Investigating the Role of IL-6 in the Pathogenesis of Systemic Lupus Erythematosus: Insights from Bone Marrow Mesenchymal Stem Cells

doi:10.21203/rs.3.rs-4817471/v1

Download PDF

Research Article

Investigating the Role of IL-6 in the Pathogenesis of Systemic Lupus Erythematosus: Insights from Bone Marrow Mesenchymal Stem Cells

https://doi.org/10.21203/rs.3.rs-4817471/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Systemic lupus erythematosus is a common autoimmune disease. Studies have suggested that defective stem cells could be involved in the pathogenesis of systemic lupus erythematosus, which leads to changes in the function of immune cells. By observing the cell morphology, autophagy, and senescence of bone marrow mesenchymal stem cells (BMSCs) from lupus mice and normal controls, this study investigated the role of IL-6 in autophagy and senescence of BMSCs and explored relevant mechanisms. Female MRL/lpr and C57 mice with similar weights and sizes at 20–22 weeks old were selected. BMSCs were isolated using the whole bone marrow adherent method. Quantitative real-time polymerase chain reaction, β-galactosidase staining, western blotting, and ELISA were used to detect autophagy and senescence. Compared with BMSCs from normal mice, BMSCs from lupus mice exhibited low autophagy and premature senescence with a senescence-associated secretory phenotype. The addition of exogenous IL-6 increased the protein levels of p-STAT3 and Bcl-2, and in the IL-6-treated group, the premature senescence of cells increased and autophagy decreased. The biological functions of BMSCs from MRL/lpr lupus mice were impaired. IL-6 prevents autophagy and subsequently promotes the senescence of BMSCs by activating the IL-6/STAT3 pathway.

Systemic lupus erythematosus

bone marrow mesenchymal stem cells

autophagy

senescence

IL-6

lupus mice.

Systemic lupus erythematosus (SLE) is a chronic and systemic autoimmune disease. Currently, the etiology of SLE is unclear. An increasing number of researchers believe that lupus erythematosus is a stem cell-related disease. Abnormal bone marrow mesenchymal stem cells (BMSCs) in SLE can affect the hematopoietic microenvironment by secreting cytokines and direct contact, resulting in abnormal proliferation and differentiation of hematopoietic stem cells, which consequently affects the maturation of B lymphocytes and leads to immune abnormalities (autoimmune) and the occurrence of lupus[1].

Some researchers found that BMSCs from SLE patients exhibited aging-related characteristics[2] and abnormalities in the secretion of immunomodulatory factors and immune regulation[3]. In this study, BMSCs from lupus mice (MRL/lpr) and healthy controls (C57) were cultured in vitro; biological characteristics, including cell morphology, autophagy, and senescence, were compared; and the role and mechanism of IL-6 in this process were also observed.

Mice

Female B6.MRL/lpr mice (20–22 weeks of age) were purchased from the Model Animal Research Center of Nanjing University (Nanjing, China). Female C57BL/6 mice of the same age were purchased from the Laboratory Animal Research Center of Southern Medical University (Guangzhou, China). All the animals were cared for and used in accordance with the International Guiding Principles for Animal Research. All the animal experiments performed in this study were approved by the Animal Ethic Committee of Nanfang Hospital, Southern Medical University.

Cell culture

BMSCs were aseptically isolated from an aspirate of bone marrow harvested from the tibia and femoral marrow compartments⁴ and then cultured in Dulbecco's modified Eagle's medium/Nutrient Mixture F12 Ham (Gibco, USA), fetal bovine serum (Gibco, USA), and antibiotics (penicillin/streptomycin) (100 IU/mL) for 24 h in a 37°C–5% CO₂ incubator. Nonadherent cells were removed after 24 h, and the medium was changed. After that, the medium was changed every 3 days. When BMSCs reached 80% confluence, they were passaged using 0.25% trypsin and 0.01% ethylenediaminetetraacetic acid (Gibco, USA). The cells were used within three passages.

Characterization of BMSCs

The surface markers of BMSCs were evaluated using flow cytometry. The following antibodies were used: anti-CD45, anti-CD11b, and anti-CD44 (all were purchased from eBioscience, San Diego, CA, USA).

SA-β-gal staining

The cells were placed in the C57, MRL/lpr, C57 + IL-6, and MRL/lpr + IL-6 groups. BMSC counts were determined, and 1 × 10⁵ cells were added to each well of a six-well plate. IL-6 (10 ng/mL) was added to the C57 + IL-6 and MRL/lpr + IL-6 groups for 48 h, and the same volume of normal saline was added to the remaining groups. The senescence of BMSCs was determined using a senescence-associated β-galactosidase (SA-β-gal) assay kit (Beyotime, Shanghai, China). The SA-β-gal–positive cells were imaged with a microscope, and the percentage of senescent BMSCs was determined using ImageJ software version 1.52e.

Real-time polymerase chain reaction

Total RNA was obtained using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). cDNA was extracted via reverse transcription with 5X Evo M-MLV RT Reaction Mix (Accurate Biology, Guangzhou, China). mRNA was evaluated via quantitative real-time polymerase chain reaction (qPCR) using SYBR Green Premix Pro Taq HS (Accurate Biology, Guangzhou, China). Each sample was analysed in triplicate. The relative expression of mRNA was determined by normalizing the expression of GAPDH, and the 2^ΔΔCt method was used for data analysis. The list of primers used is presented in Table 1.

Table 1

Primer sequences for qRT‒PCR.
Name	Forward primer	Reverse primer
Beclin1 LC3 p62 p53 p21 IL-6 IL-1α IL-1β NF-κB GAPDH	5′GCTGAGGCGGAGAGATTGG3′ 5′CACACCCATCGCTGACATCTAT3′ 5′GCCCAGTGTCTTGGCATTCT3′ 5′CCCCTGTCATCTTTTGTCCCT3′ 5′CCTGGTGATGTCCGACCTG3′ 5′GGAGCCCACCAAGAACGATA3′ 5′GGATAAAACAACTGAAAAGCACAC3′ 5′GCACCTCACAAGCAGAGCACAA3′ 5′CTTACTCTTTATCTCGCTTTCGG3′ 5′AGGTCGGTGTGAACGGATTTG3′	5′GGTGGCATTGAAGACATTGGT3′ 5′CTTGACTCAGAAGCCGAAGGTT3′ 5′CTGTTCTCAGGCGTCAGCATA3′ 5′AGCTGGCAGAATAGCTTATTGAG3′ 5′CCATGAGCGCATCGCAATC3′ 5′TCACCAGCATCAGTCCCAAG3′ 5′AACCCACTGAGGTAGGAAAGATG3′ 5′TGGGGAAGGCATTAGAAACAGTC3′ 5′RGCTCCAGTCTGTCCCTCTCTA3′ 5′GGGGTCGTTGATGGCAACA3′

Western blot

BMSCs were lysed in radioimmunoprecipitation buffer containing protease inhibitors. Proteins were isolated using electrophoresis with 10% sodium dodecyl sulfate–polyacrylamide gel. The proteins were then transferred to polyvinylidene difluoride membranes. After being blocked with 5% defatted milk, the membranes were incubated with the primary antibodies anti-signal transducer and activator of transcription 3 (STAT3) (1:1000; Cell Signaling, USA), anti-p-STAT3 (1:1000; Cell Signaling, USA), anti-NF-κB (1:1000; Bimake, USA), anti-p62 (1:1000; SAB, USA), anti-LC3 (1:1000; Proteintech, USA), anti-Beclin1 (1:1000; Proteintech, USA), anti-p21 (1:1000; Proteintech, USA), anti-p53 (1:1000; Proteintech, USA), anti-Bcl-2 (1:1000; Proteintech, USA), and GAPDH (1:1000; Proteintech, USA). The membranes were washed with PBS three times and incubated with a secondary antibody. Protein bands were normalized and analysed using ImageJ software version 1.52e.

ELISA

The level of IL-6 within the culture supernatant was measured using an ELISA kit (MultiSciences, Beijing, China) according to the manufacturer’s instructions.

Statistical analyses

All the results are expressed as the mean ± SD. Statistical analyses were performed using GraphPad Prism 8.0 and SPSS 25.0. Student’s t test was used to estimate the differences between the two groups. Differences among multiple groups were determined using one-way ANOVA. p < 0.05 was considered statistically significant.

Characterization of BMSCs

BMSCs exhibited a fibroblast-like shape with colonies in the culture plate, and there was no significant difference between the MRL/lpr and C57 groups (Fig. 1A and 1B). Flow cytometry analysis indicated that CD44, CD45, and CD11b were expressed by 98.6%, 0.27%, and 0.54% of the cells, respectively (Fig. 1C, 1D and 1E).

Senescence of BMSCs

SA-β-gal analysis and the expression of senescence-associated markers (p53 and p21) were used to measure the level of cell senescence. SA-β-gal revealed that the percentage of cell senescence was significantly higher in the MRL/lpr group (36.66 ± 2.08) than in the C57 group (17.33 ± 2.08) (Fig. 2A, 2B and 2C). qPCR results indicated that the mRNA expression levels of p53 (3.59 ± 0.15 vs. 0.99 ± 0.03) and p21 (2.18 ± 0.78 vs. 0.99 ± 0.03) were higher in the MRL/lpr group than in the C57 group (Fig. 2D). The protein expression levels of p53 (0.86 ± 0.04 vs. 0.44 ± 0.02) and p21 (0.62 ± 0.02 vs. 0.37 ± 0.04) were also higher in the MRL/lpr group than in the C57 group (p < 0.05 in all) (Fig. 2E and 2F).

Senescence-associated secretory phenotype in BMSCs

The mRNA and protein levels of senescence-associated secretory phenotype (SASP)-related markers in the MRL/lpr and C57 groups were detected using qPCR, western blot, and ELISA. The results indicated that the mRNA levels of IL-6 (2.43 ± 0.37), IL-1α (7.12 ± 0.54), IL-1β (4.04 ± 1.66), and NF-κB (2.54 ± 0.52) were higher in the MRL/lpr group than in the C57 group (p < 0.05) (Fig. 3A). The protein levels of NF-κB were also higher in the MRL/lpr group than in the C57 group (Fig. 3B). In addition, the level of IL-6 in the culture supernatant of the MRL/lpr group was higher than that of the C57 group (34.14 ± 3.67 vs. 14.03 ± 1.38) (p < 0.05) (Fig. 3C).

Autophagy declines in the MRL/lpr group compared with the C57 group

To compare the autophagy level of BMSCs in the MRL/lpr and C57 groups, qPCR and western blot were performed to detect autophagy-related genes (LC3, Beclin1, and p62). The mRNA levels of LC3 (0.57 ± 0.096 vs. 1.01 ± 0.23) and Beclin1 (0.40 ± 0.56 vs. 1.00 ± 0.65) were lower in the MRL/lpr group than in the C57 group, whereas the mRNA level of p62 (1.97 ± 0.42 vs. 1.00 ± 0.09) was higher in the MRL/lpr group than in the C57 group (Fig. 4A). Moreover, the protein levels of LC3 (0.86 ± 0.08 vs. 1.2 ± 0.06) and Beclin1 (0.74 ± 0.06 vs. 1.41 ± 0.08) were lower in the MRL/lpr group than in the C57 group, but the protein level of p62 (1.14 ± 0.06 vs. 0.90 ± 0.04) was higher in the MRL/lpr group than in the C57 group (p < 0.05) (Fig. 4B and 4C).

IL-6 promotes senescence of BMSCs

To analyse the effect of IL-6 on the senescence of BMSCs, IL-6 (10 ng/mL) was added to the BMSCs of MRL/lpr and C57 mice for 48 h. As presented in Fig. 5A, more β-galactosidase–positive cells were detected in the IL-6-treated group than in the MRL/lpr or C57 group (Fig. 5B, p < 0.05). Moreover, the protein levels of p53 and p21 in the MRL/lpr and C57 groups were found to increase significantly after exogenous IL-6 was added (Fig. 5C and 5D). These findings indicated that IL-6 could induce senescence of BMSCs and play an important role in the senescence of BMSCs in lupus mice.

IL-6 inhibits autophagy in BMSCs through the STAT3/Bcl-2 pathway

To investigate the mechanism of senescence induced by IL-6 in BMSCs, the protein levels of STAT3, p-STAT3, Bcl-2, LC3, Beclin1, and p62 were measured using western blotting. The protein levels of LC3 and Beclin1 were much lower in the IL-6-treated groups than in the other groups. Furthermore, the protein levels of p62, p-STAT3, and Bcl-2 were found to be significantly higher in the groups treated with IL-6 (Fig. 6). These findings indicated that IL-6 could inhibit the autophagy of BMSCs by suppressing the STAT3/Bcl-2 signaling pathway.

SLE is a chronic autoimmune disease that can affect any organ. The etiology and mechanism of SLE are complicated and have not yet been fully clarified. Studies have indicated that the pathogenesis of SLE is related to abnormalities in stem cells. Not only haematopoietic stem cells but also BMSCs are abnormal in SLE patients[2–3]. The bone marrow microenvironment, especially BMSCs, plays a crucial role in both acquired immunity and the maintenance of immune balance⁵. Cell senescence is a process in which physiological functions gradually decline over time, including morphological changes, chromatin remodelling, metabolic changes, gene expression changes, and the emergence of a senescence-associated secretory phenotype (SASP)[6]. The senescence of BMSCs is involved in the pathogenesis of various autoimmune diseases[7]. In this study, we found that the expression levels of p53 and p21 were significantly higher in the MRL/lpr group than in the control group, and the percentage of SA-β-gal–positive cells also increased, suggesting that BMSCs of MRL/lpr mice exhibited premature senescence, which is consistent with the results of previous research[2].

SASP is a chronic inflammatory secretory phenotype that occurs in some senescent cells. It is beneficial in some physiological environments, such as inhibiting the development of cancer and promoting the repair of tissue damage[8–9]. However, in some environments, SASP causes chronic inflammation by secreting inflammatory factors such as IL-6 and IL-8[10], exhibiting negative effects. We found that the mRNA levels of IL-6, IL-1α, and IL-β in BMSCs of MRL/lpr mice increased and that the level of IL-6 in the cell culture supernatant also increased. These cytokines are important inflammatory mediators secreted by SASP cells. NF-κB is a crucial molecule that induces SASP. In this study, both the mRNA and protein levels of NF-κB were increased in BMSCs from MRL/lpr mice. The senescent BMSCs of SLE induce SASP to establish a local inflammatory microenvironment. The homeostasis of the hematopoietic microenvironment was disrupted, which resulted in an abnormal immune system by the disordered self-renewal and differentiation of hematopoietic stem cells, which is an important factor in the pathogenesis of SLE.

Autophagy is a conserved self-degradation system that plays a crucial role in maintaining cell homeostasis under stress conditions; it runs through the whole process of immune response and immune balance. The pathogenesis of various autoimmune diseases has been confirmed to be related to autophagy, including SLE[11]. At the same time, autophagy is also considered to be an important defense mechanism against tissue damage, cell senescence, and SASP[12]. Yang Ma et al[13] found that with the senescence of stem cells, autophagy decreased significantly and that autophagy inhibitors could reverse senescence in stem cells. In this study, we found that the expression of the autophagy markers LC3 and Beclin1 in BMSCs from MRL/lpr mice decreased and that the expression of p62 increased, suggesting that autophagy in BMSCs from MRL/lpr mice decreased, which could be one of the causes of cell senescence.

IL-6 is an important factor involved in inflammation and autoimmune diseases. Aging and excessive production or failure to eliminate oxygen free radicals can stimulate the production of IL-6[14], which can induce senescence[15]. In addition, IL-6 is involved in the regulation of autophagy and inhibits the expression of autophagy-related genes such as Beclin1 and LC3 by activating the phosphorylation of STAT3[16]. As a downstream transcription factor of IL-6/IL-6R, STAT3 can transduce extracellular signals by interacting with peptide receptors on the cell surface. It inhibits autophagy, mainly reflected in the destruction of the Beclin1/PIK3C3 complex, transcriptionally activates BCL2 family members (BCL2/BCL2L1/MCL1) and upregulates the expression of BCL-2, which negatively regulates Beclin1 production[17]. STAT3 can also directly bind to the promoter region of Beclin1, inhibiting its transcription[18]. In addition, phosphorylated STAT3 directly promoted cell senescence by upregulating the p53/p21 pathway[19]. We found that the level of IL-6 increased in the culture supernatant of BMSCs from MRL/lpr mice compared with that of the C57 mice. Exogenous IL-6 can inhibit autophagy and promote senescence in BMSCs of both C57 and MRL/lpr mice when cultured in vitro. After exogenous IL-6 was added, the level of p-STAT3 increased, and Bcl-2 was activated, suggesting that IL-6/STAT3 is an important signaling pathway involved in the regulation of autophagy and senescence.

In summary, our study found that the autophagy of BMSCs in MRL/lpr mice decreased, and premature senescence combined with SASP occurred. The increased level of IL-6 activated Bcl-2 by phosphorylating STAT3, inhibited autophagy, and induced premature senescence (Fig. 7). Therefore, the activation of IL-6/STAT3 is involved in the senescence of BMSCs in lupus mice, which may be one of the factors in the pathogenesis of SLE.

SLE BMSCs have shown a tendency towards premature ageing in previous studies, which is related to the onset of disease. However, the specific mechanism of premature aging is not yet clear. In our study, we found that premature aging of SLE BMSCs is accompanied by the activation of the IL6-STAT3 pathway and a decrease in cell autophagy ability, which is one of the important mechanisms contributing to the pathogenesis of SLE.

Systemic lupus erythematosus (SLE), bone marrow mesenchymal stem cells (BMSCs), quantitative real-time polymerase chain reaction (qPCR), senescence-associated secretory phenotype (SASP), senescence-associated β-galactosidase (SA-β-gal), signal transducer and activator of transcription 3 (STAT3), nuclear factor kappa-B, NF-κB.

Competing interests

The authors have no relevant financial or non-financial interests to disclose.

Authors' contributions Zhang Zhiwen: Data curation, Writing-Original draft. Zhang Wenjing: Visualization, Conceptualization, Methodology. Zhu Silang and Li Qian:Investigation. Wei Shanshan: Funding acquisition. Zhu Junhao: Formal analysis. Yin Li and Yang Shan: Validation. Lai Kuan: Funding acquisition, Supervision, Writing-Reviewing and Editing.

All authors reviewed the manuscript.

Ethics approval

This study was performed in line with the principles of the Declaration of Helsinki. Approval was granted by the Animal Ethic Committee of Nanfang Hospital, Southern Medical University.

Funding

This research was supported by the National Natural Science Foundation of China (No. 82073440) and the Guangzhou Municipal Science and Technology Project (No. 2023A04J2432).

Author Contribution

Zhang Zhiwen: Data curation, Writing-Original draft. Zhang Wenjing: Visualization, Conceptualization, Methodology. Zhu Silang and Li Qian: Investigation. Wei Shanshan: Funding acquisition. Zhu Junhao: Formal analysis. Yin Li and Yang Shan: Validation. Lai Kuan: Funding acquisition, Supervision, Writing-Reviewing and Editing. All authors reviewed the manuscript.

Acknowledgement

We thank LetPub (www.letpub.com) for its linguistic assistance during the preparation of this manuscript.

Availability of data and materials

All data generated during this study are included in this published article and its supplementary file.

W. Y. Tang, J. H. Liu, C. J. Peng, Y. Liao, J. S. Luo, X. Sun, Y. L. Tang and X. Q. Luo. 2021. Functional Characteristics and Application of Mesenchymal Stem Cells in Systemic Lupus Erythematosus. Arch Immunol Ther Exp (Warsz) 69: 7. https://doi.org10.1007/s00005-021-00603-y.
J. Ji, T. Fu, C. Dong, W. Zhu, J. Yang, X. Kong, Z. Zhang, Y. Bao, R. Zhao, X. Ge, X. Sha, Z. Lu, J. Li and Z. Gu. 2019. Targeting HMGB1 by ethyl pyruvate ameliorates systemic lupus erythematosus and reverses the senescent phenotype of bone marrow-mesenchymal stem cells, Aging (Albany NY) 11: 4338-53. https://doi.org10.18632/aging.102052.
W. Tan, Z. Gu, J. Leng, X. Zou, H. Chen, F. Min, W. Zhou, L. Zhang and G. Li. 2019. Let-7f-5p ameliorates inflammation by targeting NLRP3 in bone marrow-derived mesenchymal stem cells in patients with systemic lupus erythematosus, Biomed Pharmacother 118: 109313. https://doi.org10.1016/j.biopha.2019.109313.
M. Soleimani and S. Nadri. 2009. A protocol for isolation and culture of mesenchymal stem cells from mouse bone marrow, Nature Protocols 4: 102-6. https://doi.org10.1038/nprot.2008.221.
K. Le Blanc and D. Mougiakako. 2012. Multipotent mesenchymal stromal cells and the innate immune system, Nat Rev Immunol 12: 383-96.https://doi.org10.1038/nri3209.
Y. Li, Q. Wu, Y. Wang, L. Li, H. Bu and J. Bao. 2017. Senescence of mesenchymal stem cells (Review), Int J Mol Med 39: 775-82. https://doi.org10.3892/ijmm.2017.2912.
P. Cipriani, P. Di Benedetto, V. Liakouli, P. B. Del, M. Di Padova, M. Di Ianni, A. Marrelli, E. Alesse and R. Giacomelli. 2013. Mesenchymal stem cells (MSCs) from scleroderma patients (SSc) preserve their immunomodulatory properties although senescent and normally induce T regulatory cells (Tregs) with a functional phenotype: implications for cellular-based therapy, Clin Exp Immunol 173: 195-206. https://doi.org10.1111/cei.12111.
D. V. Faget, Q. Ren and S. A. Stewart. 2019. Unmasking senescence: context-dependent effects of SASP in cancer, Nat Rev Cancer 19: 439-53. https://doi.org10.1038/s41568-019-0156-2.
D. J. Baker, B. G. Childs, M. Durik, M. E. Wijers, C. J. Sieben, J. Zhong, R. A. Saltness, K. B. Jeganathan, G. C. Verzosa, A. Pezeshki, K. Khazaie, J. D. Miller and J. M. van Deursen. 2016. Naturally occurring p16(Ink4a)-positive cells shorten healthy lifespan, Nature 530: 184-9. https://doi.org10.1038/nature16932.
J. Campisi. 2013. Aging, cellular senescence, and cancer, Annual Review of Physiology 75: 685-705. https://doi.org10.1146/annurev-physiol-030212-183653.
A. J. Clarke, U. Ellinghaus, A. Cortini, A. Stranks, A. K. Simon, M. Botto and T. J. Vyse. 2015. Autophagy is activated in systemic lupus erythematosus and required for plasmablast development, Ann Rheum Dis 74: 912-20. https://doi.org10.1136/annrheumdis-2013-204343.
K. Jia and B. Levine. 2007. Autophagy is required for dietary restriction-mediated life span extension in C. elegans, Autophagy 3: 597-9. https://doi.org10.4161/auto.4989.
Y. Ma, M. Qi, Y. An, L. Zhang, R. Yang, D. H. Doro, W. Liu and Y. Jin. 2018. Autophagy controls mesenchymal stem cell properties and senescence during bone aging, Aging Cell 17. https://doi.org10.1111/acel.12709.
J. C. Milan-Mattos, F. F. Anibal, N. M. Perseguini, V. Minatel, P. Rehder-Santos, C. A. Castro, F. A. Vasilceac, S. M. Mattiello, L. H. Faccioli and A. M. Catai.2019. Effects of natural aging and gender on pro-inflammatory markers, Braz J Med Biol Res 52: e8392. https://doi.org10.1590/1414-431X20198392.
T. Kuilman, C. Michaloglou, L. C. Vredeveld, S. Douma, R. van Doorn, C. J. Desmet, L. A. Aarden, W. J. Mooi and D. S. Peeper. 2008. Oncogene-induced senescence relayed by an interleukin-dependent inflammatory network, Cell 133: 1019-31. https://doi.org10.1016/j.cell.2008.03.039.
B. Qin, Z. Zhou, J. He, C. Yan and S. Ding. 2015. IL-6 Inhibits Starvation-induced Autophagy via the STAT3/Bcl-2 Signaling Pathway, Scientific Reports 5: 15701. https://doi.org10.1038/srep15701.
J. F. Bromberg, M. H. Wrzeszczynska, G. Devgan, Y. Zhao, R. G. Pestell, C. Albanese and J. J. Darnell. 1999. Stat3 as an oncogene, Cell 98:, 295-303. https://doi.org10.1016/s0092-8674(00)81959-5.
F. Hu, D. Song, Y. Yan, C. Huang, C. Shen, J. Lan, Y. Chen, A. Liu, Q. Wu, L. Sun, F. Xu, F. Hu, L. Chen, X. Luo, Y. Feng, S. Huang, J. Hu and G. Wang. 2021. IL-6 regulates autophagy and chemotherapy resistance by promoting BECN1 phosphorylation, Nature Communications 12: 3651. https://doi.org10.1038/s41467-021-23923-1.
J. Chen, T. Xu, D. Zhu, J. Wang, C. Huang, L. Lyu, B. Hu, W. Sun and Y. Duan. 2016. Egg antigen p40 of Schistosoma japonicum promotes senescence in activated hepatic stellate cells by activation of the STAT3/p53/p21 pathway, Cell Death & Disease 7: e2315. https://doi.org10.1038/cddis.2016.228.

No competing interests reported.

originaluncroppedgelsorblots.zip

Download PDF

Reviews received at journal
12 Sep, 2024
Reviewers agreed at journal
09 Sep, 2024
Reviewers agreed at journal
19 Aug, 2024
Reviewers invited by journal
19 Aug, 2024
Editor assigned by journal
31 Jul, 2024
Submission checks completed at journal
29 Jul, 2024
First submitted to journal
28 Jul, 2024

You are reading this latest preprint version

Investigating the Role of IL-6 in the Pathogenesis of Systemic Lupus Erythematosus: Insights from Bone Marrow Mesenchymal Stem Cells

Status:

Version 1

Abstract

Figures

INTRODUCTION

MATERIALS AND METHODS

Mice

Cell culture

Characterization of BMSCs

SA-β-gal staining

Real-time polymerase chain reaction

Western blot

ELISA

Statistical analyses

RESULTS

Characterization of BMSCs

Senescence of BMSCs

Senescence-associated secretory phenotype in BMSCs

Autophagy declines in the MRL/lpr group compared with the C57 group

IL-6 promotes senescence of BMSCs

IL-6 inhibits autophagy in BMSCs through the STAT3/Bcl-2 pathway

DISCUSSION

CONCLUSION

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1