C57BL/6J wild type, Socs3fl/fl (31), LysMCre-Socs3fl/fl (31), Cx3cr1gfp/gfp (27, 35) and LysMCre-Socs3fl/flCx3cr1gfp/gfp DKO mice (all in C57BL/6J background) were used in the study. The Socs3fl/fl mice served as WT control. The LysMCre-Socs3fl/fl mice were obtained by crossbreeding Socs3fl/fl mice with LysMCre mice (31). The Cx3cr1gfp/gfp mice were provided by Steffen Jung (Weizmann Institute of Science, Rehovot, Israel). The LysMCre-Socs3fl/fl mice and Cx3cr1gfp/gfp mice were used to generate heterozygous LysMCre+/−Socs3fl/−Cx3cr1+/gfp mice. Subsequent crossings between offspring mice allowed the generation of LysMCre-Socs3fl/flCx3cr1gfp/gfp DKO (Abbreviated as DKO in the following context) mice (Additional file 1). The genotype of the DKO mice was confirmed by PCR (Additional file 1C). Mouse strains used for this study were listed in additional file 2. All animal procedures were conducted in accordance with the Animals (Scientific Procedures) Act of the UK Home Office (1986) and were approved by the Animal Welfare and Ethics Review Body of Queen's University Belfast. All mice were housed at the Biological Research Unit at Queen's University Belfast in a 12-hrs light / dark cycle with free access to water and food.
Fundus images were obtained. Animals were anesthetized with an intraperitoneal injection of 60 mg/kg ketamine hydrochloride (Fort George Animal Centre, Southampton, UK) and 5 mg/kg xylazine (Pharmacia & Veterinary Products, Kiel, Germany). The pupils were dilated with a drop of tropicamide and phenylephrine (Chauvin, Essex, UK). Images were captured with a Nikon D90 camera via an endoscope (36, 37) or the Micron IV system (Phoenix Research Labs, Pleasanton, CA, USA). Retinal green fluorescent images in Cx3cr1gfp/gfp and DKO mice were acquired using the Micron IV system. The illumination settings and the gain were consistent in each subject. Images were saved in TIFF format.
The eyes were collected and fixed with 2% paraformaldehyde (PFA, Agar Scientific Ltd. Cambridge, UK) for 2 h at room temperature. The anterior segment (cornea, iris and ciliary body, and lens) of the eye was removed. Retinal tissue was carefully removed from the eyecup. Retinal tissues and RPE/choroid/sclera eye-cups were processed for flatmount staining using the protocol described in our previous paper (38, 39). The antibodies used in the study were detailed in Table 1. All samples were examined by Dmi8 fluorescence microscopy (Leica Microsystems CMS, Mannheim, Germany). Images were analysed using ImageJ (National Institutes of Health, Bethesda, MD, USA).
Table 1
Antibodies and binding protein/peptide
| Name | Dilution | Company | Host/Type |
Antigen | IBA-1 | 1:200 | Wako | Rabbit |
Cone arrestin | 1:1000 | Chemicon | Rabbit |
PKCα | 1:500 | Santa Cruz | Rabbit |
Secretagogin | 1:500 | Biovendor R&D | Sheep |
GFAP | 1:250 | Abcam | Rabbit |
Protein/peptide | Isolectin B4 | 1:200 | Vector | |
Alexa Fluor™ 594 Phalloidin | 1:100 | ThermoFisher | |
Secondary Ab | Alexa Fluor 594 | 1:400 | Invitrogen | Donkey anti-rabbit |
Alexa Fluor 488 | 1:400 | Invitrogen | Donkey anti-rabbit |
Streptavidin, Alexa Fluor™ 594 | 1:400 | Invitrogen | |
H&E staining and immunohistochemistry
Eyes were fixed as described above and processed for 6 µm-thick paraffin sections. Eye sections were dewaxed using xylene, dehydrated by ethanol and rehydrated by H2O. Sections were then processed for either H&E staining or immunohistochemistry. Antigen retrieval was carried out using 0.05% citraconic anhydride buffer (Sigma-Aldrich, St. Louise, Missouri, USA) in a 95 °C water bath for 30 min. Sections were permeabilized with 0.5% Triton 100X in PBS for 15 min at room temperature and blocked using 5% BSA for 1 h. Sections were then incubated with primary antibodies (Table 1) overnight at 4 °C. After thorough washes, samples were incubated with secondary antibody for 1 h at room temperature. Samples were mounted with Vectashield mounting medium containing DAPI (Vector Laboratories) and examined by fluorescence microscopy (Leica Dmi8). |
Quantification of microglial number in retinal and RPE/choroid flatmounts
Z-stack images (20X) with 1μm intervalswere taken from the mid-central part of the retina in each flatmount (4 images/flatmount). Cells in threedifferent layers, i.e., GCL+IPL, OPL, outer nuclear layer + photoreceptor layer (ONL+PRL) of each z-stack image were quantified by Fiji software (National Institutes of Health, Bethesda, MD). The numbers were normalized to per mm2 retinal area. For RPE/choroidflatmounts, images were obtained for the entire tissue and the total number of microglia was manually counted.
Quantification of retinal neurons
Fluorescent images were obtained to quantify the number of individual retinal neurons and neuronal structure. Three sections around the optic disc were used for retinal neuronal investigations, with 3-5 eyes used in each group. Four images were taken from the mid-central part of the retina in each eye section. The settings of fluorescence microscope remained constant between images and images were analyzed using FIJI software (National Institutes of Health, Bethesda, MD). The following retinal cells were quantified and analysed using the methods established in our groups(40, 64): 1) Rod and cone photoreceptor (cone arrestin+) cell count ; 2) Cone photoreceptor segment length ; 3) Cone-bipolar (PKCα+) cell number; 4) Rod-bipolar (secretagogin+) cell number; and 5) GABA+amacrine cell number. Cell numbers were averaged and normalised.The quantificationwas confirmed by two independentresearchers.
Quantification of microglial cells and RPE morphology in aged DKO RPE/Choroid flatmounts
Five fluorescent images (40X objective lens) were taken from each RPE/choroidal flatmount. The number of microglial cells and the morphology of RPE in aged DKO mice were quantified. 6 eyes per group were used in this study. FIJI ImageJplug-in Bio-voxxel software (41) was used to outline the shape of each RPE cell. For each RPE cell, the area and perimeter were measured using FIJI and the shape factorwas calculated by the equation 4𝜋∗𝐴𝑟𝑒𝑎/𝑃𝑒𝑟𝑖𝑚𝑒𝑡𝑒𝑟2(42).The shape factor value ranges from 0 to 1, with one indicating a perfect circular cell, and zero indicating an elongated cell. The shape factor of a perfect hexagonal cell (eg. an RPE cell) is around 0.9 (43).The relationship between microglial cell number and the shape factor of the RPE was analyzed by linear regression using SPSS statistics software (IBM, Chicago, IL, USA).The quantification was confirmed by two independentresearchers.
Primary microglial cell culture and treatments
Microglia were cultured from 4-6 week old Socs3fl/fland DKO mice using a previously described protocol(44). Briefly, smashed brain tissue suspensions were filtered through a 70 μm cell strainer (BD Falcon, BD Biosciences). Then the cell suspensions were centrifuged at 600g for 8 min. The cell pellet was re-suspended in media containing 10% fetal calf serum (FCS), 20ng/ml M-CSF (Bio-techne, Minneapolis, Minnesota,US), 1% penicillin/streptomycin, 1 mM glutamine in DMEM/F12 (all from Thermo Fisher Scientific, Waltham, MA, USA), and seeded in a 6-well plate (Thermo Fisher Scientific). Floating cells were removed 3 days later and media were changed every 3 days until cells reached 90% confluence. The phenotype of the cells was confirmed by their CD11b and IBA-1 expression (>90%).The microglia were then treated with 1) M1, or pro-inflammatory stimuli by adding 100ng/ml IFN-γ (Bio-Techne)and 50ng/ml LPS (Sigma-Aldrich)or 2) M2, or anti-inflammatory stimuli by adding 20ng/ml IL-4 (Bio-Techne) overnight. The cells were collected for real-time RT-PCR for cytokine/chemokine gene expression and the supernatants were collected for Luminex assay.
Phagocytosis assay
Microglia from Socs3fl/flor DKO mice were seeded into a 96-well plate at the density of 1×105/well. The phagocytosis assay was performed using 1) the pHrodo™ Red E. coliBioParticles™ and2) Escherichia coli (K-12 strain) Alexa Fluor 594 BioParticles™ (both from Thermo Fisher Scientific)following the manufacturer’s instructions. For pHrodoRed E.coli, fluorescence intensity was measured at 0.5h, 1h, 2hand 3h after incubation using Fluostar Omega microplate reader (BMG Labtech, Ortenberg, Germany) with 550 nm excitation wavelength and a 600 nm emission filter. Bioparticles alone without cells acted as a background control. Phagocytosis was calculated by subtracting the average fluorescence intensity of the background control wells from the experimental wells. Alexa Fluor 594 conjugated E.coli was washed with PBS after 0.5h incubation, and fluorescence intensity was measured with the same wavelength. Representative images were taken using the Leica DMi8 microscope.
Reverse transcription and real-time RT-PCR
Total RNA was extracted from retinal tissues by RNeasy Mini kit (Qiagen Ltd, Crawley, UK) according to the manufacturer’s instructions. The quantity and quality of RNA were determined using a NanoDrop ND-1000 spectrophotometer (NanoDropTechnologies, Wilmington, DE). The same amount of RNA wasapplied for reverse transcription using SuperScrip™ II Reverse Transcriptase kit and random primers (Invitrogen). Real-time RT-PCR was performed using SYBR Green Master (Roche Diagnostics GmbH, Mannheim, Germany) in the LightCycler® 480 system (Roche Diagnostics GmbH). The primer sequences are listed in Table 2. β-actin was used ashousekeeping control.
Table 2. Primers and their sequences for real time RT-PCR
Genes
|
Forward
|
Reverse
|
βactin
|
GGCACCACACCTTCTACAATG
|
GGGGTGTTGAAGGTCTCAAAC
|
TNFα
|
TCTCATGCACCACCATCAAGGACT
|
ACCACTCTCCCTTTGCAGAACTCA
|
iNOS
|
TCTTTGACGCTCGGAACTGTAGCA
|
ACCTGATGTTGCCATTGTTGGTGG
|
IL-1β
|
AAGGGCTGCTTCCAAACCTTTGAC
|
ATACTGCCTGCCTGAAGCTCTTGT
|
IL-6
|
ATCCAGTTGCCTTCTTGGGACTGA
|
TAAGCCTCCGACTTGTGAAGTGGT
|
IL10
|
GGCAGAGAACCATGGCCCAGAA
|
AATCGATGACAGCGCCTCAGCC
|
IL12p40
|
ATGGCCATGTGGGAGCTGGAGAAAG
|
GTGGAGCAGCAGATGTGAGTGGCT
|
IL23p19
|
ATGTGCCCCGTATCCAGTGT
|
GGGGTGATCCTCTGGCTGGA
|
ARG1
|
TTATCGAGCGCCTTTCTCAA
|
TGGTCTCTCAGGTCATACTCTGT
|
CD206
|
TCAGCTATTGGACGCGAGGCA
|
TCCGGGTTGCAAGTTGCCGT
|
CCL2
|
GCATCCACGTGTTGGCTCA
|
CTCCAGCCTACTCATTGGGATCA
|
CCL5
|
ACTCCCTGCTGCTTTGCCTAC
|
GAGGTTCCTTCGAGTGACA
|
CXCL2
|
AAGTTTGCCTTGACCCTGAA
|
AGGCACATCAGGTACGATCC
|
Luminexmultiplex assay
The cytokine & chemokine magnetic bead panel kit (LXSAMSM-10, R&D, USA) was designed to detect CCL2, CCL5, CXCL2, CXCL10, Granulocyte-macrophage colony-stimulating factor (GM-CSF), IL-1β, IL-6, IL-10, IL-12p70 and TNF-α in the supernatant after different treatments. All procedures were carried out according to the manufacturer’s instructions. The signals were detected and data analyzed by the Bio-plex 200 System (BIO-RAD, Richmond, CA). Chemokine concentrations were calculated using StarStation software (Applied Cytometry Systems, UK) with a four parameter curve-fitting algorithm applied for standard curve calculation.
Retinal explants and microglia co-culture
The method for retinal explants and microglia co-culture was adapted from a previously published paper (45). Briefly, microglial cells from Socs3fl/fland DKO mice were seeded onto polycarbonate filters (Fisher scientific, UK) and cultured inDMEM/F12 for 24h to allow firm attachment to the filters. Cells were then given M0/ M1/ M2 treatments for overnight. Cells were washed with PBS three times to remove stimuli. Retinas from C57BL/6J mice were placed with the photoreceptor sidein contact with microglia for 24h at 37˚C. Retinal explants were fixed and stained for cone arrestin.
Statistical analysis
Statistical analysis was performed inGraphPad Prism (GraphPad Software, San Diego, CA, USA) and SPSS. Student’s t tests were performed for analysis and comparisons between two groups. Two-way analysis of variance (ANOVA) followed by Sidak’sor Tukey multiple comparison test were used to investigate the difference between groups as indicated in individual figure legends. Data are presented as mean ± SD and significance was established as P < 0.05.