Construction and Preclinical evaluation of BCL3-Degrading PROTACs for Enhanced Colorectal Cancer Therapy

doi:10.21203/rs.3.rs-4780236/v1

Download PDF

Article

Construction and Preclinical evaluation of BCL3-Degrading PROTACs for Enhanced Colorectal Cancer Therapy

https://doi.org/10.21203/rs.3.rs-4780236/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Colorectal cancer (CRC), with high incidence and mortality rates, ranks among the most prevalent malignant tumors. Molecular targeted therapies have shown impressive clinical outcomes for CRC therapy. However, the clinical success of targeted treatment of CRC is often limited by resistance. There is a pressing clinical demand for novel targeted therapeutics to enhance the prognosis of CRC patients. B-cell lymphoma 3 (BCL3), an integral constituent of the inhibitory NF-κB (IκB) family, has been reported to be frequently overexpressed in colorectal cancers and involved in the tumor etiology and progression. However, the BCL3 protein lacks “pocket” for covalent inhibitor binding, which prevented the relatively matured covalent inhibitor development. In this study, we have developed a small molecule agent (named PJ1799) targeting and degrading BCL3 via Proteolysis Targeting Chimera (PROTAC) strategy. PJ1799 has been designed to encourage efficient degradation of BCL3 in tumor cells via ubiquitin-proteasome system. As a result, BCL3 demonstrated considerable inhibitory potency for colorectal cancer cells through inactivating multiple key signaling pathways, including the PI3K-AKT and JNK/p38-MAPK pathways. To further enhance the tumor targeting of PJ1799 and address its pharmacological limitations, ligand modification and nanoformulation have been conducted through folic acid conjugate and albumin loading, respectively. The modified PJ1799 drugs possessed promising anti-tumor effects in subcutaneous and intraperitoneal tumor models in vivo without undesired side effects observed. In conclusion, we report here a novel BCL3 targeting PROTAC molecules that may provide potential therapeutic option for colorectal cancer. Besides, PJ1799 serves as a potential probe to explore biological functions of BCL3.

Biological sciences/Drug discovery/Medicinal chemistry/Drug discovery and development

Biological sciences/Cancer/Cancer therapy/Drug development

Colorectal cancer (CRC) ranks third in incidence and second in mortality among malignant tumors worldwide¹. Currently, chemotherapy occupies as a major treatment and still widely used for CRC patients with stage II or more advanced stages². However, the considerable toxicity associated with fluoropyrimidine-based chemotherapy severely restricts their extensive application³. Despite that the immunotherapeutic drugs have provided considerable prognosis for some CRC patients, the effectiveness of immune checkpoint inhibitors largely depend on the microsatellite instability (MSI) status and DNA mismatch repair (dMMR) function of the specific tumor⁴. Thus, only limited percentage (15%) of patients had benefit from immunotherapy⁵. In recent years, the landscape of CRC drug development has predominantly been characterized by a sustained focus on the targeted therapeutic agents, such as the epidermal growth factor receptor (EGFR)⁶, the vascular endothelial growth factor and its receptor (VEGF/VEGFR)^{7, 8}, and the human epidermal growth factor receptor 2 (HER2)⁹. These targeted drugs have significantly enhanced patient prognosis and quality of life. Despite the progress in targeted therapy agents, the development of some important oncogenic targets, such as the KRAS and MYC, were still in deep struggling due to the following reasons. Firstly, the most essential problem lays in the absence of ‘pockets’ for covalent binding with small molecules^{10, 11}. Secondly, although some small molecules can bind to the target protein at certain domain, some of the classical oncogenic protein have multiple functions and several active domains in their structures. As a result, the signle site binding strategy with covalent ligands may not have comprehensive inhibition¹¹. In summary, the development of pharmaceuticals with strategies for such ‘undruggable’ targets holds substantial implications for precision treatment for CRC patients and indeed, for majority of solid tumors.

The advancement of Proteolysis-Targeting Chimeras (PROTAC) technology has opened up new avenues for addressing previously “undruggable” targets¹². PROTAC therapeutics are typically composed of three integral components: a ligand targeting the protein of interest (POI), a ligand binding with the E3 ubiquitin ligase, and a linker to connect two ligands, so as to allow the cellular ubiquitin-proteasome system (UPS) recognize and degrade the POI¹³. This technology catalyzes protein degradation by leveraging cellular intrinsic mechanism. Once the POI has been degraded by UPS, PROTACs will be released and free to bind with POI again. Thus, targets can be inhibited at drug concentrations much lower than covalent inhibitors¹⁴. Additionally, PROTACs is also a better strategy for inhibiting POIs with multiple functional domians by degradation of protein rather than occupying their functional site.

B-cell lymphoma 3 (BCL3), is a member of the inhibitory NF-κB (Nuclear Factor kappa-light-chain-enhancer of activated B cells) family. It exerts influence on the transcription of NF-κB-associated downstream genes through its interaction with the p50/p52 transcription factors^{15, 16}. BCL3 has significant implications for various cellular functions, including proliferation, differentiation, apoptosis, and immune response¹⁷. Several studies have revealed BCL3 overexpression in both clinical CRC patients and cell lines. Highly expressed BCL3 promotes tumor development, metastasis and even drug resistance by regulating gene transcription, thus leads to poorer prognosis^{18, 19}. Small molecule inhibitors targeting proteins binding pocket face challenges when dealing with transcription and splicing fators including BCL3. As a transcription co-regulator protein, BCL3 is difficult to be selectively inhibited by small molecules because its conformation resembles a “spring” and lacks a distinct small molecule binding pocket²⁰. In this regards, the report by Soukupova et. al on the effect of a small molecule JS6 is notable, in which JS6 could inhibit the protein-protein interaction between BCL3 and p50²¹. Although JS6 showed effect in suppressing the metastasis of breast cancer cells, the antitumor effect of JS6 was not potent enough for clinic application. On one hand, this may due to the limited binding affinity between BCL3 and JS6. On the other hand, the blocking of N terminal site of BCL3 by JS6 may have difficulties in blocking all the functions of BCL3.

Herein, a PROTAC drug targeting BCL3 (named PJ1799) has been designed and synthesized, which successfully recruited ubiquitin and initiated proteasomal degradation of BCL3 in vitro and in vivo. By inducing BCL3 degradation, PJ1799 has effectively suppressed multiple oncogenic signaling pathways in CRC cells, including NF-κB, PI3K-AKT, and JNK/p38-MAPK pathways. Moreover, to optimize tumor selectivity, bioavailability and tumor aggregate of PJ1799, further ligand conjugation and nanoscale formulation have been conducted respectively. The modified PJ1799 exhibited superior selectivity, potency, robust anti-tumor effects in BCL3-dependent CRC tumor cells, patient derived organoid, and mice models. The PROTAC-mediated degradation of BCL3 represents a novel and promising therapeutic approach for CRC.

CRC overexpressed BCL3 associating with tumor staging and prognosis.

To verify BCL3 expression significance in CRC, immunohistochemistry (IHC) analysis of 92 pairs of CRC patient tumor tissues and adjacent normal intestinal tissues has been performed. Comparing with adjacent normal intestinal glandular tissue, BCL3 was highly expressed in CRC tumor tissues (Fig. 1a and supplementary Fig. 1). Moreover, high expression level of BCL3 was positively related with tumor stage (Fig. 1b). The overall survival (OS) period was significantly shorter in the CRC patients with higher BCL3 expression (Fig. 1c). Consistently results have been illustrated by utilizing a combination of TCGA and GTEx database, more than eight hundred cases. The RNA sequencing for both colon and rectal cancers revealed upregulation of BCL3 transcription in tumorous tissues (Fig. 1d and supplementary Fig. 2a). High BCL3 expression was also obviously correlated with unfavorable prognoses (supplementary Fig. 2b). Notably, among six prevalent types of gastrointestinal malignancies, BCL3 was markedly overexpressed in tumor tissues relative to normal tissues, while hepatocellular carcinoma was the only exception (supplementary Fig. 2c). Considering regional diversity of CRC patients, tumor tissues and adjacent normal intestinal tracts tissue derived from six surgical patients in the Seventh Affiliated Hospital of Sun Yat-sen University have been analyzed, BCL3 expression was confirmed to be significantly higher in tumor tissues (Fig. 1e). In order to facilitate cellular based analysis, BCL3 expression has been measured by western blotting (WB) in seven CRC cell lines and four noncancerous cell lines. BCL3 was obviously overexpressed in CRC cells, while all the noncancerous cells kept low BCL3 expression level (Fig. 1f − 1g).

Altogether, BCL3 was significantly expressed in CRC cell lines and patients derived tumor samples, and its expression level correlated with poor prognosis in CRC patients. These results together indicated crucial roles of BCL3 in CRC malignancy and progression.

Design and syntheses of a novel BCL3 targeting PROTAC.

Despite the burgeoning body of research underscoring the pivotal role of BCL3 in the etiology and progression of CRC¹⁷, the development of potent BCL3 inhibitor remains elusive. The breakthrough came when Soukupova and colleagues developed a small molecule named JS6²¹, a inhibitor of the interaction between BCL3 and p50. JS6 showed suppression for the metastatic phenotype in breast cancer with very limited cytotoxicity to tumor cells. Therefore, PROTAC technique could be a better solution in targeting BCL3 and a PROTAC molecule, PJ1799 was designed based on JS6. Firstly, JS6 has been synthesized as formerly reported²¹, and the synthesized JS6 was confirmed to have binding effect with BCL3 and could interrupt the interaction with p50 (supplementary Fig. 3–4, refer to the Methods section for specific synthesis steps of JS6). According to molecular docking, the fluorided benzene of JS6 was positioned opposite to protein binding site²¹. Thus, modification on the fluorided benzene has less possibility to disrupt the JS6 to target BCL3. To add a bromide group on the para-position of fluoride to connect the residue domain of PROTAC molecule, the JS6 has been synthesized with 5-bromo-2-fluorobenzoyl chloride as starting material instead of 2-fluorobenzoyl chloride. While cereblon is a prevalent choice for PROTAC design to recruit ligands¹³, its function as a molecular glue has been reported to bind and degrade neosubstrates²². Here, we opted for the VHL ligand, which, unlike cereblon, has not been reported to function as a molecular glue. Furthermore, VHL has been found to be highly expressed in several cancers^{23, 24}. Eventually, the bromide JS6 and the PEG-VHL were coupled through Miyaura reaction to afford the PROTAC molecule, PJ1799 with 39% yield (Fig. 2a and supplementary Fig. 5, refer to the Methods section for specific synthesis steps of PJ1799). It is worth mentioning that before actual synthesis of PJ1799, molecular docking was conducted to simulate the binding mode of PJ1799 with BCL3, which turned out to have considerable affinity (Fig. 2b).

Theoretically, the degradation of target protein due to PROTAC drug treatment depends on the cellular ubiquitination levels, rather than decrease of mRNA levels²⁵. To test action fashion of the synthesized PROTAC, PJ1799, RNA sequencing and proteomic detection were performed in HCT15 CRC tumor cells post-drug administration. BCL3 protein level was reduced by PJ1799(Fig. 2c) while no significant alteration in mRNA levels was observed (Fig. 2d). In the PROTAC-mediated protein degradation, ubiquitination modification of targeting protein is an early step for proteasome pathway. Immunoprecipitation experiments were thus performed in 293T cells using Flag-tagged exogenous BCL3 with MG132 as positive control. PJ1799 treatment indeed increased the ubiquitination and degradation of BCL3 (Fig. 2e). At the same time, BCL3-targeted PJ1799 can degrade BCL3 in tumor cells in a concentration-dependent manner (Fig. 2f – 2g), with a half-maximal degradation concentration (DC₅₀) less than 300 nM (supplementary Fig. 6a), while the reduction of BCL3 protein level is not caused by a decrease in RNA (supplementary Fig. 6b − 6c). Additionally, PJ1799 could degrade BCL3 protein in tumor cells in a time-dependent manner (Fig. 2h – 2i), and the degradation rate reached over 50% within 48 hours (supplementary fig. S6d), while JS6 did not show any BCL3 degradation effect (supplementary Fig. 6e − 6f). Next, proteasome inhibitor MG132 and lysosome inhibitor NH₄Cl were used to recover BCL3 degradation after PJ1799 treatment (Fig. 2j – 2m), the results confirmed PJ1799 antagonized the ubiquitin degradation of BCL3(Fig. 2j – 2k). In summary, PJ1799 efficiently increased ubiquitin binding to BCL3, and promoted protein degradation through the proteasome pathway in CRC cells.

PJ1799 inhibit tumor cell progression effectively.

In the cytotoxicity test against a spectrum of CRC cell lines, JS6 did not exhibit significant inhibition effect even at high concentration of 100 µM (Fig. 3a). The cytotoxic efficiency of PJ1799 is nearly 200 times greater than JS6 against CRC cells (supplementary Fig. 7). Meanwhile, the half-maximal inhibitory concentration (IC₅₀) of PJ1799 was nearly half less in BCL3 highly expressed CRC cell lines (Fig. 3b), compared to noncancerous cell lines with lower BCL3 expression (Fig. 3c – 3d). The difference of cytotoxicity offered PJ1799 a safe dosage for in vivo administration.

To further validate the inhibition effects of PJ1799 against CRC, calcein/PI staining experiment was performed to assess cellular viability after DMSO, JS6 and PJ1799 administration separately. The results showed that PJ1799, at a concentration of 0.25 µM, could induce tumor cell death, whereas JS6, even at a concentration that significantly inhibited p50 interaction (30 µM), did not affect tumor cell viability (Fig. 3e – 3f, and supplementary Fig. 8). Additionally, colony formation assay was conducted to assess if PROTAC-mediated degradation of BCL3 would affect clonogenic forming potential of CRC cells. PJ1799 at 0.25µM could significantly inhibit the clonogenicity of tumor cells after 48 hours treatment (Fig. 3g – 3h). Considering several research findings about BCL3 function in neoplasms^{26, 27, 28, 29}, transwell assay and flow cytometry assay have been conducted to investigate tumor cell migration and cell cycle arrest induced by BCL3 degradation. PJ1799 exhibited significant potency in suppressing tumor cell migration compared to JS6 (supplementary Fig. 9), and caused tumor cell cycle arrest at G0/G1 phase (supplementary Fig. 10).

Subsequently, the cytotoxic efficacy of PJ1799 on organoids derived from CRC patients in Seventh Affiliated Hospital of Sun Yat-sen University was examined, since the organoids exhibit more closely to physiological CRC tumor. Utilizing bright-field microscopy, a progressive fragmentation of the tumor organoid spheres positively correlated with the increase of PJ1799 concentration (Fig. 3i). The calcein/PI staining corroborated the organoid mortality as the drug concentration escalated, with an IC₅₀ of 0.8 µM. While JS6 did not demonstrate any discernible cytotoxic impact on the CRC organoids (Fig. 3j). To summarize, PJ1799 efficiently inhibited tumor progression and invasion in both CRC cellular and organoid model via degrading BCL3.

PJ1799 induces apoptosis in CRC cells via AKT and JNK/p38-MAPK signaling pathways.

To delve deeper into the cellular cascades ensuing, BCL3 was knocked down using RNA interference (RNAi) technique (supplementary Fig. 11). Both PJ1799-treated cells and BCL3-knocked down cells were evaluated by qPCR assay of a panel comprising eight chosen molecules, each extensively documented for their tumor-associated roles (Fig. 4a). The post-PJ1799 exposure analysis substantiated seven of the eight molecules mirrored the physiological alterations observed in BCL3-specific knockdown, suggesting analogous cellular impacts. Among these, key effectors within the canonical NF-κB axis, IL1B, TNFA, and MYC, were conspicuously suppressed.

Subsequently, a comprehensive transcriptomic sequencing analysis of PJ1799 (400 nM) treated HCT15 was undertaken to discern the precise mechanisms underlying PJ1799’s cytotoxic influence on neoplastic cells. The Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis revealed the top 10 significantly downregulated pathways, among which, the PI3K-AKT and Wnt pathways (Fig. 4b) have been confirmed to promote the development and progression of CRC, and to be associated with BCL3 functions^{18, 29}. Based on the sequencing data analysis via Gene Set Enrichment Analysis (GSEA), PJ1799 treatment has exhibited a potent inhibitory effect on the incidence of colorectal adenocarcinoma (Fig. 4c). Notably, the MAPK signaling pathway was also significantly inhibited after PJ1799 treatment (Fig. 4d). Up to our knowledge, this is the first report that the absence of BCL3 led to suppression of MAPK pathway, particularly regarding the p38-MAPK pathway. Thus, BCL3 may have promoted tumor progression by stimulating several key signaling pathways synergistically, including PI3K-AKT, Wnt and MAPK pathways.

In order to analyze detailed pharmacology of PJ1799, western blotting analysis of the MAPK-related molecules in CRC cells was conducted with increasing drug concentrations. The phosphorylation levels p38 and JNK were significantly suppressed (Fig. 4e – 4f). Moreover, subsequent assessment showed that the PI3K-AKT pathway was also inhibited by PJ1799 administration (Fig. 4g − 4h), whereas tumor cells treated with JS6 did not exhibit similar potency, either for the MAPK or PI3K-AKT pathways (supplementary Fig. 12–13).

Previous studies have revealed inhibition of PI3K-AKT and MAPK signaling pathways could stimulate tumor cell apoptosis via multiple mechanisms^{30, 31}. Early apoptosis of cells involves decrease in mitochondrial membrane potential³², which thus was examined after PJ1799 treatment. Indeed, PJ1799-mediated BCL3 degradation could trigger mitochondrial-mediated apoptosis. Meanwhile, cells with overexpression of BCL3 were able to restore mitochondrial membrane potential, which further validated this conclusion (supplementary Fig. 14–15). Lastly, western blotting analysis of the classical apoptosis-related molecules, including cPRAP, BCL2, and BAX, have been investigated. As expected, the protein level of anti-apoptotic factor BCL2 was downregulated while the pro-apoptotic factors BAX and cPRAP were upregulated, and overexpression of BCL3 partially reversed the expression changes of these apoptosis-related makers (Fig. 4i – 4j). These results further revealed that PJ1799 treatment could induce apoptosis in tumor cells. In conclusion, the degradation of BCL3 inhibited the AKT and JNK/p38-MAPK signaling pathways, thereby mediating the anti-tumor effect in CRC.

Anti-tumor effect of folate-coupled PJ1799(PJ1799-fo) in a subcutaneous tumor model

Encouraged by considerable anti-tumor efficacy of PJ1799 in vitro and in vivo, tumor models had been established to further confirm the feasibility of PJ1799 as a clinical therapeutic agent for CRC. Considering physiological function of BCL3 in normal cells, further tumor specific ligand modification was needed to improve tumor targeting of PROTACs. Folic acid (FA) intriguingly retains its high affinity with the folic acid receptor (FR) that is specificly overexpressed in a wide spectrum of cancer types^{33, 34, 35}. Selectively high FR expression in CRC has been identified by immunohistochemical analysis comparing tumor tissues and adjacent normal intestines from 92 patients (Fig. 5a – 5c). This finding was further validated by western blotting in CRC tissues and adjacent normal tissues derived from six clinical patients (Fig. 5d). As expected, there was a robust positive correlation between FR and BCL3 expression (Fig. 5c), indicating advantage of using FA as directing group to enhance tumor targeting of PJ1799. To this end, PJ1799 was coupled with folic acid by amide bond formation, yielding folic acid-conjugated PJ1799 (PJ1799-fo) (Fig. 5e and supplementary Fig. 16). In subsequent cytotoxicity assays against CRC tumor cells, PJ1799-fo demonstrated superior cytotoxicity compared to PJ1799 (Fig. 5f), and also exhibited a concentration-dependent degradation of BCL3 (Fig. 5g).

HCT15 cells with high FR expression were selected for the induction of subcutaneous tumorigenesis in mice (supplementary Fig. 17). Upon the subcutaneous tumor volume reached 50mm³, intravenous injections of PBS, JS6, PJ1799, and PJ1799-fo were administered to size-matched mice (Fig. 5h). Euthanasia was performed on all mice when the tumor diameter of control group reached 2 cm. In comparison to JS6, both PJ1799 and PJ1799-fo demonstrated significant inhibition of subcutaneous tumor in volume and mass (Fig. 5i). Predictably, PJ1799-fo, bearing FR-targeting domain, exhibited superior efficacy in impeding the growth of the subcutaneous tumor relative to PJ1799 (Fig. 5j and supplementary Fig. 18). Furthermore, tumors subjected to PJ1799 and PJ1799-fo treatment both exhibited notable BCL3 degradation effect (Fig. 5k – 5l), indicating PJ1799 and PJ1799-fo efficiently functioned as BCL3 degrader in subcutaneous tumor model. HE and Tunel staining indicated tumor apoptosis due to the absence of BCL3 in the mice tumors (Fig. 5l). Collectively, BCL3-targeted PROTAC has demonstrated unequivocally in vivo efficacy against CRC, with the folate-conjugate PROTAC exhibiting superior antitumor effects.

Anticancer efficacy of albumin-encapsulated (PJ1799-abl) in intraperitoneal tumor model

According to clinical statistics, CRC have the characteristics of peritoneal metastasis, around 20% of CRC cases has been estimated to ultimately metastasize to the peritoneum³⁶, and the survival duration is a mere 5–7 months without treatments³⁷. A CRC peritoneum mouse model has been developed to validate clinical feasibility of PJ1799 for metastatic CRC therapy. For cases of CRC that have advanced to peritoneal metastasis, intraperitoneal hyperthermic perfusion chemotherapy is advocated³⁸. Searching for solutions that further improve drug bioavailability, delivery efficiency and tumor distribution in vivo, PJ1799 was encapsulated in albumin (PJ1799-abl) and formulated into a nanodrug using the ultrasound-assisted technique. The PJ1799-abl had an average particle size of 137 nm and surface charge of -18.1 mV. (Fig. 6a). Enhancement in the anticancer effect of PJ1799-abl was observed, with a notable CRC inhibition IC₅₀ value less than 100 nM (supplementary Fig. 19a). Improvement in BCL3 degradation capability was also recognized for PJ1799-abl (supplementary Fig. 19b). In order to monitor cellular uptake, PJ1799-abl was loaded with Dio dye and co-incubated with tumor cells under confocal microscopy (Fig. 6b and supplementary Fig. 20). PJ1799-abl penetrated cells in a time-dependent manner, and achieved full absorption after approximately 6 hours.

In vivo evaluation has been conducted to ascertain how nanocarrier encapsulation would affect the pharmacodynamics of PJ1799. The establishment of a peritoneal metastasis model and the method of intraperitoneal drug delivery have been previously described in detail^{39, 40}. Briefly, peritoneal metastasis model was established by injecting 2×10⁶ luciferase-labeled human HCT15 cells into peritoneal cavity. In a period of three days, the successful established peritoneal metastasis was confirmed via both Intravital Imaging System (IVIS) and dissection of the mouse peritoneum (supplementary Fig. 21). Mice with comparable tumor sizes were subsequently intraperitoneal injected with PBS, JS6, PJ1799, and PJ1799-abl (Fig. 6c). IVIS was employed to monitor the progression of tumor growth (Fig. 6d). After four treatment cycles, three mice from each treatment group were dissected to measure the tumor growth. The remaining mice were kept until the end of the experiment. Illustrated from the bioluminescence intensity of tumor, both PJ1799 and PJ1799-abl effectively suppressed tumor growth, whereas JS6 did not show obvious deviation comparing to the control group (Fig. 6e). On the 15th day, the mice were dissected and evaluated (Fig. 6f – 6g), both PJ1799 and PJ1799-abl significantly inhibited tumor growth and intraperitoneal dissemination (Fig. 6h). Additionally, formation of ascites in the mice peritoneum was also effectively controlled by PJ1799 and PJ1799-abl (Fig. 6i). Notably, survival period of PJ1799-abl treated group was notably extended compared with PJ1799 (Fig. 6j), potentially due to higher drug distribution in tumor and reduced toxicity of the albumin-encapsulated drug. In summary, BCL3 degradation PROTAC with small molecule and nanoscaled formulation both demonstrated promising therapeutic effects in the peritoneal dissemination tumor model, while albumin-encapsulated nanomedicine contributed more to the extension of the mice survival period.Fig. 6 | Anticancer efficacy of albumin-encapsulated (PJ1799-abl) in intraperitoneal tumor model. a. Particle size, potential, electron microscope images, and the Tyndall's effect of the nanodrug PJ1799-abl. b. Uptake of nanodrugs by tumor cells after treatment with PJ1799-abl for 6h. The PJ1799-abl nanomedicine, labeled with Dio dye, was indicated by green fluorescence; the actin cytoskeleton was marked by red fluorescence; and the cell nuclei was denoted by blue fluorescence with DAPI. (Scale bar, 50 µm, 20 µm) c. Schematic diagram of the intraperitoneal tumor experiment in mice: After intraperitoneal implantation of HCT15-Luci cells, successful modeling of disseminated intraperitoneal tumors was confirmed after 3 days. The corresponding drug was administered via intraperitoneal injection every 4 days, for a total of 4 administrations. On day 15, 3/8 mice were dissected to observe the condition of intraperitoneal tumors, while the remaining mice were observed for survival. d. The IVIS system was used during the experiment to observe the growth of intraperitoneal tumors in mice. e. The trend of changes in intraperitoneal fluorescence values in each group of mice. f. Display of intraperitoneal dissection in each group of mice on day 15.

Biosafety of PROTAC durgs in vivo.

Encouraged by the considerable efficacy of PJ1799 in mouse models, we believe that BCL3 targeting PROTAC processes high potential in clinical application. Thus, the biosafety of PJ1799 has been further evaluated in vitro and in vivo. Cytotoxicity assay has substantiated that PJ1799 manifests a differential cytotoxic impact between neoplastic cells and noncancerous human cells, thereby offering an optimal dosage that induces minimal adverse reactions. In immunohistochemical staining of freshly dissected mice organs, BCL3 had a relatively low expression in normal organs compared to tumor tissues (supplementary Fig. 22). Moreover, no significant morphological disparities in the primary organs had been recognized from both PROTACs treatment groups and the control group (Fig. 7a). In the context of weight monitoring, there was no substantial weight reduction in the mice belonging to the experimental group across both the subcutaneous and peritoneal tumor models (Fig. 7b and supplementary Fig. 23). For the subcutaneous tumor tail vein treatment model, all standard hematological parameters, in addition to hepatic and renal function indicators, remained within normal range for each mouse cohort (Fig. 7c-7h and supplementary Fig. 24). The normalization of neutrophil and lymphocyte counts also indicated good biocompatibility of PROTACs with the immune and hematopoietic systems. Lastly, in the hemolysis assay involving PJ1799-fo and PJ1799-abl (Fig. 7I and supplementary Fig. 25), no discernible hemolysis was observed even when the nanodrug concentration in the mice erythrocyte suspension reached 1 µM, suggesting the intravenous administration safety of PJ1799-abl. Altogether, PJ1799, along with its modified derivatives PJ1799-fo and PJ1799-abl, demonstrate considerable safety for in vivo therapeutic applications.

Recently, intervention of intracellular protein homeostasis by techniques such as PROTAC, Lysosome-Targeting Chimaera (LYTAC) and autophagy-targeting chimera (AUTAC) has become an effective strategy for disease treatment^{13, 41, 42}. Among which, PROTAC has been recognized to have great potential for clinical applications in the field of degrading intracellular proteins. Given the recyclability of PROTAC drugs within cells, a minimal catalytic dose can achieve optimal tumor cytotoxicity, which likely accounts for the low toxicity. Additionally, PROTAC brought solution to the ‘undruggable’ transcription and splicing factors that were found to play crucial role in different malignant tumors¹³. While small molecule covalent inhibitors meet limitation when targeting protein processing multiple active sites related with different signaling pathways. PROTAC can block multiple protein functions with a single agent administration though fundamentally degrading the protein. By 2023, more than 20 PROTAC drugs have advanced to clinical trials²⁵. Notably, ARV-471, which targets estrogen receptors (ER), has progressed to Phase III clinical trials⁴³. Herein, we utilized JS6 as a ligand to capture BCL3 and employed the well-established VHL ligand to recruit E3 ubiquitin ligase, leading to the development of the BCL3-targeting PROTAC. PJ1799 can induce degradation of BCL3 in CRC cell lines, organoids, and in vivo tumor tissues, demonstrating superior anti-tumor efficacy compared to the protein–protein interaction (PPI) inhibitor, JS6.

BCL3, identified as a constituent of the IκB family, traditionally engages in interactions with the NF-κB family transcription factors p50/p52. This interaction influences the transcription of NF-κB-associated downstream genes, thereby modulating cellular functions such as proliferation, differentiation, apoptosis, and immune response^{44, 45}. Given that both p50 and p52 are direct interaction partners of BCL3, both the classical and non-classical NF-kB pathways are subject to the influence of BCL3. However, in healthy mice, the total loss of BCL3 activity does not eradicate all NF-κB signaling. This is best exemplified in BCL3 knockout mice⁴⁶, where apart from the deficiency in humoral immune response, BCL3 knockout mice are viable. Therefore, partially inhibition of the binding between BCL3 and p50 is not sufficient to produce a potent killing effect in tumor cells.

Despite BCL3 was identified in 1990, its oncogenic function was not acknowledged until the early 21st century. Up to present, overexpression of BCL3 has been reported in more than 10 types of solid tumors¹⁷, and its oncogenic mechanism extends beyond NF-κB pathway-related factors. For instance, in gliomas, BCL3 promoted cell proliferation and inhibited cell apoptosis via the STAT3 pathway⁴⁷. In breast cancer, BCL3 could bind with Smad3, preventing the ubiquitination and degradation of Smad3 protein, thereby facilitating the metastasis of breast cancer⁴⁸. In CRC, a number of mechanisms have been reported for BCL3’s oncogenic role. For example, BCL3 could interact with β-Catenin, which in turn promoted the acetylation level and nuclear localization of β-Catenin, thereby constitutively activating the Wnt/β-Catenin signaling pathway and advancing CRC progression²⁹. In addition, BCL3 could also promote the activation of the AKT pathway in CRC and the transcription of its downstream targets GSK3β and FOXO to facilitate tumor progression¹⁸. Therefore, focusing solely on the role of BCL3 in the NF-κB pathway may not be sufficient to terminate all of its oncogenic functions. In previous reports, although the binding of BCL3 and p50 was successfully blocked by JS6, TNFA and IL1B, two classical downstream factors of the NF-κB pathway, were elevated instead²¹. One possible reason may lie in the interaction between BCL3 and p52 within the non-classical NF-κB pathway remains unaffected, thus leads to a compensatory activation of the non-classical NF-κB pathway, resulting in a reactive elevation of TNFA and IL1B. From a mechanistic perspective, our analysis of RNA sequencing data has led to the discovery and confirmation that the PI3K-AKT pathway and MAPK signaling pathways are suppressed following the degradation of BCL3 with PJ1799 in CRC cells. Up to our knowledge, this is the first report indicating the participation of BCL3 in regulating JNK/p38-MAPK pathway. The detailed interaction fashion of BCL3 and MAPK signaling pathway is an important aspect to be explored in future research.

Despite BCL3 has been confirmed to induce and promote cancer, the structure of the BCL3 lacks a “pocket” for small molecule binding. Reported PPI inhibitor JS6 could disturb the interaction of BCL3 and p50/p50, and suppress the metastatic phenotype in breast cancer, however, its killing effect against CRC cells is not potent enough. The performance limitation may be caused by two reasons: firstly, based on former studies⁴⁵, BCL3 may have multiple active domains in the structure, thus disruption between BCL3 and p50 is not sufficient to block all the functions of BCL3. Secondly, BCL3 lacks typical ‘binding pocket’ for small molecule inhibitors, so the interaction affinity between JS6 and BCL3 may not be strong enough.

PROTACs have been recognized as a promising avenue in pharmaceutical research. PROTAC molecules are typically bifunctional and composed of three components to degrade intracellular POI, which are often characterized by large molecular weight and hydrophobicity. Their physicochemical properties sometimes meet difficulties to match the parameters of Lipinski’s ‘rule of five’ (RO5)⁴⁹. As a result, the translation of PROTACs into clinical therapeutics is often impeded by their limited cell membrane permeability, suboptimal pharmacokinetic (PK) profiles, and a lack of tumor-specific targeting²⁵. Therefore, there is a pressing demand to develop PROTACs with improved pharmaceutical properties. Seeking solutions, we have attempted to upgrade PJ1799 with two clinically available strategies, one is to conjugate PROTAC with cancer targeting functional group, the other is to encapsulate PJ1799 with nano sized carrier, albumin. Folic acid-conjugated PROTACs have demonstrated an improved selectivity between cancerous and normal cells⁵⁰. In this study, folic acid conjugated PJ1799 has shown better performance in BCL3 degradation both in vitro and in vivo, indicating that ligand-receptor mediated endocytosis improved the recognition and accumulation of PROTAC molecules in tumor cells. Furthermore, folic acid conjugation has not brought any additional toxicity to the PROTAC, which has provided a novel direction for the ongoing refinement of PROTAC drugs.

Nanocarrier is another effective tumor targeting and toxicity reducing strategy for small molecule drugs. In 2005, the FDA granted approval to the clinical use of paclitaxel albumin-bound nanoparticles, Abraxane, for metastatic breast cancer after combined chemotherapy failure. Besides safety and clinical feasibility of albumin nanoparticle drug delivery technology⁵¹, Albumin-encapsulated nano-drugs also had better accumulation in tumor tissues via both active and passive targeting mechanisms⁵². Albumin binding PROTAC by self-assembly after esterase-cleavable maleimide linker (ECMal) conjugation has been reported to achieve promising results in vivo⁵³. In our study, albumin-encapsulated PROTAC has been successfully prepared and shown promising in vitro and in vivo antitumor effects. More importantly, the survival period of mice receiving nano-PJ1799 treatment has been significantly extended. This may be attributed to the ability of albumin to evade recognition and phagocytosis by the reticuloendothelial system, passively target organs such as the liver, kidney, and bone marrow, and more effectively target tumors and reduce side effects through mechanisms including enhanced permeability and retention (EPR) effect, and Gp60 receptor targeting⁵⁴.

In summary, we report here, originally developed BCL3 targeting PROTACs with different formulations. To our knowledge, there are no commercially or clinically available BCL3 inhibitors available currently up to our knowledge, indicating the novelty of this development. Additionally, PJ1799 in all formulations exhibited effective degradation of BCL3, further led to significant anticancer potency both in vitro and in vivo. Using PJ1799 as a probe, the crucial roles of BCL3 in CRC progression and survival have been recognized. Notably, the correlation between BCL3 and the MAPK pathway in CRC has been first unveiled, laying the foundation for more in-depth mechanistic studies. Furthermore, through FA modification and nanomedicine encapsulation, effective means to improve the targeting specificity and biocompatibility of PROTAC drugs have been developed. Overall, BCL3 targeting PJ1799 are potential therapeutic agents for CRC, by targeting functional group modification and drug formulation design, PROTACs should serve as more powerful clinical therapeutics in clinical applications.

Ethics statement

This study was conducted with the informed consent of all participants and under the guidance of the Ethics Committee of the Seventh Affiliated Hospital of Sun Yat-sen University. Human colorectal cancer tissues were obtained from the Seventh Affiliated Hospital of Sun Yat sen University. All study participants are Asians. Human colorectal cancer tissue microarray (HRec-Ade180Sur-05) is purchased from Shanghai Supership. All in vivo experiments were conducted under the guidance of the Institutional Animal Care and Use Committee, and mice reaching the predetermined research endpoints will be euthanized humanely.

Cell culture

The human colon adenocarcinoma cell line HCT15, HCT116, DLD1, human gastric mucosal epithelial cell line GSE1, human peritoneal mesenchymal cell line HMrSV5, Human renal cortical proximal tubular epithelial cell line HK2, and human embryonic kidney 293T (HEK 293T) cells were purchased from the American Type Culture Collection (ATCC, USA). The human colon adenocarcinoma cell HCT8, sw620, RKO, and HCT15-lucifer were obtained from Meisen cell CTTC (Meisen, China). HCT15, HCT116, DLD1, HCT8, sw620, RKO cells were cultured in DMEM medium (GIBCO) supplemented with 10% FBS. GSE1, HMrSV5, HK2, and HCT15-lucifer were cultured in RPMI-1640 medium (GIBCO) supplemented with 10% fetal bovine serum (FBS). All cells were incubated at 37°C in a 5% CO2 humidified incubator.

Synthesis of JS6

Synthesis of intermediate: Anthranilic acid (1.0 g, 7.29 mmol) was thoroughly stirred in 10 ml of pyridine. The stirring continued with the addition of 2-fluorobenzoyl chloride (2.54 g, 16.0 mmol). After stirring at room temperature for 5 hours, the reaction solution was slowly poured into a 50 ml 10% sodium carbonate aqueous solution. The precipitate that forms was collected by vacuum filtration and washed three times with hexane, yielding the intermediate 2-(2-fluorophenyl)-4H-benzo[d] [1,3] oxazin-4-one. After drying to remove moisture, it was set aside for further use.

Conversion of Intermediate to JS6: The intermediate 2-(2-fluorophenyl)-4H-benzo[d] [1,3] oxazin-4-one (0.5 g, 2.07 mmol) was dissolved in 10 ml of DMF at room temperature. Upon complete dissolution, N, N-diisopropylamine (0.72 mL, 0.536 g, 4.15 mmol) and 2-morpholinoethanamine (0.60 mL, 0.594 g, 4.56 mmol) were added while stirring. The reaction was allowed to proceed for 18 hours, after which the reaction mixture was diluted with 50 ml of distilled water and extracted with 50 ml of ethyl acetate. The extract was washed three times with brine, each time with 50 ml, and dried with magnesium sulfate powder. The excess solvent was removed by rotary evaporation to give the crude product of 2-fluoro-N-(2-((2-morpholinoethyl)-carbamoyl)phenyl)benzamide (JS6). The crude product was purified through a chromatography column to obtain a white powder, with a yield of 75%.

Synthesis of PJ1799

The VHL E3 ligand, (S, R, S)-AHPC hydrochloride was purchased from MedChem Express (Cat No. HY-101763A), other chemicals were purchased from Aladdin company. All the reaction products structure and purity have been confirmed by NMR and HPLC. All reactions were conducted under nitrogen atmosphere except the reaction of compound 3 and 4.

(S, R, S)-AHPC hydrochloride (0.2 mmol, 93.4 mg), triethylamine (0.5 mmol, 506 mg) and (E)-14,14-dimethyl-3,6,9-trioxa-12-Azap-entadec-12-enoic acid (0.2 mmol, 55.0 mg) was dissolved in 50 ml DCM, the solution was stirred and heated to 40℃ and stirred for overnight. After cooling to room temperature, 1M HCl was added to acidify the reaction mixture. The product 2 was purified by chromatography (96.4 mg, yield 70%). Compound 2 (0.1 mmol, 68.8 mg) was dissolved in 40 ml DMF, 1.5 equiv. of TBSCl and 2.5 equiv. of imidazole were added to the solution to react at room temperature for 24 hours. The product compound 3 was purified by chromatography (55.6 mg, 73%).

The BCL3 inhibitor JS6 was synthesized according to the protocol of Soukupova’s report (Mol Cancer Ther (2021) 20 (5): 775–786. https://doi.org/10.1158/1535-7163.MCT-20-0283), and purified by chromatography. The purified JS6 (0.1 mmol, 45.0 mg) was dissolved in 50 ml dioxane, 3 equiv. of KOAc and 10 mol% of PdCl2(dppf) were added to the solution and stirred at 80℃ for overnight. The product compound 4 was purified by chromatography (40.3 mg, 81% yield).

Compound 3 (0.05 mmol, 36.7 mg) and compound 4 (0.05 mmol, 24.9 mg) were dissolved in 20 ml of MeCN. To the mixture was added 4 equiv. Of Cu (OAc)2 and the resulting mixture was stirred for 48 hours at room temperature to afford PROTAC-BCL3. The product was purified with chromatography (20.5 mg, 39% yield).

Antibodies

The following antibodies were used in this study: anti-BCL3(CST, 84776), anti-BCL3(Proteintech, 23959-1-AP), anti-β-actin(Beyotime, AF0003), anti-β-actin(Beyotime, AF5003), anti-FR(Santa, sc-515521), anti-p38(CST, 9212), anti-phospho-p38(CST, 4511), anti-JNK(CST, 9252), anti-phospho-JNK(CST, 4668), anti-bax(CST, 2772), anti-Ubiquitin(CST, 3936), anti-BCL2 (CST, 3499), anti-cleaved-PARP (CST, 5625), anti-AKT(ABclonal, A18120), anti-phospho-AKT(ABclonal, AP1208), anti-PI3K(Beyotime, AF7742), anti-phospho-PI3K(Beyotime, AF5905), Anti-Flag (Bimake, B23102), anti-Rabbit IgG (H + L), FITC-labeled Goat Anti-Rabbit IgG (H + L)( Beyotime, A0562).

Commercial kits and chemicals

Cell counting kit-8 (yeasen, 40203ES60), MG132 (Selleck, S2619), BCA reagent(Beyotime, P0012), RIPA Lysis buffer (Applygen, C1053), Protein A/G Plus-Agarose(Santa Cruz, sc-2003), Calcein/PI Cell Viability/Cytotoxicity Assay Kit(Beyotime, C2015M), NH₄Cl (aladdin, A116364), Polyethylenimine Linear (PEI) MW40000(yeasen, 40816ES03), RNase Inbihitor (Beyotime, R0102), Protease inhibitor cocktail(Selleck, B14001), Actin-Tracker Red-Rhodamine(Beyotime, C2207S), DAPI Staining Solution(Beyotime, C1005), DAB Detection Kit(Gene Tech, GK801030), Cell Cycle and Apoptosis Analysis Kit(Beyotime, C1052), Crystal Violet Staining Solution(Beyotime, C0121), Matrigel Matrix High Concentration(BD, 354248), Enhanced mitochondrial membrane potential assay kit with JC-1(Beyotime, C2003S), Evo M-MLV Reverse Transcription Kit(AG, AG11705), SYBR Green Pro Taq HS Premixed qPCR Kit(AG, AG11701), BCA protein quantitative kit (Applygen Technologies, P1513/S8010), PAGE Gel Rapid Preparation Kit(Epizyme, PG112), Tunel Cell Apoptosis Detection Kit(abcam, ab206386), Endotoxin-free plasmid medium-volume extraction kit(Tiangen, DP108), RNA Easy Fast Animal Tissue / Cell Total RNA Extraction Kit(Tiangen, DP451).

Cell viability assays

Upon completion of cell quantification, a homogeneous dispersion of 4x103 cells per well was meticulously established on a 96-well plate. Following a 24-hour incubation period to facilitate cell adhesion, the cells were subjected to treatment with the designated pharmaceutical agents. Subsequent to a 48-hour period of drug exposure, the absorbance at 450nm (Thermo Fisher) was measured utilizing a CCK-8 assay kit, strictly adhering to the manufacturer’s protocol, thereby enabling the calculation of cell viability. The half-maximal inhibitory concentration (IC50) values were subsequently determined employing the GraphPad Prism 8.

Immunoblotting

Cell samples were lysed in RIPA lysis buffer, while human tissue and animal tumor tissue samples required tissue disruption via an ultrasonic homogenizer. The concentration of the extracted protein solution was determined using a BCA protein quantification kit. The resulting homogenized protein underwent SDS-PAGE separation, transferred onto a PVDF membrane, and incubated with antibodies following blocking with 5% non-fat milk. Antibody detection was performed using the ChemiDo chemiluminescence imaging system (Bio-Rad). The relative expression level of the target molecule was determined using ImageJ software (1.54K) by calculating the grayscale value of each band. The ratio of the grayscale value of the target molecule band to the grayscale value of the internal reference band represents the relative expression level of the target molecule.

Immunoprecipitation (IP)

Cells were harvested and lysed in a Co-IP lysis buffer supplemented with protease inhibitors. The cell lysate was then incubated with the specified antibodies on a shaker at 4°C overnight. The following day, Protein A/G Plus-Agarose was added to the incubated lysate and further incubated on a shaker at 4°C for 4–6 hours. After washing, the immunoprecipitates were boiled in 2x SDS sample buffer, followed by immunoblot analysis.

Immunofluorescence

Cells were fixed in 4% paraformaldehyde for 20 minutes, permeabilized with 0.5% Triton X-100 for 10 minutes, and blocked with Goat Serum at room temperature for 60 minutes. The samples were then incubated with the primary antibody at 4°C overnight. The following day, after washing with PBS, the samples were incubated with the corresponding secondary antibody for 1 hour. After the secondary antibody collection, the cell nuclei were stained with DAPI dye for 10 minutes. Following the washing of the DAPI dye, images were captured using a confocal fluorescence microscope (CLSM, Zeiss LSM 880, Germany).

Immunohistochemistry

Paraffin-embedded tissue sections were incubated in a 60°C oven for 60 minutes for deparaffinization, followed by immersion in xylene three times for further deparaffinization. The sections were then sequentially hydrated in decreasing concentrations of ethanol solutions. Antigen retrieval was performed in a microwave using sodium citrate buffer for 15 minutes, and allowed to cool naturally. The sections were then immersed in 3% H2O2 in the dark for 15 minutes, and blocked at room temperature in 5% goat serum for 1 hour. Subsequently, the tissue sections were stained with the specified primary antibody at 4°C overnight. The following day, the secondary antibody was added and incubated at room temperature for 1 hour, followed by staining using the DAB Detection Kit. Slide scanning was performed using KF-PRO-040-HI (KFBIO, Ningbo, China), and slide preview and analysis were conducted using K-Viewer software. Immunohistochemical Scoring: For each tissue microarray, fields of the same size were randomly selected. The staining intensity was divided into four levels: 0, 1, 2, and 3. The immunohistochemical score was calculated by multiplying the staining intensity by the percentage of the area it occupied in each field.

Cultivation of Organoids and Evaluation of Antitumor Efficacy of PJ1799

Primary colorectal cancer tissues were dissected into small pieces and digested in a buffer solution containing Collagenase IV and Hyaluronidase at 37°C for 3 hours. Following digestion under 530 g for 5 minutes, the digested tissues were suspended in RMPI 1640 culture medium. Organoids were then collected by centrifugation at 500 g for 10 seconds, 3–5 times, counted, and resuspended in a matrix gel with minimal growth factors (at a density of 2 x 105 cells/mL). These were then seeded onto 6-well or 96-well plates. On the 5th day, the organoids were treated with the appropriate reagents and the culture medium was replaced. After supplementing with fresh culture medium and further culturing for 48 hours, vitality tests and protein extraction experiments were performed.

Molecular docking

The VHL-PROTAC-BCL3 ternary complex was computed via PRosettaC (https://prosettac.weizmann.ac.il/pacb/steps). The structure file of VHL-PROTAC-JW48 was downloaded from PDB (8C13) and the PROTAC JW38 molecule in the 8C13 structure was removed using PyMOL software, leaving only the PDB format file of the VHL structure. The smi format file of PROTAC-1799 was generated using Chem3D software. The BCL3 structure PDB format file was downloaded from PDB (1k1b). The VH032 structure sdf format file was downloaded from PubChem (77232228), and the BCL3 inhibitor JS6 structure sdf format file was downloaded from PubChem (24824960). Therefore, after the files were prepared, they were uploaded to the PRosettaC website for cloud computing. Upon completion of the computation, a notification email will be received, and the ternary complex structure can be downloaded via the link. The image of the ternary complex structure was generated using PyMOL software.

Acetoxy-methyl ester (AM)/propidium iodide (PI) cytotoxicity assays

Following cell enumeration, a uniform distribution of 4x103 cells per well was achieved on a 96-well plate. After a 24-hour period allowing for cell adhesion, the cells were treated with the specified drugs. At the designated time points, cell staining was performed according to the instructions provided with the Calcein/PI Cell Viability/Cytotoxicity Assay Kit. Images were captured under an inverted fluorescence microscope, and image analysis and statistics were conducted using ImageJ software (version 1.53K).

Mitochondrial membrane potential assays

Following cell enumeration, a uniform distribution of 4x103 cells per well was achieved on a 96-well plate. After a 24-hour period allowing for cell adhesion, the cells were treated with the specified drugs. At the designated time points, cell staining was performed according to the instructions provided with the Enhanced Mitochondrial Membrane Potential Assay Kit with JC-1. Images were captured under an inverted fluorescence microscope (version 1.53K).

Cellular uptake assay

Following cell enumeration, a uniform distribution of 5x10⁵ cells per well was achieved on Confocal Dishes. After a 24-hour period allowing for cell adhesion, the HCT15 cells were treated with DIO-labeled PJ1799-abl (50 nM). After incubation for 0, 2, 6, 12, and 24 hours, the cells were washed twice with PBS and fixed with 4% paraformaldehyde. The cells were then permeabilized with 0.5% Triton X-100 for 10 minutes, and stained with Actin-Tracker Red-Rhodamine at room temperature in the dark for 1 hour. Following washing, the cells were stained with DAPI for 10 minutes. Fluorescent images were recorded using a confocal laser scanning microscope (CLSM, Zeiss LSM 880, Germany).

Cell cycle assay

Following cell enumeration, a uniform distribution of 5x10⁵ cells per well was achieved on a 6-well plate. After a 24-hour period allowing for cell adhesion, the cells were treated with the specified concentration of drugs for 48 hours. The cells were then collected and stained according to the instructions provided with the Cell Cycle and Apoptosis Analysis Kit. Flow cytometry was performed (Beckman, USA), and the data were analyzed using FlowJo software (version 10.7.2).

Tumor cell migration assay

Cell migration assays were conducted using a Millipore 24-well Millicell plate with an 8 µm pore membrane. Following cell enumeration, cells were added to the upper chamber (8x10⁴ cells/well), and 20% FBS culture medium was added to the lower chamber. After 12 hours, drugs of the specified concentration were added to the upper chamber, and the culture was continued for 48 hours. At the end of the culture period, the cells were fixed with 4% paraformaldehyde at room temperature for 15 minutes. The membrane was washed three times with PBS, and then stained with 0.5% crystal violet in methanol at room temperature for 15 minutes. Any cells remaining on the surface of the membrane (non-migrated) were gently scraped off with a cotton swab. Images of the cells on the underside of the membrane (migrated cells) were captured using a photomicroscope (Leica, DMi1, Germany).

RNA extraction and sequencing

Following the treatment of HCT15 cells with PJ1799 (400nM) for 48 hours, biological samples (n = 3) were collected and RNA was extracted using TRIzol reagent. RNA sequencing and library construction were performed using the Illumina HiseqTM 2500/4000 by Gene Denovo Biotechnology Co., Ltd (Guangzhou, China). Differential gene analysis was conducted using the DESeq2 package (1.42.0), while KEGG and GSEA analyses were performed using the clusterProfiler package (4.1.0). The entire analysis process was carried out using R software (4.2).

Proteomics analysis (Label free)

Drug treatment was carried out in the same manner as for RNA sequencing. Cells were lysed with a lysis buffer (50 mM Tris-HCl [pH 8.0], 1% Triton X-100, 0.5% Nonidet P-40, 10 mM dithiothreitol, 1% protease inhibitor cocktail, 150 mM NaCl, and 5 mM EDTA) on ice for 30 minutes, followed by centrifugation at 12,000 g for 20 minutes at 4°C. The protein solution was precipitated with acetone and reduced with 50 mM dithiothreitol for 1.5 hours at 30°C. The protein solution was then alkylated with 50 mM iodoacetamide for 15 minutes at room temperature in darkness. Subsequently, 100 mM TEAB was added to the urea in the protein sample, which was then digested overnight by trypsin at a 1:50 trypsin-to-protein mass ratio. Finally, the peptides were analyzed by liquid chromatography-tandem mass spectrometry (LC-MS/MS).

Reverse transcription and quantitative real-time PCR

Total RNA was extracted utilizing the RNA Easy Fast Animal Tissue/Cell Total RNA Extraction Kit. Quantification was performed using a NanoDrop spectrophotometer. Reverse transcription was carried out using the Evo M-MLV Reverse Transcription Kit. Quantitative PCR was conducted employing the SYBR Green Pro Taq HS Premixed qPCR Kit.

Colony formation experiment

HCT15 and HCT116 (800 cells/well) were seeded onto 6-well plates. After a 24-hour period allowing for cell adhesion, the cells were treated with the specified concentration of drugs. After 48 hours, the culture medium was replaced and the cells were further cultured for 12 days. The colonies were then stained with 0.5% crystal violet in methanol at room temperature for 10 minutes. Images were captured using a mobile phone camera (without magnification), and image analysis and statistics were conducted using ImageJ software (version 1.53K).

Oligonucleotides

qPCR primers were all synthesized by Sangong Biotech. Shanghai, the sequences are as follows: Human BCL3 primers, forward: CCCGTTTCCTCTGGTGAACCTG, reverse: GCGTGTCTCCGTCCTCATCTG.

Human β-Actin primers, forward: CACCATTGGCAATGAGCGGTTC, reverse: AGGTCTTTGCGGATGTCCACGT.

Human IL1B primers, forward: ATGATGGCTTATTACAGTGGCAA, reverse: GTCGGAGATTCGTAGCTGGA.

Human TNFA primers, forward: CCTCTCTCTAATCAGCCCTCTG, reverse: GAGGACCTGGGAGTAGATGAG.

Human MYC primers, forward: TCCCTCCACTCGGAAGGAC, reverse: CTGGTGCATTTTCGGTTGTTG.

Human CDC42 primers, forward: CCATCGGAATATGTACCGACTG, reverse: CTCAGCGGTCGTAATCTGTCA.

Human HES1 primers, forward: GCAGATGACGGCTGCGCTGA, reverse: AAGCGGGGTCACCTCGTTCATGC.

Human CXCR4 primers, forward: AAACTGAGAAGCATGACGGACAA, reverse: GCCAACATAGACCACCTTTTCAG.

Human CCND2 primers, forward: GCAGAACCTGTTGACCATCG, reverse: GCTTGCGAAGGATGTGCTC.

Human CER1 primers, forward: GTCCAGGCTTGGAAGATTC, reverse: AGGGCACAGTCCTGCAGGTC.

BCL3 overexpression and knockdown

HCT15, HCT116, and 293T cells were uniformly seeded onto 6-well plates at a density of 5x105 cells per well. The following day, when the cells were approximately 60% confluent, transfection was performed using Polyethylenimine Linear (PEI) MW40000 (yeasen, China), with each well receiving 2µg of plasmid (pCDNA3.1). The cells were then further cultured. For 293T cells, the transfection time was 8 hours, while for HCT15 and HCT116 cells, subsequent drug administration and other operations were performed 24 hours post-transfection. The sequences of oligo required for knockdown of BCL3 gene (NM_005178.4) were listed below:

BCL3-shRNA-1: CCGG-TGCCACCCACATCTTCCATTT-CTCGAG-AAATGGAAGATGTGGGTGGCA-TTTTTT

BCL3-shRNA-2: CCGG-CTCGACATCTACAACAACCTA-CTCGAG-TAGGTTGTTGTAGATGTCGAG-TTTTTT

BCL3-shRNA-3: CCGG-CGACATCTACAACAACC-CTCGAG-GGTTGTTGTAGATGTCG-TTTTTT

Statistical Analysis

Continuous variables are expressed as mean ± SD. When comparing two groups, statistical significance is determined using an unpaired two-tailed Student's t-test. The correlation between BCL3 and FR was established using the Person rank correlation coefficient. Survival analysis was conducted using the log-rank test in GraphPad Prism software. The threshold for statistical significance was defined as P < 0.05.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

Data from TCGA COAD READ ESCA PAAD STAD LIHC cohort RNA-Seq information used in this study were downloaded from Xena Browser [https://xenabrowser.net/datapages].

COMPETING INTERESTS:

Authors declare that they have no competing interests.

AUTHOR CONTRIBUTIONS:

Z.J., L.BB., H.YL. designed the study; L.BB., Z.J. synthesized all PROTAC compounds; B.B., L.YS., Z.SB., W.Q., L.K., L.P., L.YX. performed the in vitro experiments; B.B., C.HX., L.ZH. performed bioinformatics analysis; L.Y., W.YF., X.JQ., B.B., Z.SB. performed the in vivo experiments; D.YM., Q.MJ., Y.Y., L.D., B.B., X.JQ. performed graphing and data analysis; B.B., D.YM., Z.J. wrote the manuscript。

Acknowledgments:

This work was in part supported by: Science and Technology Planning Project of Shenzhen Municipality Grant JCYJ20210324122612032 and JCYJ20220530144613030, Shenzhen Key Laboratory of Chinese Medicine Active substance and Translational Research Grant ZDSYS20220606100801003, and Shenzhen Medical Research Fund (D2301010). (to Z.J.) Science and Technology Planning Project of Guangdong Province (No. 2021B1212040006). (to H.YL.) National Natural Science Foundation of China Grant 81902426 and Shenzhen Science and Technology R&D Funds. (to L.BB) The Provincial Natural Science Foundation of Hunan in China Grant 2024JJ6661 and The China Postdoctoral Science Foundation (Grant GZC20233182). (to W.Q.)

Bray F, et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 74, 229-263 (2024).
Dekker E, Tanis PJ, Vleugels JLA, Kasi PM, Wallace MB. Colorectal cancer. Lancet (London, England) 394, 1467-1480 (2019).
Spaander MCW, et al. Young-onset colorectal cancer. Nat Rev Dis Primers 9, 21 (2023).
Ganesh K. Optimizing immunotherapy for colorectal cancer. Nat Rev Gastroenterol Hepatol 19, 93-94 (2022).
Topalian SL, Taube JM, Pardoll DM. Neoadjuvant checkpoint blockade for cancer immunotherapy. Science 367, (2020).
Normanno N, Tejpar S, Morgillo F, De Luca A, Van Cutsem E, Ciardiello F. Implications for KRAS status and EGFR-targeted therapies in metastatic CRC. Nature reviews Clinical oncology 6, 519-527 (2009).
Cohen MH, Gootenberg J, Keegan P, Pazdur R. FDA drug approval summary: bevacizumab plus FOLFOX4 as second-line treatment of colorectal cancer. Oncologist 12, 356-361 (2007).
Grothey A, et al. Regorafenib monotherapy for previously treated metastatic colorectal cancer (CORRECT): an international, multicentre, randomised, placebo-controlled, phase 3 trial. Lancet (London, England) 381, 303-312 (2013).
Gutzmer R, et al. Atezolizumab, vemurafenib, and cobimetinib as first-line treatment for unresectable advanced BRAF(V600) mutation-positive melanoma (IMspire150): primary analysis of the randomised, double-blind, placebo-controlled, phase 3 trial. Lancet (London, England) 395, 1835-1844 (2020).
Sacher A, et al. Single-Agent Divarasib (GDC-6036) in Solid Tumors with a KRAS G12C Mutation. The New England journal of medicine 389, 710-721 (2023).
Dhanasekaran R, Deutzmann A, Mahauad-Fernandez WD, Hansen AS, Gouw AM, Felsher DW. The MYC oncogene - the grand orchestrator of cancer growth and immune evasion. Nature reviews Clinical oncology 19, 23-36 (2022).
Khan S, et al. PROteolysis TArgeting Chimeras (PROTACs) as emerging anticancer therapeutics. Oncogene 39, 4909-4924 (2020).
Békés M, Langley DR, Crews CM. PROTAC targeted protein degraders: the past is prologue. Nature reviews Drug discovery 21, 181-200 (2022).
Ocaña A, Pandiella A. Proteolysis targeting chimeras (PROTACs) in cancer therapy. J Exp Clin Cancer Res 39, 189 (2020).
Wang VY, et al. Bcl3 Phosphorylation by Akt, Erk2, and IKK Is Required for Its Transcriptional Activity. Mol Cell 67, 484-497.e485 (2017).
Pan W, Meshcheryakov VA, Li T, Wang Y, Ghosh G, Wang VY. Structures of NF-κB p52 homodimer-DNA complexes rationalize binding mechanisms and transcription activation. Elife 12, (2023).
Seaton G, Smith H, Brancale A, Westwell AD, Clarkson R. Multifaceted roles for BCL3 in cancer: a proto-oncogene comes of age. Molecular cancer 23, 7 (2024).
Urban BC, et al. BCL-3 expression promotes colorectal tumorigenesis through activation of AKT signalling. Gut 65, 1151-1164 (2016).
Tao Y, et al. Alternative NF-κB signaling promotes colorectal tumorigenesis through transcriptionally upregulating Bcl-3. Oncogene 37, 5887-5900 (2018).
Xie X, et al. Recent advances in targeting the "undruggable" proteins: from drug discovery to clinical trials. Signal transduction and targeted therapy 8, 335 (2023).
Soukupová J, et al. The Discovery of a Novel Antimetastatic Bcl3 Inhibitor. Molecular cancer therapeutics 20, 775-786 (2021).
Asatsuma-Okumura T, Ito T, Handa H. Molecular mechanisms of cereblon-based drugs. Pharmacology & therapeutics 202, 132-139 (2019).
Adams CM, et al. Targeted MDM2 Degradation Reveals a New Vulnerability for p53-Inactivated Triple-Negative Breast Cancer. Cancer Discov 13, 1210-1229 (2023).
Khan S, et al. A selective BCL-X(L) PROTAC degrader achieves safe and potent antitumor activity. Nat Med 25, 1938-1947 (2019).
Chirnomas D, Hornberger KR, Crews CM. Protein degraders enter the clinic - a new approach to cancer therapy. Nature reviews Clinical oncology 20, 265-278 (2023).
Turnham DJ, et al. Bcl-3 promotes multi-modal tumour cell migration via NF-κB1 mediated regulation of Cdc42. Carcinogenesis 41, 1432-1443 (2020).
Massoumi R, et al. Down-regulation of CYLD expression by Snail promotes tumor progression in malignant melanoma. The Journal of experimental medicine 206, 221-232 (2009).
Voce DJ, et al. CDK1 is up-regulated by temozolomide in an NF-κB dependent manner in glioblastoma. Scientific reports 11, 5665 (2021).
Chen X, et al. Bcl-3 promotes Wnt signaling by maintaining the acetylation of β-catenin at lysine 49 in colorectal cancer. Signal transduction and targeted therapy 5, 52 (2020).
Wagner EF, Nebreda AR. Signal integration by JNK and p38 MAPK pathways in cancer development. Nature reviews Cancer 9, 537-549 (2009).
Rong Y, Distelhorst CW. Bcl-2 protein family members: versatile regulators of calcium signaling in cell survival and apoptosis. Annual review of physiology 70, 73-91 (2008).
Du L, et al. IGF-2 Preprograms Maturing Macrophages to Acquire Oxidative Phosphorylation-Dependent Anti-inflammatory Properties. Cell metabolism 29, 1363-1375.e1368 (2019).
Pinhassi RI, et al. Arabinogalactan-folic acid-drug conjugate for targeted delivery and target-activated release of anticancer drugs to folate receptor-overexpressing cells. Biomacromolecules 11, 294-303 (2010).
Zu Y, et al. A novel preparation method for camptothecin (CPT) loaded folic acid conjugated dextran tumor-targeted nanoparticles. International journal of molecular sciences 12, 4237-4249 (2011).
Lu Y, Low PS. Immunotherapy of folate receptor-expressing tumors: review of recent advances and future prospects. Journal of controlled release : official journal of the Controlled Release Society 91, 17-29 (2003).
Klaver CEL, et al. Adjuvant hyperthermic intraperitoneal chemotherapy in patients with locally advanced colon cancer (COLOPEC): a multicentre, open-label, randomised trial. The lancet Gastroenterology & hepatology 4, 761-770 (2019).
Razenberg LG, van Gestel YR, Lemmens VE, de Hingh IH, Creemers GJ. Bevacizumab in Addition to Palliative Chemotherapy for Patients With Peritoneal Carcinomatosis of Colorectal Origin: A Nationwide Population-Based Study. Clinical colorectal cancer 15, e41-46 (2016).
Quénet F, et al. Cytoreductive surgery plus hyperthermic intraperitoneal chemotherapy versus cytoreductive surgery alone for colorectal peritoneal metastases (PRODIGE 7): a multicentre, randomised, open-label, phase 3 trial. Lancet Oncol 22, 256-266 (2021).
Wang Q, et al. Metal-enriched HSP90 nanoinhibitor overcomes heat resistance in hyperthermic intraperitoneal chemotherapy used for peritoneal metastases. Molecular cancer 22, 95 (2023).
Chen G, et al. Engineering Bifunctional Calcium Alendronate Gene-Delivery Nanoneedle for Synergistic Chemo/Immuno-Therapy Against HER2 Positive Ovarian Cancer. Adv Sci (Weinh) 10, e2204654 (2023).
Zhao L, Zhao J, Zhong K, Tong A, Jia D. Targeted protein degradation: mechanisms, strategies and application. Signal transduction and targeted therapy 7, 113 (2022).
Kocak M, et al. Targeting autophagy in disease: established and new strategies. Autophagy 18, 473-495 (2022).
Wang X, et al. Annual review of PROTAC degraders as anticancer agents in 2022. European journal of medicinal chemistry 267, 116166 (2024).
Franzoso G, Bours V, Park S, Tomita-Yamaguchi M, Kelly K, Siebenlist U. The candidate oncoprotein Bcl-3 is an antagonist of p50/NF-kappa B-mediated inhibition. Nature 359, 339-342 (1992).
Bours V, et al. The oncoprotein Bcl-3 directly transactivates through kappa B motifs via association with DNA-binding p50B homodimers. Cell 72, 729-739 (1993).
Schwarz EM, Krimpenfort P, Berns A, Verma IM. Immunological defects in mice with a targeted disruption in Bcl-3. Genes & development 11, 187-197 (1997).
Wu J, Li L, Jiang G, Zhan H, Wang N. B-cell CLL/lymphoma 3 promotes glioma cell proliferation and inhibits apoptosis through the oncogenic STAT3 pathway. International journal of oncology 49, 2471-2479 (2016).
Chen X, et al. Bcl-3 regulates TGFβ signaling by stabilizing Smad3 during breast cancer pulmonary metastasis. Cell death & disease 7, e2508 (2016).
Lipinski CA. Lead- and drug-like compounds: the rule-of-five revolution. Drug discovery today Technologies 1, 337-341 (2004).
Liu J, et al. Cancer Selective Target Degradation by Folate-Caged PROTACs. Journal of the American Chemical Society 143, 7380-7387 (2021).
Gradishar WJ, et al. Phase III trial of nanoparticle albumin-bound paclitaxel compared with polyethylated castor oil-based paclitaxel in women with breast cancer. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 23, 7794-7803 (2005).
Lamichhane S, Lee S. Albumin nanoscience: homing nanotechnology enabling targeted drug delivery and therapy. Archives of pharmacal research 43, 118-133 (2020).
Cho H, Jeon SI, Shim MK, Ahn CH, Kim K. In situ albumin-binding and esterase-specifically cleaved BRD4-degrading PROTAC for targeted cancer therapy. Biomaterials 295, 122038 (2023).
Liu Z, Chen X. Simple bioconjugate chemistry serves great clinical advances: albumin as a versatile platform for diagnosis and

There is NO Competing Interest.

Supportinginformation20240720.docx

Download PDF

Version 1

posted

You are reading this latest preprint version

Construction and Preclinical evaluation of BCL3-Degrading PROTACs for Enhanced Colorectal Cancer Therapy

Status:

Version 1

Abstract

Figures

Introduction

Results

Anti-tumor effect of folate-coupled PJ1799(PJ1799-fo) in a subcutaneous tumor model

Anticancer efficacy of albumin-encapsulated (PJ1799-abl) in intraperitoneal tumor model

Discussion

Methods

Ethics statement

Cell culture

Synthesis of JS6

Synthesis of PJ1799

Antibodies

Commercial kits and chemicals

Cell viability assays

Immunoblotting

Immunoprecipitation (IP)

Immunofluorescence

Immunohistochemistry

Cultivation of Organoids and Evaluation of Antitumor Efficacy of PJ1799

Molecular docking

Acetoxy-methyl ester (AM)/propidium iodide (PI) cytotoxicity assays

Mitochondrial membrane potential assays

Cellular uptake assay

Cell cycle assay

Tumor cell migration assay

RNA extraction and sequencing

Proteomics analysis (Label free)

Reverse transcription and quantitative real-time PCR

Colony formation experiment

Oligonucleotides

BCL3 overexpression and knockdown

Statistical Analysis

Declarations

Reporting summary

Data availability

COMPETING INTERESTS:

AUTHOR CONTRIBUTIONS:

Acknowledgments:

References

Additional Declarations

Supplementary Files

Status:

Version 1