Screening for porcine endogenous retrovirus - C (PERV-C) in pigs

doi:10.21203/rs.3.rs-4807994/v1

Download PDF

Short Report

Screening for porcine endogenous retrovirus - C (PERV-C) in pigs

https://doi.org/10.21203/rs.3.rs-4807994/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Porcine endogenous retrovirus C (PERV-C) is a gammaretrovirus present in the genome of many, but not all pigs. PERV-C is an ecotropic virus, able to infect only pig cells. In contrast, PERV-A and PERV-B are present in all pigs, they can infect cells of numerous host species including humans, and therefore pose a risk for xenotransplantation using pigs as donor animals. Intriguingly, PERV-C can recombine with PERV-A and the resulting PERV-A/C recombinants can also infect human cells and replicate to higher titers compared to the paternal PERV-A. Therefore, only PERV-C-free animals should be used for xenotransplantation. When screening wild boars and German landrace pigs for PERV-C, proviral variants were detected, and to detect these variants, new PCR methods were developed. Furthermore, PERVs are known to be active in living pigs as demonstrated by recombination and by different copy numbers in various organs and different parts of an organ. Copy numbers also increased with the age of the animals. This data was obtained by PCR using primers amplifying the highly conserved polymerase sequence which is identical in PERV-A, PERV-B and PERV-C. Here we screened indigenous Greek black pigs, Auckland Island pigs and German slaughterhouse pigs for the presence of PERV-C, using different PCR-based methods and optimized these detection methods. Auckland Island pigs were PERV-C-negative and represent the optimal donor pigs after genetic modifications.

porcine endogenous retroviruses (PERVs)

PERV-C

xenotransplantation

Porcine endogenous retroviruses (PERVs) are integrated in the genome of all pigs. PERV-A and PERV-B are present in all pigs, whereas PERV-C is not present in all, but most pigs [1]. This correlates with the fact that PERV-C is phylogenetically younger compared to PERV-A and PERV-B [2–4]. Since PERV-A and PERV-B can infect human cells (human-tropic virus), they pose a risk for xenotransplantation using pig cells, tissues or organs [5]. PERV-A and PERV-B infect also cells from numerous other species (polytropic viruses). PERV-C infects only pig cells (ecotropic virus) and therefore, theoretically does not pose a risk for xenotransplantation. However, PERV-C can recombine with PERV-A, acquiring the receptor binding site for the receptor on cells of humans and other species, enabling the virus to efficiently replicate in human cells [6, 7]. In addition, the replication rate of the PERV-A/C recombinants is higher compared to paternal PERV-A [8, 9].

Therefore, it is recommended to use PERV-C-free animals as donor pigs for xenotransplantation [10]. To ensure that the animals are PERV-C-free, sensitive and specific conventional and real-time PCRs were developed [1, 11–14]. When we screened wild boars and German landrace pigs for PERV-C using the commonly used PCR developed by Takeuchi et al. [1], we observed mutations in the primer binding sites giving a false negative result in some pigs. Therefore, we developed new PCRs to detect PERV-C variants in such animals [15].

It is well known that PERVs are active in living pigs [16]. This was demonstrated by different copy numbers of integrated proviruses in different organs and in different parts of one organ and by an increase of the copy number by age [17–21]. The lowest level of PERV-A and PERV-B proviral DNA was shown in muscles [20]. These investigations were performed using primer and probes binding to a highly conserved region in PERV's polymerase sequence (pol), not discriminating between PERV-A, PERV-B and PERV-C. Furthermore, there is good evidence that PERV-C is active in living pigs: Recombinants with PERV-A were found in somatic cells but such PERV-A/C were never found in the germ line [6, 7].

When we screened indigenous Greek black pigs for PERV-C using another PCR, designated PCR4 [12], 11 of 21 animals were found positive [22]. None of the PERV-C-positive animals were positive for PERV-A/C. Indigenous Greek black pigs live in mountainous areas, they are resistant to weather conditions and to diseases even though numerous viruses including porcine cytomegalovirus/porcine roseolovirus (PCMV/PRV), porcine lymphotropic herpes virus − 3 (PLHV-3), and porcine circovirus 3 (PCV3) were found in most of the animals [22].

Auckland Island pigs are ideal organ donors because of the optimal organ size for humans [23]. Therefore, there is no need for a knock-out of the porcine growth factor receptor as done with other pig breeds [24]. The second important advantage is the low number of porcine microorganisms. These animals lived for a hundred years on the remote Auckland Island, they were thoroughly studied in New Zealand [25–27] and used as donors of pig islets in the first clinical trials treating diabetes patients in New Zealand and Argentina. In these trials no transmission of porcine viruses, including PERV to the patients was observed [28, 29]. Since more than 50% of the animals in New Zealand were PERV-C positive, we selected PERV-C negative animals from which cells were delivered to Germany and piglets were obtained by somatic cell nuclear transfer (SCNT) [21]. Genetic diversity, growth and heart function of these Auckland Island pigs at the Center for Innovative Medical Models (CiMM) in Munich as well as the absence of PERV-C demonstrate that they are excellent donor animals [23].

To evaluate our methods developed for the detection of numerous porcine viruses we recently screened German slaughterhouse pigs [30]. Nine of ten animals were PERV-C positive and therefore we included them in this study using different PCR approaches and sequencing methods to analyze PERV-C in indigenous Greek black pigs, Auckland Island pigs and pigs from a German slaughterhouse.

PCR methods for the detection of PERV-C To screen pigs for the presence of PERV-C, a PCR developed by Takeuchi et al. [1] is commonly used, designated here PCR1 (Figure 1A). Later Dieckhoff et al. developed a new PCR [31], designated PCR4 by Kaulitz et al. [12] using primers based on a PERV-C sequence (accession number EU440732.1, [32]). In addition, PCR2, PCR3 and a real-time PCR were developed [12]. The PCR1 detected up to 1.1x10³ molecules of a PERV-C plasmid, and the real-time PCR performed as duplex PCR simultaneously detecting PERV-C and porcine cyclophilin detected 100 copies/reaction PERV-C [12]. PCR1, PCR2 and PCR3 detected equally good PERV-C in German landrace pigs [12]. Later, when we detected new variants of PERV-C in German wild boars, we added two new PCRs, PCR6 and PCR7 [15]. All primer and probe sequences were found in the PERV-C reference sequence (accession number AM229312, [33]), but not in the PERV-A reference sequence (accession number AY288779.1, [34]) (Table 1). In this manuscript, the real-time PCR was performed as a duplex real-time PCR detecting in parallel porcine GAPDH and the sensitivity was 10 copies PERV-C /100ng DNA [21]. To evaluate the specificity of the developed PCRs and to determine the presence or absence of PERV-C, we screened indigenous Greek black pigs, Auckland Island pigs and pigs from a German slaughterhouse. In this manuscript, three new PCRs, PCR8, PCR9 and PCR10, were added, which partially were designed to obtain larger amplicons for sequencing purposes (Figure 1A). To stress it again, all primer and probe sequences were found in our PERV-C reference sequence, but not in the PERV-A reference sequence (Table 1).

Detection of PERV-C in indigenous Greek black pigs Initially, 21 indigenous Greek black pigs were screened for PERV-C using PCR4. This screening revealed that 11 of 21 animals (52.4%) were positive [22]. To further investigate the presence of PERV-C in these animals, four animals from farm 1 were analyzed using PCR1. Screening with this PCR1 reconfirmed the presence of PERV-C in all pigs, except pig 3 (Figure 2A). The same result had been obtained for PCR4 [22]. The absence of PERV-C specific bands in PCR1 and PCR4 for animal 3 suggests that PERV-C is either absent in this animal or that the primer-binding sites are mutated, making them unrecognizable by one or both primers.

To test these possibilities, PCR5 and PCR6 were performed (Figure 2A). Testing DNA from the liver and spleen of animals 2 and 4 with PCR5 and PCR6 produced strong amplicons identical in size to that of the positive control. No amplification was observed with PCR 5 and PCR6 when DNA from both tissues of animal 3 was used. Interestingly, no amplification was detected in animal 1 with PCR 5, and only a faint band was observed with PCR6 using DNA isolated from the spleen, but not from the liver. Given the importance of this PCR6 result, the PCR was repeated several times to ensure reproducibility, and the results of two experiments are presented in Figure 2A. The difference between liver and spleen suggests that there is a mutation in one or both primer binding sites in the provirus in the liver, but not in the spleen, indicating different proviruses in these organs.

To obtain a larger amplicon for sequencing purposes, PCR8 was performed, using the forward primer of PCR6 and the reverse primer of PCR5. To our surprise, DNA extracted from all tissues from all four animals yielded amplicons, also from pig 3. Most interestingly, the amplicons from the liver and spleen of animal 3 were larger compared to the amplicons from animals 1, 2 and 4, indicating a potential insertion (Figure 2A). PCR7 (the combination of the forward primer of PCR5 and the reverse primer of the real-time PCR) and PCR9 (using the forward primer of the real-time PCR and the reverse primer of PCR5) were also positive for all four animals.

Detection of PERV-C in other pigs When the DNA from the German slaughterhouse pigs were screened using a real-time PCR [12], all animals were also positive (Table 2). In contrast, the Auckland Island pigs and the PK15 cells were negative in the real-time PCR (Table 2). The Auckland Island pigs [21] and the pig cell line PK15 [35] are well known to be PERV-C negative. They were also PERV-C negative in this study in PCR4 (Figure 2B) and PCR8, which was using the forward primer of PCR6 and the reverse primer of PCR5 in order to obtain extended amplicons (Figure 2C, 2D).

Sequence analysis of PERV-C from indigenous Greek black pigs Sanger sequencing of the PCR8 amplicon from pig 4 resulted in a high-quality sequence and an alignment of this sequence with a PERV-C reference sequence AM229312 [33] revealed that the sequences were nearly identical (Figure S1).

However, since the Sanger sequencing of the other amplicons did not produce satisfactory results, possibly due to the simultaneous amplification of different proviruses present in the pig genome with differences in the sequence, all amplicons were sequenced using the Nanopore method. As expected, putative insertions were detected in the sequence from animal 3 when compared with the sequences from animals 2 and 4 (Figure 1B). The largest insertion disrupts the binding sites of the forward primers of PCR1 and PCR4, while the other disrupts the binding sites of the reverse primers of PCR1 and PCR4. The smallest insertion disrupts the binding site for the forward primer of PCR5. Consequently, none of these three PCRs produced amplicons when DNA from animal 3 was tested (Figure 2A). However, when the large insert and the whole amplicon sequence from animal 3 were analyzed using nucleotide BLAST (nBLAST), a high sequence similarity PERV-A was observed (Figure S2), indicating that the provirus amplified with PCR8 in pig 3 is PERV-A.

Based on the nanopore sequences of the PCR8 amplicons from animals 3 and 4 a dendrogram was built, showing that the amplicon from animals 4 is closer to the PERV-C reference sequence and the amplicon from animal 3 is closer to the PERV-A reference sequence (Figure 3).

Comparative analysis of the primer binding sites The sequences obtained by nanopore sequencing of the 692bp amplicons obtained by PCR8 were used to analyze the primer binding sites of PCR1, PCR4, PCR5, PCR6, PCR7, PCR8 and PCR 9 as well as the binding sites for primers and probes of the real-time PCR (Table 3). The nanopore sequences were of high quality and the sequences of the amplicons derived from the liver DNA and the spleen DNA were 100% identical. When the sequences of the primers and the corresponding sequences in the amplicons were compared, it was confirmed that the forward and reverse primers of PCR 1 and PCR4 are highly specific, because in the PERV-A sequence (amplicon of PCR8 from animal 4) the primer binding sites were disrupted by larger sequences absent in PERV-C. The sequences of the PCR5 primer binding sites in pig 3 had mutations, in the case of the forward primer an insertion of sequence “AAC” disrupted the primer binding site (Table 3), explaining the absence of amplicons when PCR5 was performed (Figure 2A).

The real-time PCR is not PERV-C-specific In addition, a real-time PCR as described by Kaulitz et al. [12] was performed. Primers and the probe had been designed using sequences found in the PERV-C reference genome, but not in the PERV-A reference genome (Table 1). An identical copy number in the spleen and liver of animals 2 and 4 (21 Ct) was found, but a lower copy number in both tissues of animals 1 and 3 (26 Ct) (Table 2). Interestingly, no significant differences in the PERV copy numbers were observed between the liver and spleen of all animals. When the real-time PCR was used to screen the four indigenous Greek black pigs from farm 1, all four animals including pig 3, which was found PERV-C negative on the basis of PCR1, PCR4, PCR5 and PCR6 (Figure 2A) were found to be positive in the real-time PCR (Table 2). In contrast, the Auckland Island pigs, which were also found PERV-C negative using the mentioned PCRs, were negative in the real-time PCR (Table 2). All ten German slaughterhouse pigs were positive in the real-time PCR, including pig 3, which was found to be PERV-C negative using PCR1 and PCR4 [30] (Table 2).

Sequences obtained by PCR10 In order to obtain an even larger sequence for extended sequencing, PCR10 was developed using the forward primer of PCR6 and a new primer downstream of the reverse primer of PCR5 (Table 1). PCR10 was positive for all tissues of all four indigenous Greek black pigs (Figure 2A), including pig 3. The amplicons from the liver and spleen of pig 3 and pig 4 were sequenced by the nanopore method and were compared with the PERV-C reference gene (Figure S3). There were significant differences, indicating that different proviruses had been amplified. When these sequences were analyzed using nBLAST, the sequences from pig 3 corresponded to PERV-B and that from pig 4 to PERV-A, indicating that the primer amplified non-PERV-C proviruses. PCR10 was also positive for the German slaughterhouse pig 3, the sequence of the amplicon was also identified as PERV-A. Therefore, a comparison of the primers of PCR1, PCR4, PCR5 and the primers and the probe of the real-time PCR with the corresponding binding sites in the sequences was not conductive (Figure S3). Interestingly, PCR10 was negative for an Auckland Island pig and positive for PK15 cells (Figure 2E).

Screening for PERV-A/C To detect PERV-A/C recombinants, primer pairs were used which had been previously validated for identification of different types of recombinants [7, 36-38]. Despite comprehensive screening with these primer pairs, no PERV-A/C sequences could be detected in the genome of indigenous Greek black pigs (Figure 4).

Here we analyzed for the first time integrated PERV-C proviruses in indigenous Greek black pigs, German landrace pigs and Auckland Island pigs and confirmed that Auckland Island pigs from the CiMM in Munich are PERV-C-negative. Furthermore, we tested several PCR assays to determine whether they correctly detect PERV-C. Eleven of 21 indigenous Greek black pigs in four different farms in Greece were found to carry PERV-C proviruses using PCR4. This confirms that not all pigs carry PERV-C proviruses as reported in various previous publications. For example, 113 of 348 (30%) Chinese miniature pigs [39], 176 of 181 (97%) German transgenic and non-transgenic pigs [31], and 25 of 98 (25.5%) US farm animals [11] carry PERV-C. The absence of PERV-C in several animals correlates with the fact that PERV-C is phylogenetically younger compared to PERV-A and PERV-B, which are present in all pigs [2–4].

Three of four indigenous Greek black pigs in farm 1 were found to be PERV-C-positive using both PCR1 and PCR4 [22]. Nine out of ten German slaughterhouse pigs were positive using these PCRs, while the porcine cell line PK15 was negative, as expected. Most importantly, all Auckland Island pigs from the CiMM in Munich, which were derived from cell lines from selected, PERV-C-negative, animals [21] were confirmed to be PERV-C negative. Although PERV-C does not infect human cells, it can recombine with the ubiquitous PERV-A present in all pig genomes. These PERV-A/C recombinants are able to infect human cells and replicate to higher titers compared to the paternal PERV-A [8, 9]. Therefore, only PERV-C-negative animals should be used for preclinical and clinical xenotransplantation [10].

Sequencing of the amplicon produced by PCR8 using the Sanger sequencing showed that the sequence found in pigs 2 and 4 from farm 1 is nearly identical to the PERV-C reference sequence AM229312 [33]. Since the Sanger sequencing of the amplicons obtained by PCR8 using the DNA from pig 3 was not successful, possibly due to the presence of amplicons generated from different proviruses in the genome, all amplicons were sequenced using the Nanopore method. This sequencing showed insertions in the PERV sequences of animal 3. This is in agreement with the finding that the amplicons obtained when performing PCR8 using DNA from animal 3 was larger compared with the amplicons of the other three pigs. As a matter of fact, three putative insertions were found when the amplicons of PCR8 were sequenced and compared. These insertions disrupted the primer binding sites of PCR1, PCR4 and PCR5, explaining the negative results. The sequence “ATTGGCAACAGCGGGTACAAAAAGAT”, which is PERV-A specific, is absent in the PERV-C sequence of animals 1 and 4, suggesting it may be a sequence derived from PERV-A that is inserted in the PERV-C sequence in animal 3. However, sequence analysis of the sequence of the amplicon from pig 3 indicated, that the entire sequence corresponded to PERV-A. Therefore, the so-called insertions are not insertions into PERV-C. Insertions of shorter and larger PERV-A sequences into PERV-C sequences had been observed when recombinant PERV-A/C isolated from peripheral blood mononuclear cells (PBMCs) were analyzed [36, 37], however such PERV-A/C sequences were never found in the germ line, but only in somatic cells, indicating that the recombinants are the result of recombination and de novo integration [6].

Of interest is the result of PCR8. The forward primer of PCR8 is identical to the forward primer of PCR6 and the reverse primer of PCR8 is identical to the reverse primer of PCR5. PCR5 and PCR6 did not give an amplicon when DNA from the Auckland Island pigs, PK15 and Greek animal 3 were tested. PCR5 and PCR6 were only positive with DNA from animals 1, 2 and 4 which were also positive with other PERV-C-specific PCRs such as PCR1 and PCR4 (Fig. 2).

The real-time PCR also gave equivocal results (Table 2). Whereas the real-time PCR is negative in the case of Auckland Island pigs, it was unexpectedly positive in the case of animal 3, which was tested PERV-C negative by PCR1, PCR4, PCR5 and PCR6.

The fact that PCR6 gave a positive result when analyzing DNA from the spleen of animal 1, but not from the liver of animal 1 is of interest. The negative result with the liver DNA indicates that the sequence of one or both primer binding sites is absent or mutated. This data indicates that different proviruses are integrated in the DNA of two tissues, the spleen and liver, of a single animal.

The methods characterized here are required to identify PERV-C-negative pigs for xenotransplantation to prevent a recombination with PERV-A. However, we have to consider, that in addition to recombination with PERV-A, resulting in PERV-A/C recombinants, there are also other mechanisms able to transform the ecotropic PERV-C into a virus which can infect human cells. Gemeniano et al. [32] have shown that the C-terminal proline-rich region (PRR) in the envelope protein region is required in addition to the putative variable region A (VRA) and VRB for binding to cells. They showed that mutations in the PRR allowed infection of human cells. They also showed that the cellular receptor molecule binding the PERV-C with the mutated C-terminal region of the surface envelope protein is different from the receptor molecule when PERV-A is binding and infecting human cells.

In conclusion, screening pigs for the presence of PERV-C is easy but requires some precautions. Our experience shows that PCR1 and PCR4 always gave clear results, showing that indigenous Greek black pig 3, all Auckland Island pigs, German slaughterhouse pig 3 and PK15 cells are PERV-C negative. PCR5 and PCR6 gave false-negative results and all others including the real-time PCR gave false-positive results. On the other hand, PCR1, PCR4, PCR5, PCR6, PCR8 and the real-time PCR were negative in the case of the Auckland Island pigs. Therefore, PCR1 and PCR4 should be used for routine screening for PERV-C and all other PCRs may help to characterize the sequences in the receptor binding domain of PERV.

Animals and tissues

Liver and spleen tissues were obtained from 4 animals in Farm 1 located near Drama, North Greece [22]. These animals had been screened for different porcine viruses using real-time PCR (PCMV/PRV, PCV2, PCV3, PCV4, PLHV-1, PLHV-2 and PLHV-3), as well as real-time RT-PCR (HEV genotype 3). Blood samples from the Auckland Island pigs were obtained from Prof. Eckhard Wolf and Dr. Barbara Keßler, Chair for Molecular Animal Breeding and Biotechnology and CiMM, Munich. The three female animals were born in June 2023, they are the F1 generation of the animals born in April 2019 and were obtained by somatic cell nuclear transfer (SCNT) using PERV-C-negative kidney cells [21]. PBMCs were isolated by gradient centrifugation as described [40]. Spleen and liver samples from German pigs were obtained from a slaughterhouse near Berlin, their age was 6 months. PK15 (ACC 640) cells were ordered from the Leibniz Institute DSMZ German Collection of Microorganisms and Cell lines, Braunschweig, Germany. Using droplet digital PCR (ddPCR) 55 (52.5–60.1) PERV copies were detected in these cells using porcine GAPDH as a reference gene or 37 (35.0-39.1) copies using porcine beta actin (ACTB) as a reference [17].

DNA isolation

DNA was isolated from the tissues according to the manufacturer´s instructions using the DNeasy Blood & Tissue kit (Qiagen, Hilden, Germany). DNA concentrations were determined using NanoDrop ND-1000 (Thermo Fisher Scientific Inc., Worcester, MA, USA) or Qubit (Invitrogen, Thermo Fisher Scientific Inc., Worcester, MA, USA).

PCR and real-time PCR

Conventional PCR was performed to determine the presence of PERV-C using a set of primers (Table 1) [1, 7, 12, 15, 41]. Part of the reactions were carried out with DreamTaq DNA polymerase (Thermo Fisher Scientific, Worcester, MA, USA) and part with high-fidelity HiFi polymerase (PCRBiosystems, London, UK). All reactions were set up with a Biometra TRIO cycler (Analytik Jena, Jena, Germany).

Each sample was subjected to an initial denaturation of 10 min at 95°C (one min for HiFi polymerase), followed by 45 amplification cycles of 95°C for 15 s (35 cycles for HiFi polymerase), the annealing temperatures are shown below (30 s for DreamTaq, 15 s for HiFi Polymerase). The corresponding extension times at 72°C for each PCR are shown below. In the case of DreamTaq DNA polymerase, but not HiFi polymerase, a final extension at 72°C for 5 min was added. The annealing temperature for PCR1 was 55°C, for PCR4 60°C, for PCR5, PCR6, PCR7, and PCR8 58°C, for PCR9 55°C and for PCR10 58°C. The extension times used were 9 s for PCR1 and PCR4, 10 s for PCR5, 16 s for PCR6, 5 s for PCR7, 21 s for PCR8, 9 s for PCR9 and 24 s for PCR10 using HiFi polymerase.

In addition, a real-time PCR was established using specific primers and probe (Table 1) [12, 15]. 100 ng DNA and the SensiFAST Probe No-ROX kit (Meridian Bioscience Cincinnati, OH, USA) in a 20 µL reaction volume. The cycling conditions used were initial denaturation 5 minutes at 95°C, followed by 45 amplification cycles of 95°C for 15 s, annealing at 58°C for 30 s, and extension at 72°C for 30 s in a qTOWER3 G qPCR cycler (Analytik Jena, Jena, Germany). A standard curve was produced using the 510 bp amplicon of previously described PCR6 [21] as template. This PCR was performed as follows: 100 ng of DNA template, PCR buffer I containing MgCl₂, 0.2 mM dNTPs, and one unit of DreamTaq DNA polymerase (Thermo Fisher Scientific, Worcester, MA, USA). In case of PCRBIO HiFi polymerase, PCRBIO reaction buffer along with one-unit HiFi polymerase was used. As positive control DNA from the PERV-C positive pig (#6249) was used. The sensitivity of the real-time PCR was 10 copies/100ng DNA [21]

Sanger sequencing

PCR8 amplicons from pigs 2 and 4 were gel purified using a DNA gel extraction kit (Monarch, New England Biolabs) and sent for sequencing (LGC Genomics, Berlin, Germany). Sequences were analyzed using ApE software.

Nanopore sequencing

PCR8 amplicons from pig 1, 3 and 4 were gel purified using DNA gel extraction kit (Monarch, New England Biolabs) and sent for sequencing (Plasmidsaurus, Eugene, OR, USA). Sequences were analyzed using SnapGene (San Diego, CA, USA).

Sequence alignment and phylogenetic tree

Sequence alignment and phylogenetic tree generation were done using Clustal Omega using sequences obtained from nanopore sequencing. ApE plasmid editor was used to align the sequences obtained from Sanger sequencing.

Acknowledgements

We thank Prof. Eckhard Wolf and Dr. Barbara Keßler, Chair for Molecular Animal Breeding and Biotechnology

and CiMM, Munich, for blood from the Munich Auckland Island pigs. We thank Dr. Kostja Renko, German Federal Institute for Risk Assessment, Unit Strategies for Toxicological Assessments, Department Experimental Toxicology and ZEBET, Berlin, for the help when acquiring the organs from the German slaughterhouse pigs.

Author contributions

Conceptualization, writing, and supervision was performed by JD. Methodology, validation, formal analysis, and visualization was conducted by HJ, VP, BK, DK and JD. Investigation was conducted by HJ and DK. Funding acquisition was performed by BK and JD. Editing of the manuscript was performed by HJ, VP, BK, DK and JD.

Funding

This work was supported by Deutsche Forschungsgemeinschaft, TRR 127.

Availability of data and materials

All data generated or analyzed during this study are included in this published article and its supplementary information files.

Ethics approval and consent to participate

All animal procedures regarding animal care, handling and welfare concerning the indigenous Greek black pigs were approved by the Ethical Research Committee of the University of Thessaly (Ethical Approval Code: 104/16.11.2021). Investigations on the German slaughterhouse animals were performed using meat samples obtained from the slaughterhouse. All work with the Auckland Island pigs was performed with the permission of the local regulatory authority, Regierung von Oberbayern (ROB). Applications were reviewed by the ethics committee according to §15 TSchG (German Animal Welfare Act).

Consent to publish

Not applicable.

Competing interests

The authors declare no competing interests

Takeuchi Y, Patience C, Magre S, Weiss RA, Banerjee PT, Le Tissier P, Stoye JP. Host range and interference studies of three classes of pig endogenous retrovirus. J Virol. 1998;72(12):9986–91.
Tönjes RR, Niebert M. Relative age of proviral porcine endogenous retrovirus sequences in Sus scrofa based on the molecular clock hypothesis. J Virol. 2003;77(22):12363–8.
Chen Y, Chen X, Duan X, Cui J. Ancient origin and complex evolution of porcine endogenous retroviruses. Biosaf Health. 2020;2(3):142–51.
Denner J. The origin of porcine endogenous retroviruses (PERVs). Arch Virol. 2021;166(4):1007–13.
Denner J, Tönjes RR. Infection barriers to successful xenotransplantation focusing on porcine endogenous retroviruses. Clin Microbiol Rev. 2012;25(2):318–43.
Bartosch B, Stefanidis D, Myers R, Weiss R, Patience C, Takeuchi Y. Evidence and consequence of porcine endogenous retrovirus recombination. J Virol. 2004;78(24):13880–90.
Wood JC, Quinn G, Suling KM, Oldmixon BA, Van Tine BA, Cina R, Arn S, Huang CA, Scobie L, Onions DE, Sachs DH, Schuurman HJ, Fishman JA, Patience C. Identification of exogenous forms of human-tropic porcine endogenous retrovirus in miniature Swine. J Virol. 2004;78(5):2494–501.
Denner J, Specke V, Thiesen U, Karlas A, Kurth R. Genetic alterations of the long terminal repeat of an ecotropic porcine endogenous retrovirus during passage in human cells. Virology. 2003;314(1):125–33.
Harrison I, Takeuchi Y, Bartosch B, Stoye JP. Determinants of high titer in recombinant porcine endogenous retroviruses. J Virol. 2004;78(24):13871–9.
Hering BJ, Cooper DK, Cozzi E, Schuurman HJ, Korbutt GS, Denner J, O’Connell PJ, Vanderpool HY. Pierson RN 3rd: The international xenotransplantation association consensus statement on conditions for undertaking clinical trials of porcine islet products in type 1 diabetes–executive summary. Xenotransplantation. 2009;16:196–202.
Pal N, Baker R, Schalk S, Scobie L, Tucker AW, Opriessnig T. Detection of porcine endogenous retrovirus (PERV) viremia in diseased versus healthy US pigs by qualitative and quantitative real-time RT-PCR. Transbound Emerg Dis. 2011;58(4):344–51.
Kaulitz D, Mihica D, Dorna J, Costa MR, Petersen B, Niemann H, Tönjes RR, Denner J. Development of sensitive methods for detection of porcine endogenous retrovirus-C (PERV-C) in the genome of pigs. J Virol Methods. 2011;175(1):60–5.
Guo F, Xing X, Hawthorne WJ, Dong Q, Ye B, Zhang J, Liang Q, Nie W, Wang W. Characterization of PERV in a new conserved pig herd as potential donor animals for xenotransplantation in China. Virol J. 2014;11:212.
Gazda LS, Collins J, Lovatt A, Holdcraft RW, Morin MJ, Galbraith D, Graham M, Laramore MA, Maclean C, Black J, Milne EW, Marthaler DG, Vinerean HV, Michalak MM, Hoffer D, Richter S, Hall RD, Smith BH. A comprehensive microbiological safety approach for agarose encapsulated porcine islets intended for clinical trials. Xenotransplantation. 2016;23(6):444–63.
Kaulitz D, Mihica D, Adlhoch C, Semaan M, Denner J. Improved pig donor screening including newly identified variants of porcine endogenous retrovirus-C (PERV-C). Arch Virol. 2013;158(2):341–8.
Denner J. How Active Are Porcine Endogenous Retroviruses (PERVs)? Viruses. 2016;8(8):215.
Fiebig U, Fischer K, Bähr A, Runge C, Schnieke A, Wolf E, Denner J. Porcine endogenous retroviruses: Quantification of the copy number in cell lines, pig breeds, and organs. Xenotransplantation. 2018;25(4):e12445.
Krüger L, Stillfried M, Prinz C, Schröder V, Neubert LK, Denner J. Copy Number and Prevalence of Porcine Endogenous Retroviruses (PERVs) in German Wild Boars. Viruses. 2020;12(4):419.
Sypniewski D, Machnik G, Mazurek U, Wilczok T, Smorag Z, Jura J, Gajda B. Distribution of porcine endogenous retroviruses (PERVs) DNA in organs of a domestic pig. Ann Transpl. 2005;10:46–51.
Mazurek U, Kimsa MC, Strzalka-Mrozik B, Kimsa MW, Adamska J, Lipinski D, Zeyland J, Szalata M, Slomski R, Jura J, et al. Quantitative analysis of porcine endogenous retroviruses in different organs of transgenic pigs generated for xenotransplantation. Curr Microbiol. 2013;67:505–14.
Fiebig U, Krüger L, Denner J. Determination of the Copy Number of Porcine Endogenous Retroviruses (PERV) in Auckland Island Pigs Repeatedly Used for Clinical Xenotransplantation and Elimination of PERV-C. Microorganisms. 2024;12(1):98.
Jhelum H, Papatsiros V, Papakonstantinou G, Krabben L, Kaufer B, Denner J. Screening for viruses in indigenous Greek black pigs. Microorganisms. 2024;12(2):315.
Lange A, Medugorac I, Ali A, Kessler B, Kurome M, Zakhartchenko V, Hammer S, Hauser A, Denner J, Dobenecker B, Wess G, Tan PLJ, Garkavenko O, Reichart B, Wolf E, Kemter E. Genetic diversity, growth and heart function of Auckland Island pigs, a potential source for organ xenotransplantation. Xenotransplantation. 2024;31(2):e12858.
Hinrichs A, Riedel EO, Klymiuk N, Blutke A, Kemter E, Längin M, Dahlhoff M, Keßler B, Kurome M, Zakhartchenko V, Jemiller EM, Ayares D, Bidlingmaier M, Flenkenthaler F, de Hrabĕ M, Arnold GJ, Reichart B, Fröhlich T, Wolf E. Growth hormone receptor knockout to reduce the size of donor pigs for preclinical xenotransplantation studies. Xenotransplantation. 2021;28(2):e12664.
Fan B, Gongora J, Chen Y, Garkavenko O, Li Moran C. Population genetic variability and origin of Auckland Island feral pigs. J R Soc N Z. 2005;35:279–85.
Garkavenko O, Muzina M, Muzina Z, Powels K, Elliott RB, Croxson MC. Monitoring for potentially xenozoonotic viruses in New Zealand pigs. J Med Virol. 2004;72:338–44.
Garkavenko O, Dieckhoff B, Wynyard S, Denner J, Elliott RB, Tan PL, Croxson MC. Absence of transmission of potentially xenotic viruses in a prospective pig to primate islet xenotransplantation study. J Med Virol. 2008;80:2046–52.
Wynyard S, Nathu D, Garkavenko O, Denner J, Elliott R. Microbiological safety of the first clinical pig islet xenotransplantation trial in New Zealand. Xenotransplantation. 2014;21:309–23.
Morozov VA, Wynyard S, Matsumoto S, Abalovich A, Denner J, Elliott R. No PERV transmission during a clinical trial of pig islet cell transplantation. Virus Res. 2017;227:34–40.
Jhelum H, Kaufer B, Denner J. Application of methods detecting xenotransplantation-relevant viruses for screening German slaughterhouse pigs. Viruses. 2024;16:1119.
Dieckhoff B, Kessler B, Jobst D, Kues W, Petersen B, Pfeifer A, Kurth R, Niemann H, Wolf E, Denner J. Distribution and expression of porcine endogenous retroviruses in multi-transgenic pigs generated for xenotransplantation. Xenotransplantation. 2009;16(2):64–73.
Gemeniano M, Mpanju O, Salomon DR, Eiden MV, Wilson CA. The infectivity and host range of the ecotropic porcine endogenous retrovirus, PERV-C, is modulated by residues in the C-terminal region of its surface envelope protein. Virology. 2006;346:108–17.
Preuss T, Fischer N, Boller K, Tonjes RR. Isolation and characterization of an infectious replication-competent molecular clone of ecotropic porcine endogenous retrovirus class C. J Virol. 2006;80(20):10258–61.
Scobie L, Taylor S, Wood JC, Suling KM, Quinn G, Meikle S, Patience C, Schuurman HJ, Onions DE. Absence of replication-competent human-tropic porcine endogenous retroviruses in the germ line DNA of inbred miniature Swine. J Virol. 2004;78(5):2502–9.
Dieckhoff B, Karlas A, Hofmann A, Kues WA, Petersen B, Pfeifer A, Niemann H, Kurth R, Denner J. Inhibition of porcine endogenous retroviruses (PERVs) in primary porcine cells by RNA interference using lentiviral vectors. Arch Virol. 2007;152(3):629–34.
Krüger L, Kristiansen Y, Reuber E, Möller L, Laue M, Reimer C, Denner J. A Comprehensive Strategy for Screening for Xenotransplantation-Relevant Viruses in a Second Isolated Population of Göttingen Minipigs. Viruses. 2019;12(1):38.
Halecker S, Krabben L, Kristiansen Y, Krüger L, Möller L, Becher D, Laue M, Kaufer B, Reimer C, Denner J. Rare isolation of human-tropic recombinant porcine endogenous retroviruses PERV-A/C from Göttingen minipigs. Virol J. 2022;19(1):30.
Karlas A, Irgang M, Votteler J, Specke V, Ozel M, Kurth R, Denner J. Characterisation of a human cell-adapted porcine endogenous retrovirus PERV-A/C. Ann Transpl. 2010;15(2):45–54.
Wu J, Ma Y, Lv M, Yang Y, Guo Y, Yu X, Tian K, Zhang J. Large-scale survey of porcine endogenous retrovirus in Chinese miniature pigs. Comp Immunol Microbiol Infect Dis. 2008;31(4):367–71.
Semaan M, Rotem A, Barkai U, Bornstein S, Denner J. Screening pigs for xenotransplantation: prevalence and expression of porcine endogenous retroviruses in Göttingen minipigs. Xenotransplantation. 2013;20(3):148–56.
Duvigneau J, Hartl R, Groiss S, Gemeiner M. Quantitative simultaneous multiplex real-time PCR for the detection of porcine cytokines. J Immunol Methods. 2005;306:16–27.

Table 1 Primers (fw, forward; rev, reverse) and probes used for the detection of PERV sequences (location according to Accession Nr. AM229312) and porcine GAPDH

Primer/probe	Sequence 5’-3’	Location^a	PERV-C^b	PERV-A^c
PERV-C
PCR1 fwd^d	CTGACCTGGATTAGAACTGG	6606..6625	yes	no
PCR1 rev	CCAGGACCATCCTCTAACAT	6867..6886	yes	no
PCR4 fwd	GATTAGAACTGGAAGCCCCAAGTGCTCT	6614..6641	yes	no
PCR4 rev	ACCATCCTCTAACATAACTTCTGGATCAGA	6872..6901	yes	no
PCR5 fwd	CTATTCGCCTCAAAATAAACCAG	6778..6800	yes	no
PCR5 rev = PCR8 rev = PCR9 rev	CATAGAGACCAATGCACATG	7086..7105	yes	no
PCR6 fwd= PCR8 fwd=PCR10 fwd	CCAGGACCACCAAATAATGG	6435..6454	yes	no
PCR6 rev=envC real time rev	ACTAAAATGGGGGCAAAACTT	6924..6944	yes	no
envC real-time fwd=PCR9 fwd	CCCCAACCCAAGGACCAG	6853..6870	yes	no
envC real-time probe	FAM-CTCTAACATAACTTCTGGATCAGACCC-BHQ1	6878..6904	Yes	no
PCR10 rev	CACTGAAGCCTTTAATCAAACC	7183..7205	yes	no
PERV-A/C (380 bp amplicon)
PERV-A-VRB^efwd	CCTACCAGTTATAATCAATTTAATTATGGC	6129–6158	no	yes
PERV-C rev	TATGTTAGAGGATGGTCCTGGTC	6451–6473	yes	no
PERV-A/C (1260 bp amplicon)
PERV-A-VRB—fwd PERV-C-TMR rev	CCTACCAGTTATAATCAATTTAATTATGGC CTCAAACCACCCTTGAGTAGTTTCC	6129–6158 7370–7395	no yes	yes no
pGAPDH
pGAPDH-fwd pGAPDH-rev pGAPDH-probe	ACATGGCCTCCAAGGAGTAAGA TCAGTGTCGGGGTTGAGCTAG HEX-CCA CCA ACC CCA GCA AGA G-BHQ

^alocation of the PERV-C primer/probe according to accession number AM229312 [33], of the GAPDH primer/probe according to Duvigneau et al., 2005 [41], primers to detect PERV-A/C as described by Wood et al. [7]

^bprimer/probe sequence is present in PERV-C sequence with accession number AM229312, clone1312 [33]

^cprimer/probe sequence is present in PERV-A sequence with accession number AY288779.1 [34]

^ddesigned by Takeuchi et al. 1998 [1]

^eVRB, variable region B

Table 2 Duplex real-time PCR for the detection of PERV-C

and GAPDH in indigenous Greek black pigs from farm 1,

Auckland Island pigs and German slaughterhouse pigs

		Mean ct			260/280 nm values^a
		PERV-C		pGAPDH
Indigenous Greek black pigs, farm 1
Pig 1 spleen		25.07		19.16	1.85
liver		26.38		19.86	1.89
Pig 2 spleen		21.06		19.14	1.90
liver		21.47		19.92	1.80
Pig 3 spleen		26.92		19.93	1.87
liver		26.23		19.98	1.82
Pig 4 spleen		21.29		19.92	1.91
liver		20.70		19.20	1.86
Auckland Island pigs
13947		n.d.		19.53	1.81
13980		n.d.		19.03	1.89
13983		n.d.		19.19	1.90
German slaughterhouse pigs
Pig 1 spleen	24.57		18.52			1.83
liver	28.66		20.12			1.91
Pig 2 spleen	21.67		17.68			1.80
liver	22.00		18.30			1.83
Pig 3 spleen	26.43		17.51			1.92
liver	31.05		20.08			1.84
Pig 4 spleen	25.11		18.20			1.86
liver	26.46		19.24			1.90
Pig 5 spleen	25.78		19.02			1.87
liver	28.90		20.00			1.93
Pig 6 spleen	26.36		19.39			1.89
liver	26.19		19.97			1.90
Pig 7 spleen	25.78		19.22			1.81
liver	27.42		20.17			1.82
Pig 8 spleen	23.49		19.59			1.85
liver	23.05		20.10			1.92
Pig 9 spleen	29.40		19.06			1.84
liver	31.68		19.84			1.93
Pig 10 spleen	27.12		19.12			1.87
liver	33.57		20.25			1.91

^aindicates the purity of the DNA; n.d., not detected

Table 3 Comparison if the sequences of the primers and probes used for the PCRs and real-time PCRs with the sequences found in the amplicons obtained by PCR8 using DNA from indigenous Greek black pigs 3 and 4

PCR	Fwd/rev
1	fwd	Primer	CTGACCTGGATTAGAACTGG
		Pig 3	disrupted	PCR8
		Pig 4	CTGACCTGGATTAGAACTGG	PCR8
1	rev	Primer	CCAGGACCATCCTCTAACAT
		Pig 3	disrupted	PCR8
		Pig 4	CCAGGACCATCCTCTAACAT	PCR8
4	fwd	Primer	GATTAGAACTGGAAGCCCCAAGTGCTCT
		Pig 3	disrupted	PCR8
		Pig 4	GATTAGAACTGGAAGCCCCAAGTGCTCT	PCR8
	rev	Primer	ACCATCCTCTAACATAACTTCTGGATCAGA
		Pig 3	disrupted	PCR8
		Pig 4	ACCATCCTCTAACATAACTTCTGGATCAGA	PCR8
5	fwd	Primer	CTATTCGCCTCAAAATAAACCAG
		Pig 3	CTATTCGCCTCAGAATAGAAACTCAG	PCR8
		Pig 4	CTATTCGCCTCAAAATAAACCAG	PCR8
	rev	Primer	CATAGAGACCAATGCACATG
6	fwd	Primer	CCAGGACCACCAAATAATGG
		Pig 3	not available	PCR8
		Pig 4	not available	PCR8
	rev	Primer	ACTAAAATGGGGGCAAAACTT
		Pig 3	ATTAAAACAGGGGCGAAACTT	PCR8
		Pig 4	ACTAAAATGGGGGCAAAACTT	PCR8
Real-time PCR	fwd	Primer	CCCCAACCCAAGGACCAG
		Pig 3	CTCCAATCCAAGAACCGA	PCR8
		Pig 4	CCCCAACCCAAGGACCAG	PCR8
	probe	Probe	CTCTAACATAACTTCTGGATCAGACCC
		Pig 3	TTACAATACAACCTCTGGATCAGTCCC	PCR8
		Pig 4	CTCTAACATAACTTCTGGATCAGACCC	PCR8
	rev	Primer	ACTAAAATGGGGGCAAAACTT
		Pig 3	ATTAAAACAGGGGCGAAACTT	PCR8
		Pig 4	ACTAAAATGGGGGCAAAACTT	PCR8
7	fwd corresponds to fwd primer of PCR5
	rev corresponds to the rev primer of the real-time PCR
8	fwd corresponds to fwd primer of PCR6
	rev corresponds to the rev primer of PCR5
9	fwd corresponds to the fwd primer of the real-time PCR
	rev corresponds to the reverse primer of PCR5

fwd, forward primer, rev, reverse primer; mutations in comparison to the primer sequence were marked bold and grey.

No competing interests reported.

Download PDF

Reviews received at journal
11 Sep, 2024
Reviews received at journal
02 Sep, 2024
Reviewers agreed at journal
26 Aug, 2024
Reviewers agreed at journal
06 Aug, 2024
Reviewers invited by journal
05 Aug, 2024
Editor assigned by journal
30 Jul, 2024
Submission checks completed at journal
30 Jul, 2024
First submitted to journal
26 Jul, 2024

You are reading this latest preprint version

Screening for porcine endogenous retrovirus - C (PERV-C) in pigs

Status:

Version 1

Abstract

Figures

Introduction

Results

Discussion

Materials and Methods

Animals and tissues

DNA isolation

PCR and real-time PCR

Sanger sequencing

Nanopore sequencing

Sequence alignment and phylogenetic tree

Declarations

References

Tables

Additional Declarations

Supplementary Files

Status:

Version 1