Microbial Community Diversity and Succession of Casing Soil during Oudemansiella raphanipes Cultivation

doi:10.21203/rs.3.rs-4718389/v1

Download PDF

Research Article

Microbial Community Diversity and Succession of Casing Soil during Oudemansiella raphanipes Cultivation

https://doi.org/10.21203/rs.3.rs-4718389/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

In this study, high-throughput sequencing(HTS) was used to demonstrate the microbial community diversity and succession of casing soil during Oudemansiella raphanipes cultivation. The abundance and diversity of bacteria and fungi were the highest in the original soil of vegetable soil, and decreased in casing soil, but increased at the end of the mushroom formation. /As the mushroom formation progressed, bacterial aspects, some microorganisms that are often found in heavy metal contaminated soils such as Massilia, Sphingomonas, and Cupriavidus increased in abundance. In terms of fungi, the dominant fungi in the vegetable soil and at the end of the mushroom formation stage was Thermoascus, and the abundance of some plant and animal pathogens, such as Candida, Aspergillus, Trichoderma, and Chaetomium, increased in the first and second mushroom formation stages.This study revealed microbial community succession of casing soil during Oudemansiella raphanipes cultivation, providing theoretical support to improve the yield and quality of Oudemansiella raphanipes by adjusting the casing soil, and also to find solutions for disease control.

Oudemansiella raphanipes

high-throughput sequencing

microbial community

microbial succession

casing soil

Oudemansiella raphanipes is a popular mushroom with edible and medicinal properties in China. With the increasing scale of cultivation, the annual yield of Oudemansiella raphanipes in China has exceeded 20,000 tons per year, with a corresponding output value of over 350 billion CNY.¹ For the commercial cultivation of this mushroom, a crucial step is the addition of a casing layer or casing soil overlaying the substrate like many other mushrooms, e.g., Agaricus bisporus, Agaricus blazei, Copyinds comatus, Grifola frondosa, Ganoderma lucidum, Stropharia rugosoannulata, and so on. ^2,3,4 The physicochemical properties of casing soil and microbial flora comprehensively affect the quality and yield of edible mushroom.^3,13,14 For example, Pseudomonas, Bacillus and other bacteria can increase mycelial growth, primordial formation, and yield in some species of the genera Agaricus and Pleurotus.^5,6,7,8,9 Furthermore, the bioactive factors in the casing soil may promote fruiting body formation in P. portentosus.¹⁰

To date, research on Oudemansiella raphanipes has mainly focused on the screening of high-quality cultivation materials in casing soil, the evaluation of efficient strains and the development of potential bioactive components.^16,17,18,19 However, the diversity and succession of the microbial community in casing soil layer has not been reported, and the interaction between microorganisms in the casing soil layer and the growth and development of Oudemansiella raphanipes is still unclear. Therefore, it is important to characterize the microbial community and determine the interactions between microorganisms in the casing soil layer and the growth of Oudemansiella raphanipes, in order to adjust the casing method to improve the yield and quality of Oudemansiella raphanipesi.

High-throughput sequencing (HTS) technology conducted by Illumina MiSeqTM analysis is the most ideal sequencing platform characterized by high throughput, high accuracy, flexibility and low cost.²⁰ Therefore, it is becoming widely used to investigate whole microbial communities in edible fungi.^21,22 In this study, microbial community diversity and succession in the casing soil at different stages during the cultivation of Oudemansiella raphanipes was conducted using HTS approach. The research may provide insights into the interactions between casing soil-associated microorganisms and Oudemansiella raphanipes.

Samples Preparation and Sampling

Preparation

The Oudemansiella raphanipes packs were supplied by Shandong Linyi Auntie's Mushroom Packs Shop, each pack weighed around 1200g, and the regular casing soil was taken from the vegetable garden soil of the test field on campus.

After sieving vegetable garden soil, eliminated the larger stones, plant and animal remains of the soil samples for disinfection. 200g of Trichloroisocyanuric Acid powder and 2000g of quicklime were added to each cubic meter of soil, fully mixed, then smothered with a plastic sheet for 12h, and spread out to dry for 2h before use. Each group has ten mushroom packs coverd with casing soil, and the thickness of the casing soil was about 5cm. Then watered immediately to ensure that the water soaked through the soil. The ambient temperature was maintained at 21–27°C, and the humidity was kept above 70%. During the cultivation of Oudemansiella raphanipes, wait until the surface of the casing soil dries out and then water a little to keep the surface of the casing soil layer moist.

Sampling

After removal of the top layer of casing soil from the mushroom packs, we used a 10mm diameter perforator to punch vertically downward into the casing soil layer, and put it into a sterile sampling bag. Two sampling sites were set up for each mushroom pack, and ten mushroom packs were taken each time. The soil samples were mixed evenly and divided into five portions, stored at -80°C, and reserved for microbiota analysis of the mulch layer. The original vegetable soil was sampled as a control group. (CY: vegetable garden soil, YC: first mushrooming stage, EC: second mushrooming stage, JS: End of mushrooming stage)

DNA Extraction

The microbial DNA of samples was extracted using the TIANamp Soil DNA Kit and DNA quality was monitored using agarose gel electrophoresis.

Illumina High-throughput Sequencing

Extracted DNA was used as a template for PCR amplification. PCR products were examined using 2% ethidium bromide agarose gel electrophoresis. The DNA gel recovery kit cut the gel to recover the DNA products and purify them, and perform DNA quantification.

The region of bacterial 16S rDNA was amplified using the primer pair 341F/806R (341F: CCTACGGGNGGCWGCAG, 806R: GGACTACHVGGGTWTCTAAT). The fungal ITS1 region was amplified using the primer pair 1737F/2043R (1737F: GGAAGTAAAGCTGTAACAGG, 2043R: GCTGCGTTCTTCATCATCGATGC).

All PCR products were used for library construction using the TIANamp Soil DNA Kit. After the library was qualified, samples were loaded onto the Illumina NovaSeq6000 platform (Novogene Co., Ltd. China) for PE250 double-ended sequencing.

Data analysis

The raw data obtained by sequencing with reads spliced using FLASH software, was processed using QIIME to obtain high-quality Clean Tags data, which were then compared with the species database and chimeric sequences were removed to obtain the final effective data.^23,24 Use the Uparse algorithm to cluster Effective Tags. Sequences are clustered into OTUs with a consistency of 97%. Shannon diversity and Chao1 richness were calculated on the basis of the OTUs. Comparative analysis of alpha diversity and beta diversity of microbial communities was performed using QIIME. The above analysis was completed on NovoMagic, the after-sales platform of Beijing Novosource Technology Co., Ltd.²⁰

Microbial abundance and OTUs diversity

In order to study the species composition of each sample, sequences with 97% identity were clustered into OTUs, and quantified and compared the number of OTUs at different stages of cultivation. A total of 1609 bacterial OTUs and 4707 fungal OTUs were obtained. The common number of bacterial OTUs for the four stages was only 141 (Fig. 1a), and 805 fungal OTUs (Fig. 1b), which were much lower than the overall OTU counts, suggesting that the microbial species in each stages were not very similar.

Vegetable garden soil had the highest number of endemic OTUs; OTUs in the soil layer showed a decreasing trend after cultivation of Oudemansiella raphanipes, with the number of bacterial OTUs decreasing substantially, and that of fungi decreasing less compared with that of bacteria. There was no big difference in the number of OTUs of bacteria and fungi in the soil layer between the second and the first mushroom emergence stages. At the end of the mushrooming stage, the number of bacterial OTUs rebounded, while the fungi still showed a decreasing trend.

The community abundance and diversity indexes, including Shannon, Simpson, ACE and Chao1, were calculated to assess the abundance and diversity of microbial OTUs (Table. 1). The Chao1 and Shannon indexes of each sample were used to evaluate the richness and diversity describe the alpha-diversity of the microbial community respectively. The ACE index reflects whether this sequencing result represents the real situation of the microorganisms in the sample, and the higher the value, the higher the probability that the sequences in the sample are measured, which can also be expressed as the coverage of this sequencing result. The chao1 index showed that the bacterial abundance of virgin garden soil was significantly higher than the other stages, decreased in the first and second mushroom emergence stage, and increased significantly in the end, but still showed lower than the virgin garden soil stage. By analyzing the Shannon and Simpson indexes, the Shannon and Simpson indexes were higher and the microbial diversity was greatest in the original samples of the vegetable garden soil than in the growth stage of Oudemansiella raphanipes. The coverage of bacterial abundance was highest in the virgin vegetable garden soil and lowest in the first flush mushroom emergence stage. For fungi, the highest fungal abundance was found in the original vegetable garden soil. Observed species and chao1 indexes decreased at the first mushroom emergence stage but were not significantly different from the original samples of vegetable garden soil, decreased sharply at the second mushroom emergence stage, and increased slightly at end of mushroom emergence stage. As bacteria, the Shannon and Simpson's indexes were higher and fungal diversity was greatest in the raw vegetable garden soil samples. The coverage of fungal richness was highest in the pristine vegetable garden soil and lowest in the second flush mushroom emergence stage.

Table 1

Bacterial and Fungus Alpha Diversity in Soil Layers of *Oudemansiella raphanipies* Cultivation
	Bacterial				Fungus
Growth stage	Shannon	Simpson	Chao1	ACE	Shannon	Simpson	Chao1	ACE
CY	6.96 ± 0.58a	1 ± 0a	2735.04 ± 565.54a	2724.02 ± 563.91a	4.94 ± 0.58a	0.97 ± 0.03a	1631.53 ± 331.24a	1624.23 ± 329.25a
YC	4.68 ± 0.08b	0.96 ± 0b	761.54 ± 93.54b	759.14 ± 91.6b	3.68 ± 0.4ab	0.87 ± 0.04a	1177.81 ± 127.16a	1197.77 ± 131.16a
EC	4.86 ± 0.34bc	0.98 ± 0.01c	672.59 ± 123.52b	670.81 ± 122.48b	1.6 ± 1.25ab	0.51 ± 0.19a	515.92 ± 533.39ab	511.34 ± 528.33ab
JS	5.49 ± 0.36c	0.98 ± 0.01bc	1117.89 ± 142.39c	1111.91 ± 144.13c	3.08 ± 0.77b	0.9 ± 0.1a	657.92 ± 209.57b	651.75 ± 203.54b
CY: vegetable garden soil, YC: first mushrooming stage, EC: second mushrooming stage, JS: End of mushrooming stage

Diversity Analysis of the Bacterial Community

Bacteria 12530 OTUs were classified into 45 phyla, 142 orders, 271 orders, 430 families, 685 genera 804 species and other unclassified groups. The bacterial populations of the samples were studied at phylum (Fig. 2a) and genus level (Fig. 2b). Eleven bacterial phyla, including Firmicutes, Proteobacteria, Bacteroidetes, Firmicutes, Actinobacteria, Chloroflexi and so on, were identified in the vegetable garden soil. The largest proportion of abundance was Proteobacteria with 18.69%; after mulching, Proteobacteria were still dominant and the proportion increased significantly, the proportion of abundance of Proteobacteria increased to 76.91% in the first mushroom stage. The relative abundance of most other phyla decreased.

In terms of genus, the dominant bacteria in the soil of the vegetable garden were Bacteroides (4.3%), and Massilia spp., Sphingomonas spp., Brevundimonas spp., and Phenylobacterium spp.(4.3%) increased to become the dominant bacteria in the mushrooming stage. The proportion of Brevundimonas spp. and Phenylobacterium spp. increased and became the dominant bacteria. Sphingomonas spp. was the most dominant bacterium at the first mushrooming stage with 12.9%, Phenylobacterium spp. was the most dominant bacterium at the second mushrooming stage, and Massilia spp. increased to be the most dominant bacterium at the end of the mushrooming stage. The percentage of Pseudomonas spp. gradually increased, and Sphingomonas spp., Caulobacter spp., and Agrobacterium spp. significantly increased and then gradually decreased at the first mushrooming stage.

Diversity analysis of the fungal community

Fungi 4707 OTUs were classified into 14 phyla, 44 orders, 104 orders, 233 families, 447 genera 901 families and other unclassified groups. The fungal populations of the samples were studied at phylum (Fig. 3a) and genus level (Fig. 3b). At the phylum level, the largest proportion of abundance in all stages of mushroom cultivation was in the Ascomycota phylum, which accounted for about 50%; a comparison of the first flush of mushroom emergence after mulching with the original garden soil samples revealed that the Mortierellomycota phylum decreased from 6.37–1.35%, and to 0.3% in the second flush of mushroom emergence.

In terms of genus, Thermoascus spp. was the most dominant bacterium in the garden soil with 16.06%, decreased in the mushroom emergence stage, and increased to 17.75% in the end stage, being the most dominant bacterium in the end mushroom emergence stage. The most dominant bacterium in the first mushroom emergence stage was Saccharomycopsis spp. with a percentage of 8.48%, and Candida with a percentage of 14.29% was the most dominant bacterium in the second mushroom emergence stage; Besides Thermoascus spp., Aspergillus spp., Trichoderma spp. and Chaetomium spp. increased in the end mushrooming stage and became the dominant bacteria in the end mushrooming stage.

Microbial succession analysis

The principal components were analyzed based on the Unweighted Unifrac distance, with the horizontal coordinate indicating the first principal component, the vertical coordinate indicating the second, and the percentage indicating the cxontribution of each principal component to the sample. The variation in the bacterial communities between phases was found to be 32.8% (PCo1) and 12.2% (PCo2) with a strong separation by region (Fig. 4a). The vegetable garden soil samples differed from all other periods, the structure of species composition in the casing soil was relatively similar in the first and second mushroom emergence phases as well as the end of mushroom emergence phases. For the fungal community, the maximal variation values were 28.4% (PC1) and 11.0% (PC2) as shown in (Fig. 4b). The first mushrooming stage has the richest fungal composition, including all species in other stages. Phases were scattered, and their fungal composition were relatively different, indicating that the bacterial and fungal composition structure in the casing soil was changing with the increase of cultivation time.

To further identify clustering patterns of microbes at phylum and genus levels in casing soil during Oudemansiella raphanipes cultivation, the distribution of bacterial and fungi in different phases was analyzed (Fig. 5; Fig. 6). For bacteria, at the phylum level, all four stages were enriched in Proteobacteria, and the dominance of colonies in the CY stage was not obvious, comparing with the YC, EC, and JS samples, in which Acidobacteria, Actinobacteria, and Chloroflexi were significantly lower than the other samples. At the genus level, the dominant bacteria in the YC, EC, and JS stages were Sphingomonas, Phenylobacterium, and Massilia, respectively, with Massilia being higher in all three stages. The content of each colony in the CY stage was significantly lower than that in the other stages. As for fungi, at the phylum level, Ascomycota was the absolute dominant fungus in all four stages, with much higher numbers than other colonies. At the genus level, Thermoascus was more abundant in the CY and JS samples than in the other samples, while Candida was more abundant in the EC stage than in the other samples.

This study applied high-throughput sequencing technology to reveal the diversity and succession of microorganisms in the casing soil during the cultivation of Oudemansiella raphanipes. The results showed that the abundance and diversity of bacterial and fungal communities decreased after soil cover, and then increased at the end of the mushrooming stage. This was similar to the previous study.³⁷ Compared with the original mulch, the number of bacterial and fungal OTUs decreased at the mushroom emergence stage, the number of bacterial OTUs increased at the end of the mushroom emergence stage, and the fungi still showed a decreasing trend. This is because Oudemansiella raphanipes attracts microbial enrichment for inter-root secretions, marginal cells and mucus that may be produced by the growth of mycelium and substrates during mushroom emergence, which makes the microbiota of the casing soil layer different from that of the original vegetable garden soil.³⁶ Comparison of the different phases showed that there was a significant change in the composition of the colony in the first mushroom emergence phase, and the composition of the colony in the end mushroom emergence phase gradually moved closer to that of the original vegetable garden soil phase. UPGMA and PCoA analyses showed that the vegetable garden soil was classified into one category separately, while the community structure of the remaining three phases was much more similar.

We found that bacteria and fungi in the soil of the casing soil layer differed significantly in composition and dominant genera, and played a certain role in regulating the soil microbiology. The bacterial community structure fluctuated greatly (Fig. 5). At the phylum level, Proteobacteria was always the most dominant phylum with relative abundance significantly higher than other phyla throughout the mushrooming stage. Massilia was the most dominant genus in the casing soil layer of Oudemansiella raphanipes during the cultivation period, and the relative abundance of Massilia showed a tendency of increasing, then slightly decreasing, and then rapidly increasing during the mushrooming stage of Oudemansiella raphanipes, and its number was the highest at the end of the mushrooming stage and the lowest in the garden soil. The relative abundance of Oudemansiella raphanipes tended to increase, then decrease slightly, and then increase rapidly during the mushrooming stage. It may be due to Massilia, a highly competitive root-perimeter colonizing bacterium, which proliferates around the fungal hyphae of Oudemansiella raphanipes substrates as the substrate grows in large numbers.^25,26 Phenylobacterium utilized the xenobiotic compounds chloridazon, antipyrin, and pyramidon as sole carbon sources, are resistant to heavy metals, and it can degrade the Herbicide Chloridazon,^27,28 and during the second flush of mushroom emergence, Phenylobacterium rised in abundance and became the most dominant genus, replacing the dominance of Massilia. For fungi, the fungal community structure was similar and less variable throughout cultivation. At the phylum level, Ascomycota was the dominant phylum from vegetable garden soil to the end of mushroom production, they form symbiotic associations with biocrust components or latent saprotrophs or pathogens that live on plant tissues.²⁹ This was consistent with previous findings on Agaricus sinodeliciosus, Agaricus bisporus, and Ganoderma lucidum communities.^30,31,32,33 Thermoascus was the most dominant genus of fungi in the first three stages of soil and was definitely superior in the vegetable garden soil and the second flush of mushroom emergence stage, before declining. It produced high levels of a wide range of industrial enzymes and is stable under a wide range of conditions.³⁴ At the end of the mushrooming stage the abundance of Trichoderma, a soil pathogen, increased and mushrooming stops. Due to the high overlap between the growth conditions of wood mold and edible mushrooms, the proliferation of wood mold was highly susceptible to occur in unventilated environments.³⁵

The microbial communities of soil bacteria and fungi in the casing soil layer of Oudemansiella raphanipes changed significantly during different growth stages, and the interactions between microorganisms in the overburden layer and the growth of Oudemansiella raphanipes are still unclear, and further experiments need to be carried out to explore the relationship between microorganisms in the overburden layer and the growth of Oudemansiella raphanipes.

Funding: This research was funded by Shandong Modern Agricultural Industry Technology System Edible Fungi Innovation Team（SDAIT-07-14）.

Zeng, X. Y., Yuan, X. X., Peng, K. Q., Pan, Y. T., Tan, T. J., Wu, N., & Tian, F. H. (2022). Taxonomy and control of Trichoderma hymenopellicola sp. nov. responsible for the first green mold disease on Hymenopellis raphanipes. Frontiers in Microbiology, 13, 991987.
Martos, E. T., Zied, D. C., Junqueira, P. P. G., Rinker, D. L., Da Silva, R., Toledo, R. C. C., & Dias, E. S. (2017). Casing layer and effect of primordia induction in the production of Agaricus subrufescens mushroom. Agriculture and Natural Resources, 51(4), 231-234.
Kertesz, M. A., & Thai, M. (2018). Compost bacteria and fungi that influence growth and development of Agaricus bisporus and other commercial mushrooms. Applied microbiology and biotechnology, 102, 1639-1650.
Carrasco, J., Tello, M. L., Perez, M., & Preston, G. (2018). Biotechnological requirements for the commercial cultivation of macrofungi: substrate and casing layer. Biology of macrofungi, 159-175.
Cho, Y. S., Kim, J. S., Crowley, D. E., & Cho, B. G. (2003). Growth promotion of the edible fungus Pleurotus ostreatus by fluorescent pseudomonads. FEMS microbiology letters, 218(2), 271-276.
Chen, S., Qiu, C., Huang, T., Zhou, W., Qi, Y., Gao, Y., ... & Qiu, L. (2013). Effect of 1-aminocyclopropane-1-carboxylic acid deaminase producing bacteria on the hyphal growth and primordium initiation of Agaricus bisporus. Fungal Ecology, 6(1), 110-118.
Young, L. S., Chu, J. N., & Young, C. C. (2012). Beneficial bacterial strains on Agaricus blazei cultivation. Pesquisa Agropecuária Brasileira, 47, 815-821.
Zarenejad, F., Yakhchali, B., & Rasooli, I. (2012). Evaluation of indigenous potent mushroom growth promoting bacteria (MGPB) on Agaricus bisporus production. World Journal of Microbiology and Biotechnology, 28, 99-104.
Rossouw, W., & Korsten, L. (2017). Cultivable microbiome of fresh white button mushrooms. Letters in Applied Microbiology, 64(2), 164-170.
Yang, R. H., Bao, D. P., Guo, T., Li, Y., Ji, G. Y., Ji, K. P., & Tan, Q. (2019). Bacterial profiling and dynamic succession analysis of Phlebopus portentosus casing soil using MiSeq sequencing. Frontiers in microbiology, 10, 1927.
Hao, Y. J., Zhao, Q. I., Wang, S. X., & Yang, Z. L. (2016). What is the radicate Oudemansiella cultivated in China. Phytotaxa, 286(1), 1-12.
Kalberer, P. P. (1983). Influence of the depth of the casing layer and the harvesting time on changes of the water content of the casing layer and the substrate caused by the first flush of mushrooms. Scientia Horticulturae, 21(1), 9-18.
Wei-Ming, C. A. I., Huai-Ying, Y. A. O., Wei-Lin, F. E. N. G., Qun-Li, J. I. N., Yue-Yan, L. I. U., Nan-Yi, L. I., & Zheng, Z. (2009). Microbial community structure of casing soil during mushroom growth. Pedosphere, 19(4), 446-452.
Nazir, R., Warmink, J. A., Voordes, D. C., van de Bovenkamp, H. H., & van Elsas, J. D. (2013). Inhibition of mushroom formation and induction of glycerol release—Ecological strategies of Burkholderia terrae BS001 to create a hospitable niche at the fungus Lyophyllum sp. strain Karsten. Microbial ecology, 65, 245-254.
Kertesz, M. A., & Thai, M. (2018). Compost bacteria and fungi that influence growth and development of Agaricus bisporus and other commercial mushrooms. Applied microbiology and biotechnology, 102, 1639-1650.
Hayes, W. A., Randle, P. E., & Last, F. T. (1969). The nature of the microbial stimulus affecting sporophore formation in Agaricus bisporus (Lange) Sing. Annals of Applied Biology, 64(1), 177-187.
Umezawa, H., TAKEUCHI, T., ILNUMA, H., SUZUKI, K., ITO, M., MATSUZAKI, M., ... & TANABE, O. (1970). A new microbial product, oudenone, inhibiting tyrosine hydroxylase. The Journal of Antibiotics, 23(10), 514-518.
Gao, Z., Zhang, C., Liu, H., Zhu, Y., Ren, Z., Jing, H., ... & Jia, L. (2018). The characteristics and antioxidation of Oudemansiella radicata selenium polysaccharides on lipopolysaccharide-induced endo-toxemic mice. International journal of biological macromolecules, 116, 753-764.
Pan, W. J., Shi, L. L., Ren, Y. R., Yao, C. Y., Lu, Y. M., & Chen, Y. (2022). Polysaccharide ORP-1 isolated from Oudemansiella raphanipes ameliorates age-associated intestinal epithelial barrier dysfunction in Caco-2 cells monolayer. Food Research International, 162, 112038.
Xu, N., Feng, L., Wang, C., Deng, Z., Zou, S., & Lu, H. (2019). Optimization of culture conditions of fermentation technology for Oudemansiella raphanipes liquid strain fermenter. Journal of Southern Agriculture, 50(2), 344-349.
Caporaso, J. G., Lauber, C. L., Walters, W. A., Berg-Lyons, D., Huntley, J., Fierer, N., ... & Knight, R. (2012). Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. The ISME journal, 6(8), 1621-1624.
Schuster, S. C. (2008). Next-generation sequencing transforms today's biology. Nature methods, 5(1), 16-18.
Gao, H., Mao, Y., Zhao, X., Liu, W. T., Zhang, T., & Wells, G. (2019). Genome-centric metagenomics resolves microbial diversity and prevalent truncated denitrification pathways in a denitrifying PAO-enriched bioprocess. Water research, 155, 275-287.
Wang, Q., Garrity, G. M., Tiedje, J. M., & Cole, J. R. (2007). Naive Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy. Applied and environmental microbiology, 73(16), 5261-5267.
Quast, C., Pruesse, E., Yilmaz, P., Gerken, J., Schweer, T., Yarza, P., ... & Glöckner, F. O. (2012). The SILVA ribosomal RNA gene database project: improved data processing and web-based tools. Nucleic acids research, 41(D1), D590-D596.
Caporaso, J. G., Lauber, C. L., Walters, W. A., Berg-Lyons, D., Huntley, J., Fierer, N., ... & Knight, R. (2012). Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. The ISME journal, 6(8), 1621-1624.
Ofek, M., Hadar, Y., & Minz, D. (2012). Ecology of root colonizing Massilia (Oxalobacteraceae). PloS one, 7(7), e40117.
Scheublin, T. R., Sanders, I. R., Keel, C., & Van Der Meer, J. R. (2010). Characterisation of microbial communities colonising the hyphal surfaces of arbuscular mycorrhizal fungi. The ISME journal, 4(6), 752-763.
Lingens, F., Blecher, R., Blecher, H., Blobel, F., Eberspächer, J., Fröhner, C., ... & Layh, G. (1985). Phenylobacterium immobile gen. nov., sp. nov., a gram-negative bacterium that degrades the herbicide chloridazon. International Journal of Systematic and Evolutionary Microbiology, 35(1), 26-39.
Li, X., Yu, Y., Choi, L., Song, Y., Wu, M., Wang, G., & Li, M. (2019). Phenylobacterium soli sp. nov., isolated from arsenic and cadmium contaminated farmland soil. International Journal of Systematic and Evolutionary Microbiology, 69(5), 1398-1403.
Challacombe, J. F., Hesse, C. N., Bramer, L. M., McCue, L. A., Lipton, M., Purvine, S., ... & Kuske, C. R. (2019). Genomes and secretomes of Ascomycota fungi reveal diverse functions in plant biomass decomposition and pathogenesis. BMC genomics, 20(1), 1-27.
Zhou, J., Bai, X., & Zhao, R. (2017). Microbial communities in the native habitats of Agaricus sinodeliciosus from Xinjiang Province revealed by amplicon sequencing. Scientific Reports, 7(1), 15719.
McGee, C. F. (2018). Microbial ecology of the Agaricus bisporus mushroom cropping process. Applied microbiology and biotechnology, 102, 1075-1083.
Yuan, Y., Huang, H., Ye, L., Fu, J., & Wu, X. (2019). Analysis of fungal community in continuous cropping soil of Ganoderma lingzhi. Mycosystema, 38(12), 2112-2121.
Ren, F., Zhang, Y., Yu, H., & Zhang, Y. A. (2020). Ganoderma lucidum cultivation affect microbial community structure of soil, wood segments and tree roots. Scientific Reports, 10(1), 3435.
Brienzo, M., Arantes, V., & Milagres, A. M. (2008). Enzymology of the thermophilic ascomycetous fungus Thermoascus aurantiacus. Fungal biology reviews, 22(3-4), 120-130.
Hassan, M. M., Farid, M. A., & Gaber, A. (2019). Rapid identification of Trichoderma koningiopsis and Trichoderma longibrachiatum using sequence-characterized amplified region markers. Egyptian Journal of Biological Pest Control, 29, 1-8.
Reinhold-Hurek, B., Bünger, W., Burbano, C. S., Sabale, M., & Hurek, T. (2015). Roots shaping their microbiome: global hotspots for microbial activity. Annual review of phytopathology, 53, 403-424.
Qin, W., Zhao, J., Liu, Y., Gao, Q., Song, S., Wang, S., & Zhang, B. (2022). Bacterial Community Shifts in Casing Soil Before and After the Cultivation of Oudemansiella raphanipes. Journal of Soil Science and Plant Nutrition, 22(4), 4116-4126.
Gong, S., Chen, C., Zhu, J., Qi, G., & Jiang, S. (2018). Effects of wine-cap Stropharia cultivation on soil nutrients and bacterial communities in forestlands of northern China. PeerJ, 6, e5741.

No competing interests reported.

Download PDF

Editor assigned by journal
18 Jul, 2024
Submission checks completed at journal
16 Jul, 2024
First submitted to journal
10 Jul, 2024

You are reading this latest preprint version

Microbial Community Diversity and Succession of Casing Soil during Oudemansiella raphanipes Cultivation

Status:

Version 1

Abstract

Figures

Introduction

Material and Method

Samples Preparation and Sampling

Preparation

Sampling

DNA Extraction

Illumina High-throughput Sequencing

Data analysis

RESULTS

Microbial abundance and OTUs diversity

Diversity Analysis of the Bacterial Community

Diversity analysis of the fungal community

Microbial succession analysis

Discussion

Declarations

References

Additional Declarations

Status:

Version 1