically (p > 0.05) from values with different superscripts.

Based on the 260/280 nm ratio findings, it is important to note the significant discrepancy in purity data acquired from various analytical procedures. Specifically, we found that the IPF approach produces high-quality DNA in the samples. The same data was also acquired using the PG extraction method. In comparison, the other techniques yield DNA of mediocre or subpar quality. The A260/A230 ratios were obtained to assess contamination levels from salts, peptides, and polysaccharides. The results presented in Table 5 support the validity of the IPF extraction method, showing the highest values. Other procedures cannot eradicate contaminating compounds.

Gel electrophoresis of the DNA extracted

Crude DNA was evaluated for its suitability in PCR applications using particular primers ITS2 F94/R and then analyzed using agarose gel electrophoresis (Fig. 2). Overall, the intense amplicons were detected in samples C1 and C2 (lanes 1 to 8), than in samples C3 and C4 (lanes 9 to 16), with sample C5 (lanes 17 to 20) being the lowest in the list. Gel electrophoresis showed that the IPF extraction procedure effectively produced high-quality PCR results from four Chestnut Rose Juice samples (lanes 4, 8, 12, and 16). There is weak smearing due to excessive loading or high concentration of crude DNA extract. However, the PCR amplicons still displayed higher image intensities for C2-C4 samples than other extraction methods, suggesting the superior quality of the DNA extracts, which aligns with the DNA yields and quality obtained (Table 5). The gel image of DNA products from the other three procedures exhibited varying quality across distinct samples. Procedure PG (lane 2, 6, 10 and 14) yielded DNA products of comparable quality to procedure IPF, but the visible DNA bands were more vague and less distinct than sample C3 (lane 11). In addition, DNA extracted using the MC and MPG methods yielded relatively satisfactory amplification results in the small sample sizes of C1 and C2. Finally, sample C5 is a highly processed product with a limited amount of raw material, and the gel image did not reveal clear and distinct bands for all the extraction procedures, so validation using Real-time PCR analysis is necessary.

Real-time PCR of the DNA extracted

The Real-time PCR analysis findings for four extraction methods from five samples are presented in Supplement Fig. 1. Surprisingly, DNA amplification was achieved for all samples utilizing all four techniques. Lower Ct values are preferable since they indicate higher levels of amplifiable DNA. The Ct analysis conducted on the positive RT-PCR amplifications revealed that Chestnut Rose juice samples (C1 to C4) generally exhibited lower values than highly processed beverage items, such as sample C5. The ANOVA test was utilized to assess the significance of variations among the real-time PCR Ct values acquired using the four procedures (Table 5). The IPF extraction method yielded the lowest average Ct value, which was significantly superior to the other extraction procedures (p < 0.05). Additionally, no statistically significant changes were determined between the MC and PG extraction methods. It was predicted that the MPG extraction method had the worst performance among all the procedures in the present analysis, which is consistent with the preceding description.

Economic, labor, and time assessments of the DNA extracted

An analysis was also conducted to compare the various DNA extraction approaches' material costs, labor requirements, and throughput time (Table 6). The amount of manual labor needed to extract DNA was virtually identical for all four protocols, and each protocol was straightforward and uncomplicated to adhere to. DNA extraction times varied from 56 to 217 minutes across different methods. The Commercial methods (PG and MPG extraction procedures) were the shortest, taking 56 minutes. The MC and IPF extraction processes utilized the isopropyl alcohol precipitation protocol, resulting in DNA extraction times of 163 and 217 minutes, respectively. Finally, significant disparities were observed in material costs when comparing the strategies utilized in this investigation. As anticipated, the costly techniques were the MPG extraction method, followed by the PG and IPF extraction methods. By contrast, The MC extraction method was the most cost-effective, priced at 3.53¥per sample.

Table 6

Estimation of the labour intensity, time and material budgets required for each extraction procedure.
Extraction protocol	Time (min)	Labour requirements (¥)	Reagents and consumables^*(¥)	Estimated price per kit^** (¥)	Total cost per sample(¥)
MC	163	"++"	3.53	/	3.53
PG	56	"+"	3.24	¥420 for 50 preps,¥1500 for 200preps	10.74 ~ 11.64
MPG	56	"+"	1.79	¥760 for 50preps,¥2880 for 200 preps	16.19 ~ 16.99
IPF	217	"+"	1.82	¥1200 for100 preps	13.82
* Reagents and consumables include chemicals, gloves, tubes, tips, etc. **The data is provided by the manufacturer. (+) easy; (++) difficult

Evaluation of DNA degradation degree

The maximum size of PCR products that could be amplified indicated the extent of DNA degradation caused by processing. The specific primer pairs for the ITS2 gene successfully amplified fragments of 94, 186, 301, 449, and 500 base pairs (Table 3). Figure 3 displays the largest amplicons obtained from analyzing DNA recovered from marketed Chestnut Rose Juices and Beverages using the IPF extraction methods. All samples yielded a 94-base pair amplicon from the extracted DNA. However, a 500 bp fragment was only found from DNA extracted in specific samples C2 and C4, suggesting that the DNA integrity was influenced by the processing complexity of different manufacturers.

The extraction of DNA from food products is a significant accomplishment, especially when considering the various forms of industrial processing they have undergone. Utilizing a single dependable technique for DNA extractions and PCR amplification along the entire juice and beverage supply chain holds potential benefits in several scenarios, such as industrial quality control, for identifying deceit and contamination. Enhancing national and international legislation regarding the trading and selling of dairy products will also be advantageous. This current investigation conducted a comparative analysis of four extraction methods to establish a foundation for making informed judgments on choosing an appropriate extraction method for a particular sample.

Determination of the appropriate extraction method and selection of samples to be used

After evaluating various DNA extraction procedures for the highly processed samples, we found that the separation and purification stage is essential for efficient DNA extraction. This was further validated by additional research[32]. Therefore, we chose four distinct extraction methods that offer various cell lysis treatments, including chemical, enzymatic, and/or mechanical approaches.

The CTAB (cetyltrimethylammonium bromide)-based method was used for this investigation due to the inclusion of CTAB, a positively charged surfactant, in the DNA extraction buffer, which effectively separates and selectively isolates DNA from histone proteins[37]. It has been widely acknowledged as the most reliable and accurate method. It is commonly employed for extracting DNA from different types of plant materials, particularly in highly processed food samples[38, 39]. The CTAB procedure in our laboratory was performed according to the protocol outlined by Andreas et al.[40] with certain modifications. We employed a combination of phenol, chloroform, and isoamyl alcohol (in a ratio of 25:24:1) to eliminate protein contaminants, facilitate the separation of liquid and organic phases, and eliminate the formation of bubbles during the extraction process. In addition, the isopropyl alcohol was subjected to a cold treatment to cause the DNA to separate from the protein, hence minimizing DNA degradation and facilitating their separation. The Plant Genomic DNA Kit was selected as one of the primary spin column-based methods in the current study. Scientists have discovered that spin column-based protocols are suitable for extracting DNA from potato products containing 84 bp DNA fragments[41]. Furthermore, commercial spin column extraction kits are more efficient than standard precipitation methods for extracting DNA from processed foods. The spin column effectively captures fragmented and degraded DNA on the resin membrane, while the chaotropic salts effectively remove PCR inhibitors[42]. We selected the Magnetic Plant Genomic DNA Kit based on the findings of Holden et al.'s [43] study. They confirmed that techniques using DNA binding to a solid matrix, such as silica gel or magnetic particles, yielded superior results for PCR amplifications compared to selective precipitation methods when applied to ground corn. In particular, The Processed Food DNA Extraction Kit is a specialized DNA purification kit produced by the manufacturer TIANGEN specifically for extracting DNA from raw food materials and processed food. It was suggested because it can effectively eliminate impurities proteins, lipids, and other organic substances. In addition, we implemented alterations to the previous procedure and included the previously mentioned phase of treating with isopropyl alcohol at low temperatures.

The makeup of the sample may provide difficulties for a DNA extraction method. Defining a matrix in food analysis is challenging due to the variability in composition and presence of diverse components that can impact the performance of PCR, even when comparing products made using different processes. The laboratory seldom receives comprehensive compositional data on the products. Hence, we selected five distinct commercial samples to encompass a wide range of potential problems with DNA extraction and a diverse array of matrix complexities. In our study, four distinct extraction methods exhibited varying levels of DNA extraction efficacy. Therefore, we have determined that the effectiveness of DNA extraction is not solely reliant on the characteristics of the sample but also on the specific process used for extracting the DNA. This conclusion was further corroborated by prior research[44].

Evaluation of the extraction method

The assessment was conducted using spectrophotometer measurements, gel electrophoresis experiment, and real-time PCR Ct values. The three spectrophotometer measurements, namely yield, ratios of 260/280 and 260/230 nm, were preliminarily employed for assessing the quality of DNA. Significant quantities of DNA obtained from the identical sample material are deemed satisfactory, with the ratios falling between 1.7 and 1.9 for 260 nm/280 nm and beyond 2.0 for 260 nm/230 nm being considered acceptable for pure DNA. Reducing the matrix effect by using analogous samples allows us to ascribe the changes in the data to the influence of the extraction procedures. Based on these criteria, only one method, which involved combining isopropyl alcohol precipitation with the Processed Food DNA Extraction Kit (referred to as IPF), proved to be highly effective in the current investigation. The disparities between the IPF extraction method and other methods can be ascribed to the unique buffer system, preprocessing phase, and Isopropyl alcohol cold treatment processes. To prevent low efficiency of DNA extraction caused by a pH value that is too low, the samples extracted by the IPF method were pretreated three times with Tris.Cl buffer (pH 8.0), as recommended by the manufacturer. Furthermore, Isopropyl alcohol was employed to precipitate DNA by subjecting it to cold treatment for a duration of one hour to maximize the yield of DNA. These measures can be beneficial in obtaining elevated quantities of genomic DNA from all the analyzed products. Regrettably, the chemical factors contributing to the effectiveness of this method cannot be assessed due to the undisclosed nature of the other components in the kit, as provided by the manufacturer.

Regarding the case of highly processed foods, it is possible that significant gene sections cannot be amplified due to structural damage to the DNA. Visualizing the crude DNA on agarose gel alone may lead to incorrect conclusions when assessing the DNA integrity in this particular situation. Therefore, comparing the level of amplifiable endogenous genes among many extracts from the same sample remains a valuable strategy for evaluating extraction techniques. Nevertheless, the level of amplification determined using this method is affected not only by the amount of DNA obtained in the extract but also by the quality of the template DNA. In this context, in contrast to agarose gel visualization of conventional PCR products, real-time PCR demonstrated a distinct signal in all isolated DNA samples, even the highly processed sample C5. This indicated a remarkable sensitivity, specificity, and dependability level, which aligns with earlier research findings[45–47]. The Ct values obtained from real-time PCR directly indicate the suitability of the extracted sample for molecular investigation. Nevertheless, the Ct values were significantly impacted by PCR inhibitors that were present in the samples and were co-extracted during the various DNA extraction techniques. These inhibitors might potentially disrupt the RT-PCR amplification process, leading to a potential delay in the Ct values or even a full failure of the reaction.

According to real-time PCR Ct measurements, most attention was focused on the results of method IPF, which gave more positive results and made evaluating the different extraction procedures easier. The IPF method was also easily scalable, which may be an important advantage for a difficult matrix such as beverages. Due to the absence of literature references about this method, we could not carry out a comparison analysis. Compared to the IPF extraction method, the noncommercial MC method, specifically the modified CTAB-based approach, yielded higher quantities of DNA in the extracted samples. However, the real-time PCR performance of these samples was relatively poor, suggesting the presence of inhibitors. The inhibitors can come from studied substances, such as proteins, polysaccharides, lipids, and polyphenols[48–50]. In addition, the chemicals utilized in the DNA extraction process, including cetyltrimethylammonium bromide (CTAB), EDTA, phenol, chloroform, ethanol, and isopropanol, have the potential to hinder the PCR reaction by inhibiting the Taq polymerase[40, 51–53]. Furthermore, many researches indicated that an extensive array of salts, sugars, and other substances commonly employed in buffer solutions can further diminish the performance of PCR[52, 54, 55]. To address this issue, some researchers have utilized post-DNA extraction methods to enhance the purity of DNA. The methods encompass enzymatic treatments[56], solvent precipitation, and chromatographic or electrophoretic separation[57]. Further purification leads to more effective elimination of PCR inhibitors, resulting in a greater yield of amplification products, assuming that the initial quantity of target DNA is adequately high. Our strategy was not adhered to due to the potential loss of DNA during the purification process, which could destroy samples containing tiny amounts of DNA, such as beverages. It is worth mentioning that the Plant Genomic DNA Kit (abbreviated as PG) successfully removed PCR inhibitors, as described previously. However, this occurred at the cost of reduced yield, since a significant amount of DNA was lost during the column purification process. Consequently, the overall sensitivity of the study was compromised. Evidently, the outcome was confirmed by the observation that the PG approach consistently yielded higher Ct values than the noncommercial MC method. While statistical significance was not achieved (Table 5), the Ct value disparities between the commercial PG and noncommercial MC methods are still deemed substantial. This is because a one-cycle variation in the Ct value corresponds to doubling the DNA quantity[36]. This finding also indicated that the total amount of DNA obtained was the primary factor affecting the level of detectable endogenous genes in extracts of highly processed foods, which is consistent with a prior study[41]. Finally, it is worth noting the commercial method called Magnetic Plant Genomic DNA Kit (MPG), which, despite yielding DNA with low concentrations and less than ideal purity compared to other methods, still allowed for clear amplification curves with real-time PCR for all the samples in the experiment (Supplement Fig. 1). Researchers have successfully employed this magnetic particle-based technique to isolate DNA from ground corn and maize foodstuffs samples for real-time PCR analysis[43, 58]. The suboptimal performance seen in our study may be attributable to the specific food matrix and product variations from different manufacturers.

Economic evaluation and the assignability across the four procedures

In the field of analytical molecular biology, the process of extracting nucleic acids generally involves making a compromise between achieving high quality and minimizing expenses. Procedures that result in fewer expenses for analyzing the substance generally have worse quality, which might negatively affect the analysis. On the other hand, procedures that produce a highly qualitative analyte often do so at the cost of the economy. While the two commercial kits proved to be the fastest and simplest to perform, the overall expenses per sample were quite high. The reason for this could potentially be explained by the utilization of nucleic acid-binding resins or magnetic particles in these methods. Furthermore, the yield or purity of the extracted DNA using these two methods exhibited poor performance, posing a significant obstacle for samples containing low DNA concentrations. Compared with other methods, the noncommercial MC method was the most cost-effective regarding supplies. However, it was also time-consuming as it included many transfers between tubes. Transferring samples in a diagnostic environment can lead to a higher risk of cross-contamination. Indeed, we also acknowledged the fact that this approach yielded substantially higher amounts of DNA from all the provided samples. Regarding the combined IPF approach, the processing time is mostly dedicated to sample preparation and cold treatment using isopropyl alcohol to precipitate DNA, resulting in the longest duration. Nevertheless, the entire procedure is straightforward and effortless to operate. Likewise, we also noticed that while the approach cost was about four times higher than the noncommercial MC method, it fell within the price range of PG and MPG in the commercial kit, positioning it at a reasonable level. Regardless, this method demonstrated outstanding performance in extracting DNA from Chestnut Rose Juices and Beverages. It could be readily expanded to handle more difficult samples, particularly those from highly processed foods with a very low pH value.

In light of the aforementioned considerations, we needed to evaluate the assignability of the extraction techniques to various samples of juices and beverages. Due to the enormous variation in the composition and diversity of highly processed food samples, we should have focused on developing improved DNA extraction methods specifically for juices and beverages. This is particularly important for samples with higher levels of acidity. In summary, we established an order for the assignability of the four procedures based on the aforementioned criteria as follows: IPF ≥ MC ≥ PG ≥ MPG. Each of the four extraction processes has distinct benefits and slight drawbacks. To achieve specific study objectives, it is advisable to meticulously choose the necessary extraction process. If a cost-effective and productive approach is needed specifically for qualitative research, the MC technique would be the preferable choice. In contrast, the IPF approach is appropriate for extracting superior quality DNA, which is essential for precise quantitative analysis.

Evaluation of DNA degradation in chestnut rose juices or beverages.

Due to increasing customer demand and technological advancements, various types of processed food products have gained more popularity than fresh produce. This case also contributes to the traceability of food goods, which is crucial for ensuring public health and promoting fair trade. Fraud detection analyses' effectiveness depends on the quality, yield, and degradation level[59], with DNA degradation being a significant issue that can lead to interruptions in species identification and food traceability. HRNČÍROVÁ et al.[38] investigated the impact of technological treatment on DNA degradation in specific plant-based food matrices. The researchers observed a degradation in the integrity of heated DNA that corresponded to the exposure time. The quantity of DNA extracted from a food matrix was influenced by factors such as addition, matrix particle size, and time-dependent thermal treatment. PEANO et al.[60] the DNA obtained from a cracker, taco, tofu, and polenta samples had undergone significant degradation compared to the DNA obtained from corn and soy flours. In addition, the quantity of whole DNA that could be extracted from the more extensively treated products was significantly lower. The size range of DNA fragments retrieved from each sample in our investigation could be affected by the complexity of processing procedures employed by different manufacturers. Furthermore, the quantity of both total and amplifiable DNA that could be obtained from each sample generally exhibited a similar fundamental trend. For instance, Sample C5, a highly processed beverage product, could only amplify the size of DNA fragments to a limited extent (Fig. 3). Similarly, the total DNA content obtained was relatively low using a restricted extraction approach (data not shown). Our observation aligns with other research that has shown a decrease in both the quality and amount of DNA obtained from food commodities following food processing, which can have a detrimental impact on the ability to detect or measure food components accurately.

In summary, the present research has shown that the DNA obtained from Chestnut Rose derived Juices and Beverages differs in quality and quantity according to the specific product matrix and extraction process employed. The combined IPF method demonstrated exceptional performance across all sample types, affirming its status as the preferred method, presuming that time and cost constraints are not a concern. Alternatively, the inexpensive and high-yielding noncommercial MC approach can be chosen if the quality of extracted DNA is not a major concern. The data acquired from our tests serve as a foundation for making decisions regarding choosing an appropriate extraction technique for a particular sample. Additional investigation should focus on precisely characterizing the constituents concerning their DNA integrity and ability to undergo PCR amplification, as well as developing verified reference materials particular to the matrix.

Plant Genomic DNA Kit (PG); Magnetic Plant Genomic DNA Kit (MPG); the modified CTAB-based approach (MC); isopropyl alcohol precipitation combined with Processed Food DNA Extraction Kit (IPF)

Ethics approval and consent to participate

Not applicable

Consent for publication

Not applicable

Availability of data and materials

All data generated or analysed during this study are included in this published article [and its supplementary information files].

Competing interests

The authors declare that they have no competing interests.

Funding

This research was supported by Science and Technology Department of Qiannan (No.2021-16).

Authors' contributions

The research conducted in this study was a collaborative effort involving all authors. Yongchao Ren conducted the experiments, contributed to the statistical analysis, and drafted the manuscript. Yun Song and Yanqi Li were responsible for designing the primers. Yunlong Ma, WeiWei Zhao, and Zuogang Xu were responsible for designing the techniques and experiments, conducting statistical analysis, and interpreting the results. The work was supported by Xuncai Huang, Danmin Yu, and Jian Li. Yongchao Ren, Yanqi Li, and Wenjun Zhao originated the study, conducted data collecting and analysis, contributed to the project's design and coordination, and provided funding for the study. The final manuscript was read and approved by all writers.

Acknowledgements

We express our gratitude to Professor Chenggui Han from China Agricultural University for his diligent work in reviewing this article.

Paarlberg RL. The politics of precaution: Genetically modified crops in developing countries. Intl Food Policy Res Inst; 2001.
Opara LU. Traceability in agriculture and food supply chain: a review of basic concepts, technological implications, and future prospects. J Food Agric Environ. 2003;1:101–6.
Chen G, Kan J. Characterization of a novel polysaccharide isolated from Rosa roxburghii Tratt fruit and assessment of its antioxidant in vitro and in vivo. Int J Biol Macromol. 2018;107:166–74.
Wang H, Li Y, Ren Z, Cong Z, Chen M, Shi L, Han X, Pei J. Optimization of the microwave-assisted enzymatic extraction of Rosa roxburghii Tratt. polysaccharides using response surface methodology and its antioxidant and α-d-glucosidase inhibitory activity. Int J Biol Macromol. 2018;112:473–82.
Guizhou Prickly pears industry. target to achieve output value of 15 billion in 2022. [https://www.gz.chinanews.com.cn/zxgz/2022-01-29/doc-ihavazia5757357.shtml].
Wang L-T, Lv M-J, An J-Y, Fan X-H, Dong M-Z, Zhang S-D, Wang J-D, Wang Y-Q, Cai Z-H, Fu Y-J. Botanical characteristics, phytochemistry and related biological activities of Rosa roxburghii Tratt fruit, and its potential use in functional foods: A review. Food Funct. 2021;12(4):1432–51.
Wang J, Wang G, Wang X, Qin L, Xu C, She X, He Y, Tan D. Chemical constituents and bioactivities of Rosa roxburghii: a systematic review. Food Sci Technol 2022, 42.
Li S, Lv Y, Yang Q, Tang J, Huang Y, Zhao H, Zhao F. Quality analysis and geographical origin identification of Rosa roxburghii Tratt from three regions based on Fourier transform infrared spectroscopy. Spectrochim Acta Part A Mol Biomol Spectrosc. 2023;297:122689.
Chauhan VS, Sharma A. Studies on organoleptic properties of food products from fresh egg and egg powder through principal component analysis. Food/Nahrung. 2003;47(2):102–5.
Pádua MS, Paiva LV, Silva LCd L, KGd, Alves E, Castro AHF. Morphological characteristics and cell viability of coffee plants calli. Ciência Rural. 2014;44:660–5.
Molina E, Martı́n-Álvarez PJ, Ramos M. Analysis of cows', ewes’ and goats’ milk mixtures by capillary electrophoresis: quantification by multivariate regression analysis. Int Dairy J. 1999;9(2):99–105.
Noni Id, Tirelli A, Masotti F. Detection of cow milk in non-bovine cheese by HPLC of whey protein: application to goat milk cheese. 1996.
Asensio L, González I, García T, Martín R. Determination of food authenticity by enzyme-linked immunosorbent assay (ELISA). Food Control. 2008;19(1):1–8.
Cavaliere B, De Nino A, Hayet F, Lazez A, Macchione B, Moncef C, Perri E, Sindona G, Tagarelli A. A metabolomic approach to the evaluation of the origin of extra virgin olive oil: a convenient statistical treatment of mass spectrometric analytical data. J Agric Food Chem. 2007;55(4):1454–62.
Cuny M, Vigneau E, Le Gall G, Colquhoun I, Lees M, Rutledge D. Fruit juice authentication by 1 H NMR spectroscopy in combination with different chemometrics tools. Anal Bioanal Chem. 2008;390:419–27.
Jha S, Gunasekaran S. Authentication of sweetness of mango juice using Fourier transform infrared-attenuated total reflection spectroscopy. J Food Eng. 2010;101(3):337–42.
Castro-Puyana M, Herrero M. Metabolomics approaches based on mass spectrometry for food safety, quality and traceability. TRAC Trends Anal Chem. 2013;52:74–87.
Drake S, Eisele T, QUALITY OF. STORAGE ATMOSPHERE AND CONCOMITANT STORAGE WITH ‘BARTLETT’PEARS 1. J Food Qual. 1997;20(1):41–51.
Drake S, Eisele T. Influence of harvest date and controlled atmosphere storage delay on the color and quality of'Delicious' apples stored in a purge-type controlled-atmosphere environment. 1995.
Drake S, Elfving D, Eisele T. Harvest Maturity and Storage Affect Quality of Cripps Pink'(Pink Lady®) Apples. HortTechnology 2002, 12(3):388–391.
Wrolstad RE, Heatherbell DA, Spanos GA, Durst RW, Hsu J-C, Yorgey BM. Processing and storage influences on the chemical composition and quality of apple, pear, and grape juice concentrates. In.: ACS; 1989.
BABSKY NE, WROLSTAD RE, DURST RW: INFLUENCE OF COMMERCIAL SHIPPING ON THE COLOR AND COMPOSITION OF APPLE JUICE CONCENTRATE 1. J Food Qual. 1989;12(5):355–67.
Han J, Wu Y, Huang W, Wang B, Sun C, Ge Y, Chen Y. PCR and DHPLC methods used to detect juice ingredient from 7 fruits. Food Control. 2012;25(2):696–703.
Yang Y, Liu M, Niu N, Wang H, Wang B, Li M, Wang Y, Wu Y. Identification of small berry species in food and juice using TaqMan-based real-time PCR. J AOAC Int. 2019;102(5):1552–66.
Wu Y, Li M, Yang Y, Jiang L, Liu M, Wang B, Wang Y. Authentication of small berry fruit in fruit products by DNA barcoding method. J Food Sci. 2018;83(6):1494–504.
Di Pinto A, Conversano MC, Forte VT, Novello L, Tantillo GM. Detection of cow milk in buffalo mozzarella by polymerase chain reaction (PCR) assay. J Food Qual. 2004;27(6):428–35.
Díaz IL-C, Alonso IG, Fajardo V, Martín I, Hernández P, Lacarra TG, de Santos RM. Application of a polymerase chain reaction to detect adulteration of ovine cheeses with caprine milk. Eur Food Res Technol. 2007;225:345–9.
Terry CF, Harris N, Parkes HC. Detection of genetically modified crops and their derivatives: critical steps in sample preparation and extraction. J AOAC Int. 2002;85(3):768–74.
Abdel-Latif A, Osman G. Comparison of three genomic DNA extraction methods to obtain high DNA quality from maize. Plant methods. 2017;13:1–9.
Di Bernardo G, Del Gaudio S, Galderisi U, Cascino A, Cipollaro M. Comparative evaluation of different DNA extraction procedures from food samples. Biotechnol Prog. 2007;23(2):297–301.
Liu M-H, Zhang Q, Zhang Y-H, Lu X-Y, Fu W-M, He J-Y. Chemical analysis of dietary constituents in Rosa roxburghii and Rosa sterilis fruits. Molecules. 2016;21(9):1204.
Bernardo GD, Gaudio SD, Galderisi U, Cascino A, Cipollaro M. Comparative evaluation of different DNA extraction procedures from food samples. Biotechnol Prog. 2007;23(2):297–301.
Chapela MJ, Sotelo CG, Pérez-Martín RI, Pardo MÁ, Pérez-Villareal B, Gilardi P, Riese J. Comparison of DNA extraction methods from muscle of canned tuna for species identification. Food Control. 2007;18(10):1211–5.
Pahlich E, Gerlitz C. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemistry. 1980;19:11–3.
Yao H, Song J, Liu C, Luo K, Han J, Li Y, Pang X, Xu H, Zhu Y, Xiao P et al. Use of ITS2 Region as the Universal DNA Barcode for Plants and Animals. PLoS ONE 2010, 5.
Psifidi A, Dovas CI, Banos G. A comparison of six methods for genomic DNA extraction suitable for PCR-based genotyping applications using ovine milk samples. Mol Cell Probes. 2010;24(2):93–8.
Irfan M, Ting ZT, Yang W, Chunyu Z, Qing M, Lijun Z, Feng L. Modification of CTAB protocol for maize genomic DNA extraction. Res J Biotechnol. 2013;8(1):41–5.
Hrnčírová Z, Bergerová E, Siekel P. Effects of technological treatment on DNA degradation in selected food matrices of plant origin. J Food Nutr Res 2008, 47(1).
Gryson N, Messens K, Dewettinck K. Evaluation and optimisation of five different extraction methods for soy DNA in chocolate and biscuits. Extraction of DNA as a first step in GMO analysis. J Sci Food Agric. 2004;84(11):1357–63.
Zimmermann A, Lüthy J, Pauli U. Quantitative and qualitative evaluation of nine different extraction methods for nucleic acids on soya bean food samples. Z für Lebensmitteluntersuchung und-Forschung A. 1998;207:81–90.
Smith DS, Maxwell PW, De Boer SH. Comparison of several methods for the extraction of DNA from potatoes and potato-derived products. J Agric Food Chem. 2005;53(26):9848–59.
Davoren J, Vanek D, Konjhodzić R, Crews J, Huffine E, Parsons TJ. Highly effective DNA extraction method for nuclear short tandem repeat testing of skeletal remains from mass graves. Croatian Med J. 2007;48(4):478.
Holden MJ, Blasic JR, Bussjaeger L, Kao C, Shokere LA, Kendall DC, Freese L, Jenkins GR. Evaluation of extraction methodologies for corn kernel (Zea mays) DNA for detection of trace amounts of biotechnology-derived DNA. J Agric Food Chem. 2003;51(9):2468–74.
Kuhn R, Böllmann J, Krahl K, Bryant IM, Martienssen M. Comparison of ten different DNA extraction procedures with respect to their suitability for environmental samples. J Microbiol Methods. 2017;143:78–86.
Zhang M, Chen W, Liu D, Liu T, Gao L, Shu K. Identification of a specific SCAR marker for detection of Tilletia foetida (Wall) Liro pathogen of wheat. Russian J Genet. 2012;48:663–6.
Yao Z, Qin D, Chen D, Liu C, Chen W, Liu T, Liu B, Gao L. Development of ISSR-derived SCAR marker and SYBR green I real-time PCR method for detection of teliospores of Tilletia laevis Kühn. Sci Rep. 2019;9(1):17651.
Fang Y, Ramasamy RP. Current and prospective methods for plant disease detection. Biosensors. 2015;5(3):537–61.
Meyer R. Development and application of DNA analytical methods for the detection of GMOs in food. Food Control. 1999;10(6):391–9.
Van Hoef A, Kok E, Bouw E, Kuiper H, Keijer J. Development and application of a selective detection method for genetically modified soy and soy-derived products. Food Addit Contam. 1998;15(7):767–74.
Kuiper H. Summary report of the ILSI Europe workshop on detection methods for novel foods derived from genetically modified organisms. Food Control. 1999;10(6):339–49.
Anklam E, Gadani F, Heinze P, Pijnenburg H, Van Den Eede G. Analytical methods for detection and determination of genetically modified organisms in agricultural crops and plant-derived food products. Eur Food Res Technol. 2002;214:3–26.
Rossen L, Nørskov P, Holmstrøm K, Rasmussen OF. Inhibition of PCR by components of food samples, microbial diagnostic assays and DNA-extraction solutions. Int J Food Microbiol. 1992;17(1):37–45.
Tinker N, Fortin M, Mather D. Random amplified polymorphic DNA and pedigree relationships in spring barley. Theor Appl Genet. 1993;85:976–84.
Wilson IG. Inhibition and facilitation of nucleic acid amplification. Appl Environ Microbiol. 1997;63(10):3741–51.
Hammes WP, Hertel C. Mit Hilfe der Gentechnik erzeugte Lebensmittel: Novel Foods und die Problematik ihres Nachweises. Biol unserer Zeit. 1995;25(4):246–55.
Polverelli M, Berger M, Odin F, Cadet J. Simple chromatographic systems permitting both DNA purification and separation of 2'-deoxyribonucleoside 3'-monophosphates as substrates for 32P-postlabelling studies. J Chromatogr B Biomed Sci Appl. 1993;613(2):257–65.
Geuna F, Hartings H, Scienza A. Plant DNA extraction based on grinding by reciprocal shaking of dried tissue. Anal Biochem. 2000;278(2):228–30.
Rizzi A, Panebianco L, Giaccu D, Sorlini C, Daffonchio D. Stability and recovery of maize DNA during food processing. Ital J Food Sci. 2003;15(4):499–510.
Tümerkan ETA. DNA Degradation from Raw Material to Canned Products.
Peano C, Samson MC, Palmieri L, Gulli M, Marmiroli N. Qualitative and quantitative evaluation of the genomic DNA extracted from GMO and non-GMO foodstuffs with four different extraction methods. J Agric Food Chem. 2004;52(23):6962–8.

No competing interests reported.

Download PDF

Editorial decision: Revision requested
12 Jul, 2024
Editor assigned by journal
12 Jul, 2024
Submission checks completed at journal
12 Jul, 2024
First submitted to journal
09 Jul, 2024

You are reading this latest preprint version

Comparative evaluation of various DNA extraction methods and analysis of DNA degradation levels in commercially marketed Chestnut Rose Juices and Beverages

Status:

Version 1

Abstract

Background

Methods

Results

Conclusions

Figures

Introduction

Materials and methods

Samples

DNA extraction methods

Commercial method

Noncommercial method

Combined method

Spectrophotometer measurements

PCR amplification

Real-time PCR

Economic evaluation

Statistical analysis

Results

Quality and concentration of the DNA extracted

Gel electrophoresis of the DNA extracted

Real-time PCR of the DNA extracted

Economic, labor, and time assessments of the DNA extracted

Evaluation of DNA degradation degree

Discussion

Determination of the appropriate extraction method and selection of samples to be used

Evaluation of the extraction method

Economic evaluation and the assignability across the four procedures

Conclusion

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1