Induction and genetic verification of homologous haploid plants obtained through the anther culture of Citrus cultivars

doi:10.21203/rs.3.rs-4724343/v1

Download PDF

Research Article

Induction and genetic verification of homologous haploid plants obtained through the anther culture of Citrus cultivars

https://doi.org/10.21203/rs.3.rs-4724343/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

In this study, an anther culture system was developed for two Citrus varieties known for their genetic value: blood orange (Moro) and mandarin (Lee). Anthers were inoculated on N6 solid medium containing thidiazuron (TDZ, 0.44 mg/L), 6-benzylaminopurine (0.8 mg/L), zeatin (0.43 mg/L), kinetin (0.44 mg/L), 1-naphthaleneacetic acid (0.2 mg/L), 2,4-Dichlorophenoxyacetic acid (0.2 mg/L), and malt extract (500 mg/L). The inoculated anthers were treated with N6 liquid medium containing spermidine (200 µM) and gibberellic acid (GA₃, 1 mg/L) and cultured for six weeks. Thereafter, the swollen anthers were transferred to Murashige and Skoog (MS) basal medium enriched with malt extract (500 mg/L), sucrose (50 g/L), TDZ (0.5 mg/L), GA₃ (1 mg/L), and gelrite (0.2 %), which induced callus and somatic embryos. These somatic embryos from both varieties were then transferred to a germination medium (MS basal medium containing sorbitol [0.05 M], galactose [0.05 M], malt extract [500 mg/L], GA₃ [0.5 mg/L], and gelrite [2 g/L]) to develop into normal plants. However, Lee exhibited significantly slower shoot and root growth compared to Moro. Genetic analysis using barley microsatellite-derived cleaved amplified polymorphic sequence markers indicated that Lee likely originated from haploid plants, whereas Moro retained heterozygosity similar to the parent. Ploidy analysis confirmed Lee as diploid, identical to the control. Internal transcribed spacer region analysis confirmed that Lee was an anther-cultured haploid-derived plant, estimated to be a homozygous diploid carrying recessive genes. These findings highlight potential applications in marker development and cultivar breeding enhancement focused on recessive trait-associated phenotypes and genotypes.

Anther culture

Citrus cultivars

Blood orange (Moro)

Lee mandarin

Ploidy analysis

Homozygous diploid

The doubled haploid mandarin “Lee” exhibits dwarfism, as evidenced by poor elongation of new shoots, and can serve as a model to study dwarfism mechanisms in citrus species.

Citrus fruits, belonging to the family Rutaceae and subfamily Aurantioideae, are among the most widely produced fruits worldwide (Caserta et al. 2019; Dorji and Yapwattanaphun 2011; Iacuzzi et al. 2019; Kim et al. 2023; Sun et al. 2019), holding significant economic value as fruit crops (Cardoso et al. 2014; Ezrari et al. 2022; Huh et al. 2011; Jin et al. 2022; Jung et al. 2005). In South Korea, Citrus ranks third in orchard cultivation area and production volume, following apples and pears, indicating its high supply and demand (Chung 2022; Jin et al. 2022). However, Citrus breeding faces challenges due to traits such as high heterozygosity, prolonged juvenility, self-incompatibility, and polyembryony. These factors make it time-consuming and labor-intensive to develop pure, superior lines using traditional breeding methods like crossing (Cardoso et al. 2014; Chiancone and Germanà 2016; Chiancone et al. 2015; Germanà 2007, 2009; Jin et al. 2022).

In contrast, haploid plants obtained through anther cultures offer significant advantages. They enable the production of completely homozygous lines from heterozygous parents in a single step. Additionally, haploid-derived plants often exhibit dwarfism and reduced vigor compared to the donor parent (Burbulis et al. 2005; Jin et al. 2022; Lee et al. 2016; Niroula and Bimb 2009). These morphological characteristics facilitate the rapid selection of pure lines, thereby reducing the breeding time (Chiancone and Germanà 2016; Jin et al. 2022; Karjee et al. 2020).

Anther culture, a tissue culture technique, is predominantly used to obtain homozygous plants and is significant for producing somatic tissues identical to the parent (Iacuzzi et al. 2019). Anther cultures have been extensively studied in numerous plant species and have high potential for plant breeding and crop improvement (Chiancone and Germanà 2016; Cimò et al. 2016; Das et al. 2018; Germanà et al. 2013; Jin et al. 2022; Mishra and Goswami 2014). In Citrus, anther culture-obtained haploid-derived regenerated plants include clementine mandarin, sweet orange, sour orange, and trifoliate orange (Poncirus trifoliata (K.) Raf.) (Cao et al. 2011; Cardoso et al. 2014; Germanà 2003; Germanà and Chiancone 2003; Germanà et al. 1990, 2005; Hidaka et al. 1979; Jin et al. 2022; Wang et al. 2015). Additionally, haploid-derived callus cells have been obtained from lemon varieties, although regenerated plants were not achieved (Germanà 2007, 2011). Despite the necessity of developing multiple pure lines for systematic breeding of Citrus, there is currently a significant deficiency in such breeding efforts (Cao et al. 2011; Jin et al. 2022).

Therefore, this study aimed to develop multiple pure line varieties by regenerating plants from the anther cultures of blood orange (Moro) and mandarin (Lee) varieties. Additionally, genetic verification was conducted to assess whether the regenerated plants were haploid-derived. For the Lee variety, presumed to be haploid-derived, a ploidy analysis was performed. Moreover, phylogenetic analysis was used to verify whether these regenerated plants were homozygous or heterozygous haploid-derived plants.

Plant material pretreatment and anther culture

Blood orange (Moro) and mandarin (Lee) samples were collected from the flower buds (approximately 2–3 mm in diameter) from mid to late April, 2023 (Fig. 1). Fifty flower buds were harvested from Citrus trees in a greenhouse at a citrus facility, following the method described by Jin et al. (2022). The harvested flower buds were pretreated at 4 ℃ for 24 h and sterilized by immersing them in 70% ethanol for 30–60 s. To completely evaporate the alcohol, the buds were placed on sterile filters for approximately 2–3 h.

To isolate the anthers from the dried flower buds for anther culture, unopened buds were dissected using a scalpel and tweezers to carefully remove flower stalks. Subsequently, the anthers were inoculated onto N6 culture medium (Chu 1981) supplemented with thidiazuron (TDZ, 0.44 mg/L), 6-benzylaminopurine (BA, 0.8 mg/L), zeatin (0.43 mg/L), kinetin (0.44 mg/L), 1-naphthaleneacetic acid (NAA, 0.2 mg/L), 2,4-dichlorophenoxyacetic acid (2,4-D, 0.2 mg/L), malt extract (500 mg/L), sucrose (50 g/L), and agar (8 g/L). Additionally, a liquid medium (N6 medium supplemented with spermidine [200 µM] and gibberellic acid [GA₃, 1 mg/L]) was added to the surface of the inoculated anther samples. The cultures were then incubated in semi-dark conditions for 4–6 weeks.

Induction of callus and somatic embryos

To induce callus and somatic embryos, swollen anthers from the culture medium (as described above) were transferred to MS (Murashige and Skoog 1962) basal medium supplemented with TDZ (0.5 mg/L), GA₃ (1 mg/L), and gelrite (0.2%). The cultures were maintained under light conditions with a 16 h photoperiod at 25 ± 2°C for 4 weeks. Somatic embryos were induced from callus cells following the method described by Jin et al. (2022). The callus cells were transferred to a somatic induction medium consisting of MS medium supplemented with malt extract (500 mg/L), lactose (164 mM), and agar (16 g/L), cultured for 6 weeks, and transferred to fresh medium every 3 weeks.

Plant regeneration

To induce plant regeneration from anther culture medium-derived somatic embryos, the Moro and Lee somatic embryos were transferred to a plant germination induction medium, following the method described by Jin et al. (2022). This medium consisted of MS basal medium supplemented with sorbitol (0.05 M), galactose (0.05 M), malt extract (500 mg/L), GA₃ (0.5 mg/L), and gelrite (2 g/L). The cultures were then incubated for 3–4 weeks. Moro and Lee individuals with normally formed shoots and roots were transferred to Magenta boxes containing MS basal medium supplemented with sucrose (30 g/L) and agar (8 g/L), without hormones, for 6 weeks. Somatic embryos of Lee that did not germinate properly in the initial germination medium were transferred to another germination medium composed of MS basal medium supplemented with malt extract (500 mg/L), sucrose (50 g/L), GA₃ (1.0 mg/L), kinetin (0.1 mg/L), and agar (0.8%) to assess the formation of shoots and roots. Each formed shoot was subsequently micrografted onto trifoliate orange rootstocks cultured in vitro to maintain and propagate the regenerated plants.

Genetic verification

To verify the haploid origin of the plants obtained through anther culture, polymerase chain reaction (PCR) was conducted using Citrus variety-specific simple sequence repeat (SSR) (Woo et al. 2020) marker primers (Biomedic, Korea) (Table 1). Total genomic DNA was extracted using the automated nuclear extraction system (MX 16; Promega, Madison, WI, USA) and stored at − 20°C. The PCR reaction mixture was prepared using AccuPower® Multiplex PCR PreMix (Bioneer, Corp., Daejeon, Korea), which contained 250 µM deoxyribonucleotide triphosphate (dNTP), 1.5 mM MgCl₂, 1.0 unit Taq DNA polymerase, 10 mM Tris-HCl (pH 9.0), and 40 mM KCl, 15–20 ng of genomic DNA, and 0.5 µM of each primer in a total volume of 20 µL. The PCR conditions were as follows: initial denaturation (94°C, 5 min), followed by 35 cycles of denaturation (94°C, 30 s), annealing (58°C, 30 s), and extension (72°C, 40 s), with a final extension (72°C, 30 min). The PCR amplification products were electrophoretically analyzed using the QiAxcel Advanced System (Qiagen, Hilden, Germany).

Table 1

Primer sets used to assess haploid-derived plants
No.	Primer names	Primer sequence (5′->3′)		Repeat motif	Tm (\(\:\mathbf{℃})\)	Size range (bp)	References
No.	Primer names	Forward	Reverse	Repeat motif	Tm (\(\:\mathbf{℃})\)	Size range (bp)	References
1	BM-CiSSR-077	TGTATTTATTTCTGACTACGACC	ATGCGTTTGGTGTGTGTT	(AT)12	58	188–207	Woo et al. 2020
2	BM-CiSSR-087	CAGATCCTATTGCAGAGGCA	GCCCATTTGTATTGCCATTT	(CAG)6	58	183–189	Woo et al. 2020
2	BM-CiSSR-162	GCTAGGGTTCCAGACTTCCAG	GATTTGGCCGATCGAAAGCC	(AAT)10(CAT)6	53	185–236	Woo et al. 2020
2	BM-CiSSR-201	CAACAGTACCTGATGGTCCG	TTCTGAAATCCAGTCCCCTC	(AAAAGA)6	55	259–270	Woo et al. 2020
3	BM-CiSSR-204	CCATGACCCACTTTCCCTAC	ATTCGGGTAGGTTGAAATCG	(ACCCG)4	55	326–365	Woo et al. 2020
4	BM-CiSSR-221	GGTCCTTTGGAGAAGGTTGA	CATGACCAAATGTCGGGTTA	(TAAT)5	55	319–332	Woo et al. 2020
6	BM-CiSSR-230	TCCATCAGCCATTCCATCTA	ATCTGAACCCTCCAATCCTG	(TTC)9	55	276–302	Woo et al. 2020
7	BM-CiSSR-240	GCTGCTGCTGCTAGTTTGTC	AAAGATGGCAATGGGTTAGG	(TCA)7	55	429–432	Woo et al. 2020
8	BM-CiSSR-241	GGTCCTTTGGAGAAGGTTGA	CATGACCAAATGTCGGGTTA	(TAAT)5	55	296–301	Woo et al. 2020
9	BM-CiSSR-246	CCCTAGGGAAATTTGGGAAT	GCACTCGAGAGTTCTCGTTAAG	(CAT)11	55	310–375	Woo et al. 2020
10	BM-CiSSR-249	ATGGGCAAGAACAGGAAATC	CCATAGGATTTGCATGAGGA	(GGA)6	55	321–331	Woo et al. 2020
11	BM-CiSSR-253	AATTTCCTGCTCCAAACCAG	TCCAACAACTTGAACACGGT	(TAA)14	55	319–355	Woo et al. 2020
12	BM-CiSSR-256	CTCTCTGAACCTGACACCGA	TTTTCTCCACCCTTTCAACC	(GAT)7	55	290–322	Woo et al. 2020
13	BM-CiSSR-260	TCATCTGAACGGACCACAAT	TAACTGCACTTGCTTCCCTG	(TTC)6	55	381–384	Woo et al. 2020
14	BM-CiSSR-264	AGGGGTGCTGAGCATAAAAT	ATACCCCGTCGTGGAATTAG	(TAA)9	55	415–442	Woo et al. 2020
15	BM-CiSSR-271	CCCCCAAAATGCTGAGTAGT	AAAGGGAGAGAGTTGGCTGA	(TATG)13	55	382–422	Woo et al. 2020
16	BM-CiSSR-273	GCATCATACGTTCAAGCCAC	TCTTGTGCTCTCCTGTGACC	(CAT)12	55	298–336	Woo et al. 2020

Ploidy verification

To verify the ploidy of the anther culture-obtained plants, leaves from the in vitro-grafted Lee plants were collected and prepared for analysis, following the method described by Chiancone et al. (2006). The ploidy of the prepared samples was determined using flow cytometry (Sysmex Partec GmbH, Görlitz, Germany). Leaves from the donor plants used in the anther culture and approximately 50 mg of leaf tissue from the in vitro-grafted plants were finely chopped with a sharp razor blade in a plastic petri dish containing nuclear extraction (0.5 mL) and staining buffers (2 mL). The extracts from all samples were passed directly through a 30 µm Partec CellTrics® filter (Sysmex Partec GmbH) into sample test tubes and measured at a gain value of 540.

Genetic phylogenetic analysis

The genetic relationship between the donor (Lee) mandarin plants (control) and the anther culture-derived regenerated plants was analyzed as described previously by Jin et al. (2016, 2018, 2022). The complete internal transcribed spacer (ITS) region of nuclear ribosomal DNA (ITS1-5.8S-ITS2) was analyzed using the primer pair ITS1F1 (5′-GAAGGATCATTGTCGACCTGCCAGCAGACG-3′) and ITS2R2 (5′-GACCTGGGTCGCAATGCGAGCGCCGCTT-3′) (Jin et al. 2016). The amplified PCR products were electrophoresed on a 1.2% agarose gel at 100 V for 30 min and purified using a GeneAll® Gel Purification Kit (GeneAll Biotechnology, Co., Seoul, Korea). The purified products were cloned using the pLUG-Prime® TA-Cloning Vector Kit (iNtRON, Korea) and transformed into Escherichia coli (Jin et al. 2018). Sequencing was performed on four colonies out of ten white colonies obtained from each transformation using SolGent (SolGent Co., Daejeon, Korea). The analyzed sequences were edited using BioEdit (Hall 1999), and genetic phylogenetic relationships were analyzed using Molecular Evolutionary Genetics Analysis (MEGA) software version 5.2.

Plant regeneration from anther-cultured cells

The anthers of blood orange (Moro; Fig. 1a) and mandarin (Lee; Fig. 1b) began to swell 1–2 weeks after culture, resulting in numerous callus cells and somatic embryos within 3–4 weeks (Fig. 2a; top and bottom). Analysis of callus induction and embryo formation rates from the cultured anthers of each citrus variety demonstrated that, on average, 11 out of 49 cultured anthers of Moro produced calluses and embryos. In contrast, Lee produced calluses from approximately 4 out of 49 cultured anthers, with embryo formation occurring in approximately two anthers (Table 2). Subsequently, the callus cells were transferred to a somatic embryo induction medium to induce embryo formation (Fig. 2b; top and bottom). A total of 154 somatic embryos induced from the Moro anthers were transferred to plant regeneration medium (embryo germination and initial micropropagation [EGIM]). After 4–6 weeks of culture, approximately 57 embryos developed into normal plants with both shoots and roots (Table 3 and Fig. 2c; top), while 108 formed only shoots and 57 formed only roots (Table 3).

Table 2

The callus cells and embryo induction rates from the anther-cultured *Citrus* cultivars
Cultivars	No. of cultured anthers	No. of anthers with callus formation	No. of anthers with somatic embryo formation
‘Moro’ orange	49\(\:\:\pm\:\:1.0\)^z	11\(\:\:\pm\:\:1.0\)	10.7\(\:\:\pm\:\:0.6\)
‘Lee’ mandarin	49\(\:\:\pm\:\:0.6\)	4.3\(\:\:\pm\:\:0.6\)	2\(\:\:\pm\:\:1.0\)
^z Average value and standard error, repeated thrice

Table 3

Assessment of plant regeneration rate in the anther-cultured cell-derived somatic embryos based on media composition
Cultivars	Media compositions	No. of cultured embryos	No. of shoot induction	No. of root induction	No. of shoot or root simultaneous formation
‘Moro’ orange	EGIM^z	154 (38.5\(\:\:\pm\:\:0.6)\)^x	108 (27\(\:\:\pm\:\:1.6)\)	57 (14.25\(\:\:\pm\:\:3.0)\)	57 (14.25\(\:\:\pm\:\:3.0)\)
‘Lee’ mandarin	EGIM	116 (29\(\:\:\pm\:\:1.8)\)	46 (11.5\(\:\:\pm\:\:1.3)\)	60 (15\(\:\:\pm\:\:0.8)\)	55 (13.75\(\:\:\pm\:\:1.0)\)
‘Lee’ mandarin	EGK^y	93 (23.3\(\:\:\pm\:\:3.4)\)	36 (9\(\:\:\pm\:\:1.4)\)	62 (15\(\:.5\:\pm\:\:2.6)\)	57 (15\(\:\:\pm\:\:2.8)\)
^z Media composition for plant germination from somatic cell embryos; MS basic medium with malt extract (500mg/L), supplemented with sorbitol (0.05M), galactose (0.05M), GA₃ (0.5 mg/L), and gelrite (0.2%)
^y Media composition for plant germination from somatic cell embryos; MS basic medium supplemented with malt extract (500mg/L), supplemented with sucrose (50g/L), GA₃ (1.0 mg/L), kinetin (0.1 mg/L), and agar (0.8%)
^x Average value and standard error, repeated four times

Somatic embryos of the mandarin (Lee) variety were transferred to a regeneration medium (EGIM medium), resulting in approximately 46 out of 116 somatic embryos forming only shoots, 60 forming only roots, and 57 forming both shoots and roots simultaneously (Table 3 and Fig. 2c; bottom). Additionally, when somatic embryos obtained from the Lee anther culture were transferred to another regeneration medium (embryo germination medium with kinetin [EGK]), 36 out of 93 somatic embryos formed only shoots, 62 formed only roots, and 57 formed both shoots and roots simultaneously (Table 3 and Fig. 2c; bottom). Plants with both shoots and roots were then transferred to hormone-free MS basal medium and sub-cultured every 4 weeks to facilitate elongation and proliferation (Fig. 2c; top and bottom). For rapid propagation, normal regenerated plants formed from anthers were micrografted onto in vitro-propagated trifoliate orange rootstocks (Fig. 2d; top and bottom).

Genetic verification

To confirm whether the anther culture-obtained Moro plants were haploid-derived, three regenerated plants were randomly selected and analyzed using three SSR markers (BM-CiSSR-87, -201, and − 264), as listed in Table 1. The results demonstrated that the regenerated Moro plants exhibited a double band pattern, indicating heterozygosity similar to that of the donor parent plants used in the anther culture (Fig. 3).

For the anther culture-obtained Lee mandarin plants, three in vitro-grafted regenerated plants and three somatic embryos were randomly selected and analyzed using 15 SSR markers (BM-CiSSR-77, -162, -204, -221, -230, -240, -241, -246, -249, -253, -256, -260, -264, -271, and − 273), as listed in Table 1. The results demonstrated that the donor parent plants (control) exhibited double (BM-CiSSR-77, -204, -221, and − 230) or triple (BM-CiSSR-162 and − 240) band patterns (Fig. 4a). In contrast, the in vitro-grafted regenerated Lee plants and randomly selected somatic embryos from the anther culture exhibited single band patterns. The single amplification products of the anther culture-obtained Lee plants matched the lowest band of the control plants, except for the SSR marker BM-CiSSR-77, which matched the uppermost band of the control amplification products (Fig. 4a). Additionally, the SSR markers BM-CiSSR-221 and − 230 exhibited double band patterns in the control plants, whereas BM-CiSSR-240 exhibited a triple band pattern (Fig. 4b). However, single amplification products from the Lee plants matched the lowest band position of the control plants (Fig. 4b). Moreover, the SSR markers BM-CiSSR-241, -246, and − 249 exhibited double band patterns in the control plants. Similarly, the SSR markers BM-CiSSR-253, -256, and − 260 exhibited triple band patterns in the control plants. In contrast, the Lee plants exhibited single band patterns matching the lowest band position of the control plants for markers BM-CiSSR-253 and − 256 (Fig. 4d). However, for the marker BM-CiSSR-260, sample lane 2 exhibited a single band pattern matching the intermediate band position of the control, whereas the remaining samples (lanes 1 and 3–6) exhibited single band patterns matching the lowest band position of the control (Fig. 4d). Additionally, the SSR marker CiSSR-264 exhibited triple band patterns in the control plants, but amplification products from the Lee plants (lanes 1–6) exhibited a major band at the lowest position, with minor bands differed from those of the control (Fig. 4e). In contrast, the SSR marker CiSSR-271 exhibited triple band patterns in the control plants, but amplification products from the Lee plants (lanes 1–6) exhibited a major band at the highest position, with minor bands differed from that of the control (Fig. 4e). Lastly, the SSR marker CiSSR-273 exhibited double band patterns in the control plants, but amplification products from the Lee plants (lanes 1–6) exhibited single band patterns matching the lowest band position of the control (Fig. 4e).

Polyploidy verification and morphological selection

Ploidy analysis was performed using leaf tissues from three anther culture-derived regenerated Lee mandarin plants, presumed to be haploid-derived through genetic verification, and the donor plant (control). As illustrated in Fig. 5, the ploidy peak of the control plant (Fig. 5a) appeared between 60–70, whereas no peak was observed in the wash water (Fig. 5b). However, the anther culture-obtained regenerated plants (Lee) that were presumed to be haploid-derived (Fig. 5c), exhibited a ploidy peak around 100.

Phylogenetic analysis

The ITS region of the three anther culture-derived regenerated plant samples of Lee mandarin underwent PCR product purification, TA cloning, and transformation into E. coli for both the Lee-1 regenerated plant and the donor plant (control). The chromosomal DNA sequences of the four selected white colonies were analyzed. The sequencing results revealed that the nucleotide sequences of the control Lee-origin-1 and Lee-origin-3 clones were most similar to those of Citrus tachibana Tanaka ‘Hongkyool’ (GenBank number: MG702224) and Citrus reticulata (GenBank number: MF155026). The sequence of the control Lee-origin-4 clone was most similar to Citrus aurantium ‘Jikak’ (GenBank number: MG702216). In contrast, the sequence of the control Lee-origin-9 clone was most similar to (Citrus unshiu x Citrus sinensis) × Citrus reticulata 'Shinyegam' (GenBank number: MG702209) and Citrus reticulata ‘Wilking’ (GenBank number: MG702212). The nucleotide sequences of the Lee-1-1, Lee-1-2, Lee-1-3, and Lee-1-7 clones from the Lee anther culture-derived regenerated plants were most similar to Citrus tachibana Tanaka ‘Hongkyool’ (GenBank number: MG702224) and Citrus reticulata (GenBank number: MF155026), consistent with the results from the control Lee-origin-1 and Lee-origin-3 clones. Based on these sequence results, a phylogenetic analysis was performed, and as illustrated in Fig. 6, two groups (Gp1 and Gp2) were identified. Gp1 included the control clones Lee-origin-1, -3, and − 4, and the Lee anther culture-regenerated plant clones Lee-1-1, -1-2, -1-3, and − 1–7. Gp2 included only the control clone Lee-origin-9.

This study assessed the acquisition of haploid-derived plants through anther culture of Citrus varieties, specifically the blood orange (Moro) and mandarin (Lee). Generally, it is easier to obtain haploid plants through anther culture in herbaceous plants than in woody plants, such as Citrus, which have a prolonged juvenile phase (Chiancone et al. 2015; Jin et al. 2022). Successful production of haploid plants through anther culture has been frequently reported in Brassicaceae and certain Solanaceae species (Jin et al. 2022; Parra-Vega et al. 2013; Prem et al. 2012; Seguí-Simarro et al. 2011; Wędzony et al. 2009). In Citrus, successful embryo induction and plant regeneration have been reported through anther culture (Cardoso et al. 2014; Germanà 2006, 2007, 2009; Iacuzzi et al. 2019; Jin et al. 2022). For the comprehensive systematic breeding of Citrus varieties, securing a substantial number of pure-line cultivars is essential; however, current efforts in this area are lacking (Cao et al. 2011; Jin et al. 2022).

Additionally, several studies have reported the production of homozygous diploid, triploid, aneuploid, and heterozygous tetraploid plants from haploid-derived lines (Chiancone et al. 2006; Germanà 2005, 2007, 2009; Iacuzzi et al. 2019; Jin et al. 2022). Specifically, for Moro, anther culture did not yield haploid-derived plants, but rather heterozygous tetraploid plants (Iacuzzi et al. 2019). This outcome is not exceptional, as various studies have reported the regeneration of Citrus plants with different ploidy levels through anther cultures (Germanà 2007, 2011; Germanà et al. 2005). These results are relatively common in the anther culture-regenerated plants of various Citrus species (Iacuzzi et al. 2019). Similarly, in this study, the anther culture-regenerated Moro plants were confirmed to be heterozygous, not haploid-derived. Therefore, this variety did not yield haploid-derived plants as reported by Iacuzzi et al. (2019).

In contrast, the regenerated Lee plants obtained through anther culture exhibited limited development compared to those of Moro. Although shoots and roots were formed, they exhibited minimal elongation. Haploid-derived plants are morphologically smaller and exhibit significantly lower vigor than their donor parents (Burbulis et al. 2005; Jin et al. 2022; Lee et al. 2016; Niroula and Bimb 2009). Therefore, based on these results, it is presumed that the regenerated Lee plants obtained through anther culture were haploid-derived. Citrus varieties, such as Lee, which have elongated roots but not shoots, require micrografting techniques for propagation (Jin et al. 2022). Regenerated Moro plants obtained through anther culture were genetically assessed using three SSR markers. The results demonstrated that these plants were heterozygous and identical to the donor parent plants that were used as controls. Therefore, this study further confirms that the regenerated Moro plants were heterozygous and not haploid-derived. In contrast, using 15 SSR markers, the PCR results demonstrated that while the donor parent (control) plants exhibited 2–3 amplification patterns, the regenerated Lee plants and somatic embryos obtained through anther culture exhibited only a single amplification pattern. This indicated that the regenerated Lee plants obtained through anther culture were haploid-derived. To date, the only mandarin variety obtained through anther culture to yield haploid-derived plants is C. clementina (Germanà 2007; Germanà et al. 1994). Studies have reported the acquisition of haploid plants from C. clementina anthers through gamma irradiation (Aleza et al. 2009; Froelicher et al. 2007). However, there have been no further studies on haploid-derived mandarin plants obtained solely through anther culture without gamma irradiation (Germanà 2007). The ploidy verification of the regenerated Lee plants, presumed to be haploid-derived through genetic verification, revealed them to be diploid.

The ITS region analysis based on the nucleotide sequences of conserved chromosomal regions revealed that the donor parent Lee (control) had clones 1 and 3 most closely related to Hongkyool and mandarin, whereas clones 4 and 9 were similar to Jikak or hybrids between orange and mandarin, specifically Shinyegam and Wilking mandarin. In contrast, the haploid-derived Lee plants exhibited the closest phylogenetic relationship with clones 1–3 among the four original clones. The Lee variety was selected through a cross between Clementine and Orlando tangelo (Reece and Gardner 1959). However, this study demonstrated that the nucleotide sequences from conserved chromosomal regions in the haploid-derived plants exhibited distant relationships to orange, tangelo (Citrus reticulata × sinensis), or Citrus aurantium varieties. This indicates that the anther culture-regenerated Lee plants are haploid-derived homozygous diploids. Therefore, to further confirm the haploid origin of these plants, it is recommended to secure regenerated plants through environmental acclimatization, such as ex vitro grafting, and perform genome analysis for more precise verification.

In this study, we conducted anther cultures of two Citrus varieties, blood orange (Moro) and mandarin (Lee). We successfully regenerated heterozygous Moro plants from the anther wall of the Moro variety and obtained doubled haploid plants from the Lee mandarin. Notably, the double haploid Lee mandarin plants exhibited dwarf characteristics, such as poor shoot elongation. These plant materials will be valuable for future research on the mechanisms underlying dwarfism.

TDZ	thidiazuron
BA	6-Benzylaminopurine
NAA	1-Naphthaleneacetic acid
2,4-D	2,4-Dichlorophenoxyacetic acid
GA₃	Gibberellic acid
PCR	Polymerase chain reaction
SSR ITS MEGA EGIM EGK	Simple sequence repeat Internal transcribed spacer Molecular Evolutionary Genetics Analysis Embryo germination and initial micropropagation Embryo germination medium with kinetin

Competing Interests

The authors have no relevant financial or non-financial interests to disclose.

Funding

This study was supported by the Rural Development Administration (Grant number PJ01735603, and PJ01446603)

Author Contributions

Genetic analysis and establishment of the anther culture system were performed by Seong Beom Jin and Jee Soo Park. Experiments were assisted by Suk Man Park, Dong Hoon Lee, and Young Eel Moon. The first draft of the manuscript was written by Seong Beom Jin. All authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.

Acknowledgments

Ha Na Jeong from the Citrus Research Center assisted in the conservation and maintenance of regenerated plant genetic resources obtained through anther culture. Su Bin Park from the Citrus Research Center assisted in the preparation and cultivation of Poncirus trifoliate (L.) Raf. rootstock.

Data availability

The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

Aleza P, Juárez J, Hernández M, Pina JA, Ollitrault P, Navarro L (2009) Recovery and characterization of a Citrus clementina Hort. ex Tan ‘Clemenules’ haploid plant selected to establish the reference whole Citrus genome sequence. BMC Plant Biol 9:1–17. https://doi.org/10.1186/1471-2229-9-110
Burbulis N, Blinstrubiene A, Sliesaravicius A, Venskutoniene E (2005) Influence of genotype, growth regulators, sucrose level and preconditioning of donor plants on flax (Linum usitatissimum L.) anther culture. Acta Biol Hung 56:323–331. https://doi.org/10.1556/abiol.56.2005.3-4.15
Cao H, Biswas MK, Lü Y et al (2011) Doubled haploid callus lines of Valencia sweet orange recovered from anther culture. Plant Cell Tiss Organ Cult 104:415–423. https://doi.org/10.1007/s11240-010-9860-z
Cardoso JC, Martinelli AP, Germana MA, Latado RR (2014) In vitro anther culture of sweet orange (Citrus sinensis L. Osbeck) genotypes and of a C. clementina × C. sinensis ‘Hamlin’ hybrid. Plant Cell Tiss Organ Cult 117:455–464. https://doi.org/10.1007/s11240-014-0456-x
Caserta R, Teixeira-Silva NS, Granato LM et al (2019) Citrus biotechnology: What has been done to improve disease resistance in such an important crop? Biotechnol Res Innov 3:95–109. https://doi.org/10.1016/j.biori.2019.12.004
Chiancone B, Germanà MA (2016) Microspore embryogenesis through anther culture in Citrus clementina Hort. ex Tan. In: Germana MA, Lambardi M (ed) In vitro embryogenesis in higher plants. Humana Press, New York, pp 475–487
Chiancone B, Tassoni A, Bagni N, Germanà MA (2006) Effect of polyamines on in vitro anther culture of Citrus clementina Hort. ex Tan. Plant Cell Tiss Organ Cult 87:145–153. https://doi.org/10.1007/s11240-006-9149-4
Chiancone B, Karasawa MMG, Gianguzzi V et al (2015) Early embryo achievement through isolated microspore culture in Citrus clementina Hort. ex Tan., cvs. ‘Monreal Rosso’ and ‘Nules’. Front Plant Sci 6:413. https://doi.org/10.3389/fpls.2015.00413
Chu CC (1981) The N6 medium and its applications to anther culture of cereal crops. In: Proceedings of the Symposium on Plant Tissue Culture. Peking Science Press, Beijing, pp 43–50
Chung WH (2022) An analysis of policy effect of the orchard scale improvement project. J Agric Life Sci 56:127–135. https://doi.org/10.14397/jals.2022.56.1.127
Cimò G, Casamento D, Marinoni DT, Botta R, Germanà MA (2016) Gametic embryogenesis through isolated microspore culture in mandarin (Citrus reticulata Blanco), Mandarino Tardivo Di Ciaculli: effect of meta-Topolin and temperature treatments. Citrus Res Technol 37:113–122. http://dx.doi.org/10.4322/crt.ICC034
Das A, Kumar K, Tribhuvan KU, Das SS, Mishra M (2018) Development of haploid and double haploid in fruit crops—A review. Int J Curr Microbiol Appl Sci 7:2119–2132. https://doi.org/10.20546/ijcmas.2018.705.247
Dorji K, Yapwattanaphun C (2011) Assessment of morphological diversity for local mandarin (Citrus reticulate Blanco) accessions in Bhutan. J Agric Technol 7:485–495.
Ezrari S, Radouane N, Tahiri A et al (2022) Dry root rot disease, an emerging threat to citrus industry worldwide under climate change: A review. Physiol Mol Plant Pathol 117:101753. https://doi.org/10.1016/j.pmpp.2021.101753
Froelicher Y, Bassene JB, Jedidi-Neji E et al (2007) Induced parthenogenesis in mandarin for haploid production: induction procedures and genetic analysis of plantlets. Plant Cell Rep 26:937–944. doi: 10.1007/s00299-007-0314-y
Germanà MA (2003) Haploids and doubled haploids in Citrus spp. In: Maluszynsky M, Kasha KJ, Forster BP, Szaejko I (ed) Doubled haploid production in crop plants: a manual. Springer, Dordrecht, pp 303–307
Germanà MA (2005) Protocol of somatic embryogenesis from Citrus spp. anther culture. In: Jain SM, Gupta PK, (ed) Protocol for somatic embryogenesis in woody plants. Springer, Dordrecht, pp 191–207
Germanà MA (2006) Doubled haploid production in fruit crops. Plant Cell Tiss Organ Cult 86:131–146. https://doi.org/10.1007/s11240-006-9088-0
Germanà MA (2007) Haploidy. In: Khan I (ed) Citrus genetics, breeding and biotechnology. CABI Publishing, Wallingford, pp 167–196
Germanà MA (2009) Haploids and doubled haploids in fruit trees. In: Touraev A, Forster BP, Jain SM (ed). Advances in haploid production in higher plants. Springer, Dordrecht, pp 241–263
Germanà MA (2011) Anther culture for haploid and doubled haploid production. Plant Cell Tiss Organ Cult 104:283–300. https://doi.org/10.1007/s11240-010-9852-z
Germanà MA, Chiancone B (2003) Improvement of Citrus clementina Hort. ex Tan. microspore-derived embryoid induction and regeneration. Plant Cell Rep 22:181–187. https://doi.org/10.1007/s00299-003-0669-7
Germanà MA, Crescimanno FG, De Pasquale F, Wang YY (1990) Androgenesis in 5 cultivars of Citrus limon L. Burm. f. In Vitro Cult XXIII IHC 300 30:315–324. https://doi.org/10.17660/ActaHortic.1992.300.46
Germanà MA, Ying Wang Y, Barbagallo MG, Iannolino G, Crescimanno FG (1994) Recovery of haploid and diploid plantlets from anther culture of Citrus clementina Hort, ex Tan. and Citrus reticulata Blanco. J Hort Sci 69:473–480. https://doi.org/10.1080/14620316.1994.11516478
Germanà MA, Chiancone B, Lain O, Testolin R (2005) Anther culture in Citrus clementina: a way to regenerate tri-haploids. Aust J Agric Res 56:839–845. https://doi.org/10.1071/AR05025
Germanà MA, Aleza P, Carrera E et al (2013) Cytological and molecular characterization of three gametoclones of Citrus clementina. BMC Plant Biol 13:1–8. https://doi.org/10.1186/1471-2229-13-129
Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser 41:95–98
Hidaka T, Yamada Y, Shichijo T (1979) In vitro differentiation of haploid plants by anther culture in Poncirus trifoliata (L.) Raf. Jpn J Breed 29:248–254. https://doi.org/10.1270/jsbbs1951.29.248
Huh MK, Yoon HJ, Choi JS (2011) Phylogenic study of genus citrus and two relative genera in Korea by trnL-trnF sequence. J Life Sci 21:1452–1459. http://dx.doi.org/10.5352/JLS.2011.21.10.1452
Iacuzzi N, Aleza P, Garcia-Lor A, Germanà MA (2019) Somatic embryogenesis through in vitro anther culture of Citrus sinensis L. Osbeck'Moro'. Acta Hortic 1230:25–34. https://doi.org/10.17660/ActaHortic.2019.1230.4
Jin SB, Park JH, Park SM, Lee DH, Yun SH (2016) Genetic phylogenetic relationship of the Jeju native Citrus ‘Byungkyool’ (Citrus platymamma Hort. ex Tanaka) using ITS (internal transcribed spacer) region of nuclear ribosomal DNA. Korean J Breed Sci 48:241–253. http://dx.doi.org/10.9787/KJBS.2016.48.3.241
Jin SB, Park JH, Park SM, Lee DH, Yun SH (2018) A phylogenic analysis of citrus cultivars native to Jeju using chloroplast DNA trnL-trnF and internal transcribed spacer region sequences. Hort Sci Technol 36:585–597. https://doi.org/10.12972/kjhst.20180059
Jin SB, Kim MJ, Choi CW, Park SM, Yun SH (2022) Anther culture-derived haploids of Citrus aurantium L. (sour orange) and genetic verification of haploid-derived regenerated plants. Plants 11:3022. https://doi.org/10.3390/plants11223022
Jung YH, Kwon HM, Kang SH, Kang JH, Kim SC (2005) Investigation of the phylogenetic relationships within the genus Citrus (Rutaceae) and related species in Korea using plastid trnL-trnF sequences. Sci Hortic 104:179–188. https://doi.org/10.1016/j.scienta.2004.08.008
Karjee S, Mahapatra S, Singh D, Saha K, Viswakarma PK (2020) Production of double haploids in ornamental crops. J Pharmacogn Phytochem 9:555–565
Kim SS, Han SG, Park YS, Park SM, Choi CW, Yun SH, Jin SB (2023) Development of pollen parent cultivar-specific scar markers and a multiplex SCAR-PCR system for discrimination between pollen parent and seed parent in citrus. Plants 12:3988. https://doi.org/10.3390/plants12233988
Lee S, Kim JS, Kang SH, Sohn SH, Won SY (2016) Rediscovery of haploid breeding in the genomics era. J Plant Biotechnol 43:12–20. https://doi.org/10.5010/JPB.2016.43.1.12
Mishra VK, Goswami R (2014) Haploid production in higher plant. Int J Chem Biol Sci 1:26–45
Murashige T, Skoog F (1962) A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol Plant 15:473–497. https://doi.org/10.1111/j.1399-3054.1962.tb08052.x
Niroula RK, Bimb HP (2009) Overview of wheat X maize system of crosses for dihaploid induction in wheat. World Appl Sci J 7:1037–1045
Parra-Vega V, Renau-Morata B, Sifres A, Seguí-Simarro JM (2013) Stress treatments and in vitro culture conditions influence microspore embryogenesis and growth of callus from anther walls of sweet pepper (Capsicum annuum L.). Plant Cell Tiss Organ Cult 112:353–360. https://doi.org/10.1007/s11240-012-0242-6
Prem D, Solís MT, Bárány I, Rodríguez-Sanz H, Risueño MC, Testillano PS (2012) A new microspore embryogenesis system under low temperature which mimics zygotic embryogenesis initials, expresses auxin and efficiently regenerates doubled-haploid plants in Brassica napus. BMC Plant Biol 12:1–19. https://doi.org/10.1186/1471-2229-12-127
Reece PC, Gardner FE (1959) Robinson, Osceola and Lee, new early maturing tangerine hybrids. Proc Fla State Hort Soc 72:49–50
Seguí-Simarro JM, Corral-Martínez P, Parra-Vega V, González-García B (2011) Androgenesis in recalcitrant solanaceous crops. Plant Cell Rep 30:765–778. https://doi.org/10.1007/s00299-010-0984-8
Sun L, Nasrullah, Ke F, Nie Z, Wang P, Xu J (2019) Citrus genetic engineering for disease resistance: Past, present and future. Int J Mol Sci 20:5256. https://doi.org/10.3390/ijms20215256
Wang SM, Lan H, Cao HB, Xu Q, Chen CL, Deng XX, Guo WW (2015) Recovery and characterization of homozygous lines from two sweet orange cultivars via anther culture. Plant Cell Tiss Organ Cult 123:633–644. https://doi.org/10.1007/s11240-015-0866-4
Wędzony M, Forster BP, Żur I et al (2009) Progress in doubled haploid technology in higher plants. In: Touraev A, Forster BP, Jain SM (ed) Advances in haploid production in higher plants. Springer, Dordrecht, pp 1–33
Woo JK, Yun SH, Yi, KU et al (2020) Identification of citrus varieties bred in Korea using microsatellite markers. Hortic Sci Technol 38:374–384. https://doi.org/10.7235/HORT.20200036

Download PDF

Version 1

posted

You are reading this latest preprint version

Induction and genetic verification of homologous haploid plants obtained through the anther culture of Citrus cultivars

Status:

Version 1

Abstract

Figures

Key Message

Introduction

Materials and Methods

Plant material pretreatment and anther culture

Induction of callus and somatic embryos

Plant regeneration

Genetic verification

Ploidy verification

Genetic phylogenetic analysis

Results

Plant regeneration from anther-cultured cells

Genetic verification

Polyploidy verification and morphological selection

Phylogenetic analysis

Discussion

Abbreviations

Declarations

Competing Interests

Funding

Author Contributions

Acknowledgments

Data availability

References

Status:

Version 1