Sample collection
The experimental material (blood samples collected from the heard and uteri) was collected post mortem 15–20 min after the shot from wild hinds in the Strzałowo Forest District (North -East of Poland; N = 10) during hunting season 2018/2019 (hunting license: ZG7521-3/2018/2019) and from breeding females from a farm in Rudzie near Gołdap (North -East of Poland; N = 24). A total number of forty two (N = 36) 3–4-year-old hinds were evaluated, and the age was confirmed, according to Korzekwa et al. [25]. All veterinary procedures were conducted after receiving the agreement of the Local Ethical Committee in Olsztyn (Poland, Agreement Number 7/2019).
The first experimental group (4th day of the estrous cycle) representing the follicular phase (N = 8), and the second experimental group (13th day of the estrous cycle) representing the luteal phase (N = 8) were obtained on the 17th and 23rd of September 2019 after pharmacological synchronization on the farm in Rudzie. The estrus and ovulation induction hinds during the estrous cycle was performed by applying a double controlled internal drug-release (CIDR) insert (1.38 g of P4; Pfizer Animal Health, New York, US), using a 12-day regimen of intravaginal CIDR devices. For better synchronization, the device was replaced after 7 days to maintain the luteal concentration of P4 until the end of the treatment period. Additionally, 200 IU of human chorionic gonadotropin (hCG; Folligon, Intervet, International B.V., Boxmeer, Holland) was injected intramuscularly on day 12. The estrus was observed 54–56 h after the second CIDR insert removal in the hinds. The day of the estrous cycle was evaluated by macroscopically observing the ovaries and uterus and confirmed by determining E2 and P4 levels in the blood plasma using an Enzyme-Linked Immunosorbent Assay (ELISA) [25, 26]. The reasons for culling animals from the herd on the farm were for economic considerations and herd renewal.
The third group (hinds in the anestrus) were collected from non-pregnant females on the 10th of May, 2019 (N = 8) on the farm in Rudzie. The last experimental group (pregnant hinds) was possessed between the 2nd and 4th of January 2019 (N = 8) from wild individuals in Strzałowo Forestry. The uterine horn tissue was immediately placed on ice and transported in liquid nitrogen to the laboratory, where it was subsequently stored at -80°C for further procedures. Plasma samples were collected by jugular venipuncture (EDTA-loaded vacuum tubes). Samples were held in ice until centrifugation at 3000 g at 4°C for 10 min after which the plasma was placed on ice and transported to the laboratory within 30 min and stored at -20°C until assayed by ELISA.
Experimental procedure
P450, 3β-HSD, 17β-HSD, and AKR1C1 enzymes engagement in the estrous cycle, anestrus, and pregnancy
The mRNA and the protein expression for P450, 3β-HSD, 17β-HSD, and AKR1C1 enzymes were determined in the uterine endometrial and myometrial tissue by real-time RT -PCR and Western Blotting.
Receptivity of uterus for P4 and E2 during the estrous cycle, anestrus and pregnancy
The mRNA and the protein expressions for P4 and E2 receptors were determined in the endometrium and myometrium tissue by real-time RT -PCR and Western Blotting.
Concentration of LH, FSH, P4, E2 and T4 involved in enzymes metabolism
LH, FSH, P4, E2, and T4 concentrations in the blood plasma were assayed by ELISA.
Determinations
Total RNA isolation and reverse transcription
Uterine tissue was first homogenized in liquid nitrogen, and then total RNA was isolated with TRI-Reagent (Sigma-Aldrich, Darmstadt, Germany, T9424), according to the manufacturer's instructions. After extraction, the purity and RNA concentration was assessed with NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific, Wilmington, DE). The wavelength ratio for all samples neared 2.0 for 260/280 nm and ranged between 1.8 and 2.2 for 260/230 nm. RNA, 1 µg was calculated based on spectrophotometric measurement and then reverse –transcribed using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Cheshire, UK, 4368813), which contained a MultiScribe™ reverse transcriptase with random primers, RNase Inhibitor, MgCl2, dNTP mixture, and Nuclease -free H2O. The samples were incubated at 25°C for 10 min followed by 37°C for 2 h. Finally, to inactivate the reverse transcriptase, the temperature was increased to 85°C for 5 min. Obtained cDNA was kept at -20°C until further analysis.
Real-Time PCR.
The mRNA expression of P450, 3β-HSD, 17β-HSD, AKR1C1, PRs, and ERα enzymes in endometrium and myometrium was analyzed by RT-PCR using Applied Biosystems Real-Time 7900 system (Applied Biosystems, Cheshire, UK), with SensiFAST SYBR Hi-ROX Kit (Bioline Reagents, London, UK, BIO-92002) according to the manufacturer’s instructions. Gene-specific primer sequences of P450, 3β-HSD, 17β-HSD, AKR1C1, PRs, and ERα genes were designed using Primer Express Software v.3. The final PCR mix (10 µL) contained 3 µl of reverse-transcribed cDNA (15 ng), 5 µL of SensiFAST SYBR Hi-ROX Mix (SYBR Green and 3 Mm of MgCl2) and 0.2 µl of forward and reverse primers (with 0.5 µM concentration). Each run was proceeded in duplicate and further the average was considered as a single sample. The results were normalized according to the best reference gene, glyceraldehyde 3-phosphate dehydrogenase (GAPDH), and chosen from two other genes (β-actin, 18S ribosomal RNA) by the NormFinder software (Aarhus University, Denmark). The primer sequences are presented in Table 1.
Table 1
Oligonucleotide sequences used for Real-time PCR.
Gene name
|
Primers sequence (5’ – 3’)
|
Amplicon length (bp)
|
EMBL
|
GAPDH
|
F: CACCCTCAAGATTGTCAGCA
R: GGTCATAAGTCCCTCCACGA
|
103
|
BC 102589
|
ACTB
|
F: CCAAGGCCAACCGTGAGAAAAT
R: CCACATTCCGTGAGGATCTTCA
|
256
|
K00622
|
RN18S1
|
F: AAGTCTTTGGGTTCCGGG
R: GGACATCTAAGGGCATCACA
|
365
|
AF176811
|
3β-HSD
|
F:TGTCATTGACGTCAGGAATGC
R:TACGCTGGCCTGGACACA
|
100
|
NM_176644.2100
|
P450
|
F: TTGTGAACCAGTGGCAGATCAA
R: GGCCGGAACTCAGATGGAT
|
64
|
AF091667.1
|
PR
|
F: GGCAATTGGTTTGAGGCAAA
R: TCTTGGGTAACTGTGCAGCAA
|
196
|
AJ557823.1
|
ERα
|
F: ATGACCCTGCACACCAAAG
R: CCTCGGGGTAGTTGTACACG
|
100
|
NM_001001443.1
|
17β-HSD
|
F: TGTGCCCTCTCGGATTGTAG
R: AGTGACAGCCCTGACCAAAG
|
244
|
AF265564
|
AKR1C1
|
F: ATACAACGTGGGGTTGTGGT
R: AGGACCATGATGGATTGCTC
|
126 |
S54973.1 |
glyceraldehyde 3-phosphate dehydrogenase (GAPDH), 18S ribosomal RNA (RN18S1), β-actin (ACTB), aldo-keto reductase family 1 member C1 (AKR1C1), 3 -beta-hydroxysteroid dehydrogenase (3β-HSD), 17 -beta-hydroxysteroid dehydrogenase (17β-HSD), cytochrome P450 aromatase (P450), estrogen receptor 1 (ESR1), and progesterone receptor (PR).
For efficiency evaluation, standard curves consisting of serial dilutions of the cDNA were plotted and the best cDNA concentration was chosen for further analysis. The first stage of the reaction was the initial denaturation of the strand and activation of the polymerase (95°C for 2 min). The next stage consisted of 45 cycles of successive reactions: denaturation (95°C for 5 sec), primer annealing, and elongation of PCR products (6°C for 20 sec). To ensure the reaction’s specificity, the melting curves of the PCR products were analyzed after the amplification was completed. Data obtained were analysed using the Miner program. Control reactions lacking the template or primers were performed to confirm that products were free of primer-dimers and genomic DNA contamination, respectively. PCR products were sequenced and compared with the appropriate genes in NCBI.
Total protein isolation
The uterine tissue (30 mg; separately endometrium and myometrium) was homogenized on ice in a RIPA lysis buffer (5 mM EDTA, 150 mM NaCl, 50 mM TRIS, 0.1% SDS, 1% Triton X-100, 0.5% sodium deoxycholate, and protease inhibitor- Sigma-Aldrich, S8830, pH 7.4). The obtained lysate was centrifuged at 10000 g for 20 min at 4°C, and the supernatant was transferred to a fresh tube and sonified. The protein concentration was estimated according to the Bradford’s method. The lysate was stored at -80°C until further analysis.
Western blot analysis.
The expression of P450, 17β-HSD, 3β-HSD, AKR1C1, PRs, and ERα proteins in the uterine tissues was determined by Western Blotting. For each sample, 30 µg of total protein was mixed with 5 µL of SDS gel-loading buffer, heated at 95°C for 5 min, and separated in 10% SDS-PAGE. Afterward, the proteins were transferred on 0.2 µm nitrocellulose membranes in transfer buffer during the electroblotting for 1.5 h. The membranes were blocked in a 5% solution of skimmed milk with 1xTBS-T for 1.5 h in room temperature (RT), and then incubated overnight at 4°C with specific primary antibodies for P450 (Abcam, Cambridge, UK, ab28146, 1:1000), 17β-HSD (Thermo Fisher Scientific, PA5-30063, 1:500), 3β-HSD (Gene Tex, Ca, USA, GTX114081, 1:500), AKR1C1 (Thermo Fisher Scientific, PA5-21672, 1:500), PRs (Thermo Fisher Scientific, MA1-410, 1:1000), and ERα (Thermo Fisher Scientific, MA1-310, 1:1000). As a reference the protein β-actin (ACTB, Sigma-Aldrich, A2228, 1:1000) was used. After that, the membranes was washes three times for 10 min in 1xTBS-T solution and incubated with secondary polyclonal anti-rabbit antibodies for P450, 3β-HSD, 17β-HSD, and AKR1C1 enzymes (Sigma-Aldrich, A3687, 1:10000), and anti-mouse for PRs and ERα (Sigma-Aldrich, A3562, 1:10000) for 1.5 h at RT. The protein bands were visualized using AP buffer and NBT-BCIP solution (Sigma-Aldrich, 72091). Western blots were quantitated using Quantity One 1-D Analysis Software (Bio-Rad, Hercules, CA, USA).
ELISA
Plasma concentrations of LH, FSH, T4, P4, and E2 after validation [25] were evaluated using ELISA. LH and FSH concentrations were estimated using a kit for bovine (Cloud-Clone Corp., TX, USA, CEA441Bo for LH and CEA830Bo for FSH). The assay’s sensitivity for LH was 137.3 pg/ml and for FSH was 0.93 pg/ml. The mean intra- and inter- assays CVs were 10% and 12%, respectively. A commercial kit (Abbexa, abx574314) designed to measure the concentration of T4 has been assessed for measuring T4 in the plasma. The sensitivity of the assay was 1.95 pg/ ml. The intra- and inter- assays CVs were 5.8 and 7.9%, respectively. According to the manufacturer’s instructions, the P4 and E2 concentrations were measured in plasma samples using an ELISA kit (Bioassay Technology Laboratory, Shanghai, China, E0018Bo for P4 and E0004Bo for E2). The assay’s sensitivities for P4 and E2 were 0.22 ng/ml and 2.53 pg/ml respectively. The mean intra- and inter -assays CVs were found to be 8% and 10%, respectively. Each run was proceeded in duplicate and further the average was considered as a single sample. All samples were detected in duplicate at 450 nm.
Statistical analysis.
GraphPad PRISM (Version 8.3.0, San Diego, CA, USA) was used for data analysis. The relationship between the mRNA and protein expression between endometrium and myometrium and between each experimental group throughout endometrium and myometrium was determined using two-way analysis of variance (ANOVA) followed by a Bonferroni post hoc test. One-way ANOVA was used for analysis of hormones` concentration, followed by Tukey’s test. All numerical data were expressed as the arithmetic mean ± standard error of mean (SEM). Statistical significance was P < 0.05.