CCR2 receptor inhibition alleviated post-intraventricular hemorrhage hydrocephalus through the glymphatic pathway

doi:10.21203/rs.3.rs-4823312/v1

Download PDF

Research Article

CCR2 receptor inhibition alleviated post-intraventricular hemorrhage hydrocephalus through the glymphatic pathway

https://doi.org/10.21203/rs.3.rs-4823312/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Background

Hydrocephalus is a common neurosurgical condition with significant limitations in traditional treatment methods. The glymphatic system, an emerging concept, has an unclear role in hydrocephalus. This study focuses on exploring the glymphatic system and its regulatory mechanisms in post-intraventricular hemorrhage (IVH) hydrocephalus, particularly the crucial role and mechanisms of the CCL2/CCR2 signaling pathway. The aim is to provide new targets and strategies for the treatment of hydrocephalus.

Methods

An IVH mouse model was used to induce hydrocephalus. CCR2 was knocked down through viral transfection techniques, and various experimental methods, including cerebrospinal fluid (CSF) tracing, ultrastructural observation, MRI imaging, and immunofluorescence analysis, were employed to evaluate its effects on hydrocephalus.

Results

The study found that the distribution of fluid components in the brain changes after IVH, and harmful metabolites accumulate in the brain, leading to neurological dysfunction and hydrocephalus. Knocking down CCR2 restored the polarization of aquaporin 4 (AQP4), improved glymphatic system (GS) dysfunction, and significantly alleviated the progression of hydrocephalus in IVH mice. CSF flow tests and tracer experiments confirmed that inhibiting CCR2 could restore CSF flow and remove of harmful metabolites. Additionally, inhibiting CCR2 significantly improved motor and cognitive functions in IVH mice.

Conclusion

This study suggests that CCR2 plays a crucial role in the occurrence and development of hydrocephalus after IVH. Knocking down CCR2 can reduce endoplasmic reticulum stress, restore AQP4 polarization, improve GS function, and thereby alleviate hydrocephalus and restore neurological function.

CCR2

glymphatic system

endoplasmic reticulum stress

hydrocephalus

AQP4

intraventricular hemorrhage

Hydrocephalus, as one of the common diseases in neurosurgery, is a severe disease that affects patients of all ages. The incidence of pediatric hydrocephalus is approximately 0.1–0.6%, comparable to that of Down syndrome in infants[1]. Although surgery is currently the mainstay treatment for hydrocephalus, surgical complications and secondary surgical trauma increase the physical and economic burden on patients. Statistics show that the revision rate of shunts due to obstruction and other factors ranges from 32–63%[2, 3]. In the United States, less than one-third of annual hydrocephalus surgeries are for patients undergoing their first surgery[4, 5]. Research progress in non-surgical treatments has been exceedingly slow and the results are often disappointing. Treatments such as the use of diuretics, intrathecal injection of fibrinolytic agents, and dexamethasone[6–9] have not yielded satisfactory outcomes. Currently, there is an urgent need for breakthroughs in hydrocephalus treatment research.

In recent years, the glymphatic system (GS) has been proposed as another important absorption link of cerebrospinal fluid (CSF), breaking the traditional concept of CSF circulation. It is believed that CSF can not only circulate through the ventricular system, but also enter the brain parenchyma and exchange with interstitial fluid (ISF), influencing the distribution and absorption of CSF. Georgiopoulos et al. used diffusion tensor imaging (DTI) technology and found that the ALPS index (diffusion tensor imaging index along the perivascular space) was significantly reduced in patients with normal intracranial pressure hydrocephalus (iNPH), suggesting that GS may be related to the severity of iNPH[10]. Ding et al. found that inhibiting astrogliosis can improve the CSF absorption function of GS, thereby reducing the occurrence of hydrocephalus, during the study of gastric matrix hemorrhage (GMH)[11]. Aquaporin 4 (AQP4) is one of the most important proteins regulating GS function, primarily located in the endfeet of astrocytes. The absence or disruption of AQP4 polarization can lead to GS dysfunction, which is involved in the occurrence and development of various neurological diseases, such as Alzheimer's disease, TBI, SAH[12–14]. Research has shown that the structural integrity of β-dystroglycan (β-DG) is essential for the contact between the vascular basement membrane and astrocyte endfeet, as well as for AQP4 polarization. Its N-terminus has been identified as a specific substrate for proteolytic cleavage by matrix metalloproteinase 9 (MMP-9)[15]. GS dysfunction may play a crucial role in the occurrence and development of hydrocephalus. However, research on GS is still in the exploratory stage, requiring further in-depth studies.

Neuroinflammation is involved in the pathological process of hydrocephalus[16]. C-C chemokine receptor type 2 (CCR2) is a typical representative of the CC chemokine family, mainly expressed in astrocytes, T lymphocytes, and monocytes/macrophages. It is a significant participant in neuroinflammation and is highly regarded due to its association with the pathogenesis of various neurological diseases[17]. Tian Q[18] and Zhang K[19] found that inhibiting CCR2 reduced inflammatory cell infiltration, alleviated neuroinflammation, and apoptosis in studies of SAH and ethanol-induced diseases. In addition, inhibiting CCR2 can also reduce MMP-9 produced by inflammatory cell activation, improve pulmonary fibrosis, and inhibit cancer cell metastasis[20, 21]. Therefore, it can be reasonably assumed that CCR2 is highly likely to be involved in the pathological and physiological processes of hydrocephalus. However, there is a paucity of pertinent reports, and the mechanism of action remains uncertain. In summary, we hypothesized that CCR2-mediated neuroinflammation plays a role in the development of hydrocephalus after IVH. We explored the occurrence and development of hydrocephalus through the GS pathway, analyzed its intervention mechanism and treatment targets, aiming to provide certain experimental basis for better treatment of hydrocephalus and clinical transformation.

Experimental Animals and Grouping

This study used SPF-grade healthy adult C57BL/6 male mice (6–8 weeks old, weighing 18-24g). The mice were purchased from Hunan Silaikejingda Experimental Animal Co., Ltd. (SCXK (Xiang) -2019-0004) and raised in an SPF-grade animal facility with a room temperature of 25°C, humidity of 40–70%, and a 12-hour light/dark cycle. Free access to water and food. All mice were randomly divided into four groups: Sham group, IVH group, shRNAvc + IVH (CCR2_VC + IVH) group, and shRNAccr2 + IVH (CCR2_KD + IVH) group. The Sham group underwent the same procedures as the IVH group, except for the ventricular puncture.

Animal Model of IVH

The IVH model was established using autologous blood[22]. Mice were anesthetized with sodium pentobarbital (40 mg/kg) and subjected to sterile surgical procedures. The scalp was incised to expose the skull, and after disinfection, 40 µL of autologous blood was injected into the right lateral ventricle at a rate of 5 µL/min using a Hamilton micro-syringe (coordinates: AP: -1.0 mm, ML: 1 mm, DV: 2.3 mm). The needle was left in place for 10 minutes after injection, and the mice were then placed in a warming chamber until they regained consciousness.

Neurologic Deficit Scoring

The wire-hanging test and the neurologic deficit score were evaluated by independent researchers as previously described[23]. The neurological deficit score evaluates the gait, climbing, and body symmetry of mice, with a maximum score of 28 and a minimum score of 0. The higher the score, the more severe the neurological dysfunction. The wire-hanging test is used to evaluate the grip strength, endurance, and balance of mice. Briefly, the hind limbs of the mice are restrained and the forelimbs are suspended on a wire 50-55cm above the ground, and the suspension time of the mice on the wire is recorded.

Morris Water Maze (MWM)

On the 28th to 32nd day after IVH, The Morris water maze test was used to evaluate the spatial learning and memory abilities of mice. In short, the experiment includes a training phase (5d) and a testing phase (1d). During the training phase, each mouse was trained four times per day from the first to the fourth quadrant. In the testing phase, the platform was removed, and the mice were placed in the quadrant opposite the platform's location, recording their movement trajectory, the number of times they crossed the platform area, and the time spent in each quadrant.

Open Field Test

At the beginning of the experiment, mice were placed in the center of the open field test box, and their movement trajectories and time spent in each area were recorded for 5 minutes. After each test, the inner walls and floor of the box were cleaned, and any residual information from the previous animal (such as feces and fur) was removed to avoid affecting subsequent test results.

Hematoxylin and Eosin Staining

After deparaffinization of paraffin-embedded sections, the brain tissue coronal sections were first stained with hematoxylin solution (Servicebio, Wuhan, China) for 5 minutes, and then treated with hematoxylin differentiation solution. The sections were then stained with eosin (Servicebio) for 5 minutes, dehydrated, and sealed for preservation. Images were collected using an optical microscope (BX53F; Olympus, Tokyo, Japan).

Immunofluorescence and Immunohistochemistry Analysis

Immunofluorescence (IF) staining was performed as previously described. After perfusing and extracting the mouse brain, the tissue was fixed, dehydrated, and embedded in paraffin for immunohistochemical and immunofluorescent staining. After paraffin sectioning, dehydration, and antigen repair, the primary antibody was incubated overnight at 4 ℃ with 10% normal goat serum at room temperature for 1 hour. Primary antibodies were incubated overnight at 4°C: anti-LYVE1 (rat, 1:200, Thermo Fisher, 14-0443-82), anti-AQP4 (rabbit, 1:200, Abcam, ab259318), anti-GFAP (rat, 1:250, Abcam, ab279291), anti-EEA1 (mouse, 1:500, Thermo Fisher, 14-9114-82), anti-CD31 (mouse, 1:600, Servicebio, GB12063-100), and anti-β-Dystroglycan (mouse, 1:200, Santa, sc-33702). Secondary antibodies were incubated at room temperature for 2 hours, followed by DAPI staining for 10 minutes. For immunohistochemistry, the tissue sections were incubated overnight with anti p-Tau (s396) antibodies (1:200, Huabio, ET1611-68) at 4 ° C, and subsequent steps were performed according to the reagent kit instructions. Observations were made using an inverted fluorescence microscope (BX53, Olympus).

Transmission and Scanning Electron Microscopy

Scanning Electron Microscopy (SEM)

Mouse brains were perfused and collected. Brain tissue was placed in electron microscopy fixative at 4°C overnight. Cut out tissue blocks with ventricular walls. Wash twice with up water for 5 minutes each time, using gradient alcohol dehydration with alcohol concentrations of 30%, 50%, 70%, 80%, 90%, 95%, and 100%, for 10 minutes per gradient. Stick the sample onto conductive adhesive, spray it with ion sputtering, and select a suitable position under the mirror for observation and photography.

Transmission Electron Microscopy (TEM)

The tissue preparation and preservation methods were the same as for SEM. The samples were fixed, dehydrated, and embedded. Ultrathin sections approximately 90 nm thick were prepared using an ultramicrotome, spread, and placed on copper grids. The sections were stained sequentially with uranyl acetate for 10 minutes and lead citrate for 2 minutes at room temperature. Images were collected using a transmission electron microscope to observe the corresponding pathological changes.

7.0T Magnetic Resonance Imaging (MRI)

Mice were anesthetized with 2% isoflurane to ensure they remained calm throughout the MRI examination. A 7.0-T Varian MRI scanner (Bruker, USA) was used to observe the head using T2-weighted sequences. The parameters were as follows: T2 fast spin-echo sequence (matrix, 256 × 256; echo time, 2.5 ms; repetition time, 100 ms). Images were acquired with a field of view of 35 mm × 35 mm and a slice thickness of 0.5 mm, resulting in 20 coronal images. Finally, 3D Slicer was used for three-dimensional reconstruction of the mouse ventricular system.

Western Blot (WB) Analysis

Mice were euthanized post-IVH, and total protein was harvested from the periventricular and hippocampal regions using radioimmunoprecipitation assay (RIPA) buffer (Servicebio). Proteins were transferred onto polyvinylidene fluoride (PVDF) membranes (Millipore, Billerica, MA, USA) and blocked with 5% bovine serum albumin (BSA) at room temperature for 1 hour. Membranes were incubated overnight at 4°C with primary antibodies: anti-CCR2 (rabbit, 1:3000, Proteintech, 16153-1), anti-CCL2 (rabbit, 1:1000, Abcam, ab283927), anti-GRP78 (rabbit, 1:1000, Cell Signaling Technology, 3177s), anti-phospho-Tau (Ser396) (rabbit, 1:1000, Huabio, ET1611-68), anti-phospho-PERK (rabbit, 1:1000, Abcam, ab229912), anti-PERK (rabbit, 1:1000, Abcam, ab192591), anti-eIF2α (rabbit, 1:1000, Santa, sc-133132), anti-phospho-eIF2α (rabbit, 1:1000, Cell Signaling Technology, 3398s), anti-IRE1α (rabbit, 1:1000, Proteintech, 27528-1), anti-NF-κB (rabbit, 1:1000, Cell Signaling Technology, 3033s), anti-MMP-9 (rabbit, 1:1000, Abcam, ab228402), anti-AQP4 (rabbit, 1:1000, Abcam, ab259318), and anti-β-Dystroglycan (mouse, 1:1000, Santa, sc-33702). Anti-Tubulin (rat, 1:1000, Abcam, ab6161) and anti-GAPDH (mouse, 1:1000, Servicebio, GB15002) were used as internal references. Membranes were then incubated with secondary antibodies: HRP-conjugated Affinipure Goat Anti-Mouse IgG (H + L) (1:8000, Proteintech, SA00001-1), HRP-conjugated Affinipure Goat Anti-Rabbit IgG (H + L) (1:8000, Proteintech, SA00001-2), and HRP-conjugated Affinipure Goat Anti-Rat IgG (H + L) (1:8000, Proteintech, SA00001-15). The protein bands were visualized using an enhanced chemiluminescence system (Millipore Sigma) and analyzed for band intensity using FIJI (ImageJ).

RNA-seq and bioinformatics analysis of tissue samples

Brain tissues were placed in pre-cooled RNase-free cryotubes, snap-frozen in liquid nitrogen, and sent to Shanghai Majorbio Bio-pharm Technology Co., Ltd. for transcriptome sequencing analysis. Successfully quality-checked samples were sequenced on the Illumina Novaseq6000 platform. Differentially expressed genes (DEGs) were screened using DESeq2 software, with selection criteria: |log2FC| ≥ 1.0 and Padj < 0.05. The results were visualized using a volcano plot. KEGG enrichment analysis of DEGs was conducted through the DAVID database, and protein-protein interaction (PPI) network analysis of DEGs in the pathways of interest was performed using the STRING database. Key genes were identified and their expression levels were displayed in a heatmap.

Cell Culture and Cell Viability Assay

For in vitro studies, mouse astrocytes (C8D1A) are cultured in DMEM medium containing 10% fetal bovine serum and 1% penicillin/streptomycin, and incubated in a sterile incubator at 37°C with 5% CO2. Hemin is used as an intervention to simulate intracerebral hemorrhage. Cell viability is assessed using the Cell Counting Kit-8 (CCK-8, Servicebio, G4103-5ML). Cells are seeded into 96-well plates and treated with varying concentrations of Hemin for 24 hours. After treatment, 10 µL of CCK-8 solution is added and incubated for 2 hours. Absorbance is measured at 450 nm using an enzyme-linked immunosorbent assay reader.

CCR2 knockdown

The corresponding shRNA was designed using the following website: https://www.vectorbuilder.cn/tool/shrna-target-design/06822d0e-9725-4777-8d5a-e310487194ac.html, and synthesized by Qingke Biological Technology Co., Ltd. The synthesized sequences were cloned into the pLKO.1 vector between the AgeI and EcoRI restriction sites. The resulting recombinant vector was verified by sequencing. In this study, AAV (adeno-associated virus) serotype 9 was used for transfection. For in vivo transfection, 3 µL of AAV (containing 1x10^10 viral particles) was injected into the brain ventricle at a rate of 0.5 µL/min, with a retention time of 5 minutes to prevent backflow. After 28 days post-virus injection, the transfection efficiency was verified by WB. Upon successful transfection, subsequent experiments were carried out. The CCR2 knockdown sequences used in the in vivo experiments were: shRNAccr2-1:GTATTAGTCACAGAGATAATT、shRNAccr2-2: TTATGAAGTCATGCGTTTAAT and shRNAccr2-3:AGAACTTTCACCTTCATATAT. For in vitro experiments, transfected cells were treated with puromycin for 7 days to select successfully transfected cells. CCR2 expression was evaluated by WB, and the cells were cultured for subsequent in vitro experiments. The knockdown sequences were: shRNAccr2-1: GATGGTGATGAAATGTAAATA、shRNAccr2-2: TTATGAAGTCATGCGTTTAAT and shRNAccr2-3: CTACCTCCAGTTCCTCATTT.

CSF Tracing

Mice are anesthetized with pentobarbital and placed on a stereotaxic frame.

Intracisternal Injection

The skin on the dorsal neck is incised, and the neck muscles are separated to expose the atlanto-occipital membrane. A 25 µL syringe (#710 RN, 0.485 mm ID; Hamilton) with a 33-gauge needle (15 mm, pst 4–12, Hamilton) is used to aspirate 5 µL of 1.5% Alexa Fluor 594 hydrazide (A594, Thermo Fisher, A10442) or 2% Evans Blue (EB, Sigma, E2129-10G). The tracer is injected into the cisterna magna at a rate of 1 µL/min, with the needle inserted approximately 1-1.5 mm. Following the injection, the syringe is held in place for about 5 minutes to prevent backflow. After 30 minutes, the mice are euthanized, and their brains are perfused with pre-cooled PBS and fixed in 4% paraformaldehyde at 4°C overnight. Brain tissues are sectioned coronally at 100 µm using a cryostat and observed under an inverted fluorescence microscope (BX53, Olympus).

Intrahippocampal Injection: The operation steps of Intrahippocampal injection are the same as Intracerebral injection. A 1 µL syringe is filled with 1.5% A594 and injected into the hippocampus at a rate of 0.2 µL/min (coordinates: AP: -1.5 mm, ML: 1 mm, DV: 2 mm). The syringe is held in place for 5 minutes to prevent backflow. After 60 minutes, the mice are euthanized, and subsequent steps follow the same protocol as the intracisternal injection.

Statistical Analysis

All experimental data were statistically analyzed and the images were processed using GraphPad Prism 9.0, FIJI, and Origin Pro software. Immunofluorescence images were quantified using FIJI. Origin was used to generate linear fluorescence projection plots from the fluorescence images. The measurement of perivascular AQP4 polarization was performed as previously described[24]. Briefly, threshold analysis was used to measure the percentage area (AQP4% area) with AQP4 immunofluorescence intensity greater than or equal to that of the perivascular region. Polarization was expressed as the percentage area with AQP4 immunofluorescence intensity less than that of the perivascular region (1 - AQP4% area), with the perivascular region defined as the CD31-positive area. Capillaries (vessel diameter < 10 µm) and large vessels (vessel diameter > 10 µm) were included. GraphPad Prism 9.0 was used for statistical analysis, and all data were presented as mean ± standard deviation (SD). Comparisons between two groups were performed using t-tests, while comparisons among three or more groups were performed using one-way analysis of variance (ANOVA). A p-value of < 0.05 was considered statistically significant.

1. GS Involvement in the Development of Hydrocephalus Post-IVH

Post-IVH in C57BL/6 mice, the ependymal cilia clusters on the ventricular walls, which drive CSF flow and drainage, were severely damaged, exhibiting tangling, swelling, and progressive reduction (Fig. 1A and B). Additionally, the structural continuity of the ventricular walls was disrupted, allowing blood components to enter the brain tissue, causing further damage. There was evident edema in the subventricular zone, severe fluid retention around blood vessels, and both capillaries and large vessels showed collapse and constriction (Fig. 1C). To further track he progression of hydrocephalus after IVH, MRI was used to monitor the ventricular system of mice at different time points. The results showed significant ventricular enlargement by day 3 post-IVH and stable, severe hydrocephalus by day 28 (Fig. 1E and F). As GS plays a crucial role in CSF absorption, we assessed whether it participates in the development of hydrocephalus post-IVH by injecting EB into the cisterna magna to evaluate CSF flow. This is based on the high affinity of EB for serum protein proteins, which helps it to be preferentially cleared by the GS. the results indicated a significant slowdown in EB absorption post-IVH (Fig. 1D), suggesting GS dysfunction. we further examined the expression and distribution of the key glymphatic system protein AQP4 in the subependymal region and around large blood vessels. Post-IVH, there was a marked reduction in AQP4 expression in these regions, along with weakened polarization of AQP4 distribution around blood vessels by astrocytic endfeet (Fig. 1G and H). These findings indicate that GS dysfunction occurs post-IVH and contributes to the development of hydrocephalus.

2. Transcriptomic data bioinformatics analysis

The volcano plot of the transcriptomic sequencing data showed a total of 749 differentially expressed genes, of which 568 were upregulated and 181 were downregulated (Fig. 2A). KEGG enrichment analysis of all differentially expressed genes indicated that the most enriched pathways included cytokine-receptor interaction, phagosome, and chemokine signaling pathways (Fig. 2B). The chemokine signaling pathway involved 28 differentially expressed genes. To analyze the protein-protein interaction (PPI) relationships of these genes, the 28 differentially expressed genes were input into the STRING database, and a PPI interaction network was constructed with a confidence score greater than 0.7 (medium confidence) (Fig. 2C). The analysis results were then imported into Cytoscape software, and the MCODE plugin was used to screen key genes. The screening results identified 16 key genes (Fig. 2D). Subsequently, the Cyto-Hubba plugin was used to identify the top 10 genes by MCC (Fig. 2E)., and the intersection of the two sets of genes yielded 10 key genes, which were displayed in a Venn diagram (Fig. 2F). The gene expression heatmap showed the expression levels of these 10 key genes (Fig. 2G).

3. Knocking down CCR2 reduces fluid retention and alleviates hydrocephalus after IVH

Based on previous bioinformatics analysis results, we examined the expression levels of CCL2 and CCR2 in brain tissue at various time points after IVH. The WB results showed that under normal conditions, CCL2 and CCR2 remained relatively low, but their expression rapidly increased after IVH, peaking at 24 hours and maintaining a high level in the following days (Fig. 3A-D). Subsequently, CCR2 in the brain was knocked down by virus transfection and validated by WB (Fig. 3E and F). The HE staining results showed that compared with the CCR2_VC + IVH group, the interstitial fluid retention in the subventricular zone of the CCR2_KD + IVH group was significantly alleviated, the vascular lumen returned to the filling state, and the perivascular fluid components were significantly absorbed. T2-weighted MRI imaging and 3D reconstruction of the lateral ventricles revealed that while both the CCR2_VC + IVH and CCR2_KD + IVH groups developed hydrocephalus post-IVH, the ventricular expansion was significantly less in the CCR2_KD + IVH group compared to the CCR2_VC + IVH group. These findings suggest that knocking down of CCR2 can alleviate hydrocephalus after IVH.

4. Knocking down CCR2 improves GS dysfunction post-IVH

GS is involved in CSF absorption and plays a crucial role in clearing p-tau protein and other toxic metabolites. To evaluate the effect of knocking down CCR2 on GS, we performed immunohistochemistry and WB analysis of p-Tau protein levels. The results indicated that post-IVH, p-Tau protein expression significantly increased and accumulated in areas such as the cortex and striatum (Fig. 4A). In contrast, the CCR2_KD + IVH group showed a significant reduction in p-Tau levels compared to the CCR2_VC + IVH group, suggesting that knocking down of CCR2 may attenuates IVH-induced GS functional impairment (Fig. 4B and C).To further investigate GS function in CSF flow and interstitial substance absorption, we conducted CSF tracing studies. By injecting 2% EB or 1.5% A594 into the cisterna magna, we found that the CSF tracer primarily spread along the ventral side of the cortical blood vessels into the deep cortex. he diffusion degree of EB decreased significantly in the IVH group and CCR2_VC + IVH group, and the time to reach deep cervical lymph nodes was significantly prolonged. In contrast, this phenomenon was markedly improved in the CCR2_KD + IVH group (Fig. 4D-F). Stereotaxic injection of CSF tracers into the hippocampal region of mice further revealed that the tracer absorption rate in the hippocampal tissue was significantly slower in the IVH and CCR2_VC + IVH groups compared to the CCR2_KD + IVH group, where A594 absorption was notably better (Fig. 4G). These findings indicate that knocking down CCR2 can improve GS dysfunction caused by IVH.

5. Knocking down CCR2 can improve the depolarization state of AQP4 after IVH

To explore how CCR2 affects the function of the glymphatic system, we analyzed the expression and distribution of AQP4 in the subependymal area and the perivascular region. Our study found that the polarization state of AQP4 in the distribution of astrocyte terminals changes after IVH. Compared with the sham group, the expression of AQP4 around blood vessels in the IVH group and CCR2_VC + IVH group decreased and no longer highly clustered near the vascular basement membrane. This phenomenon was improved in the CCR2_KD + IVH group (Fig. 5A). The dual immunofluorescence staining of AQP4 and GFAP showed that the expression of AQP4 in astrocytes in the subependymal zone decreased after IVH. Compared with the IVH group and the CCR2_VC + IVH group, the coverage of AQP4 on astrocytic endfeet around blood vessels significantly increased in the CCR2_KD + IVH group (Fig. 5B). We evaluated the polarization status of AQP4 by immunofluorescence staining of AQP4 and CD31, and the results showed that AQP4 exhibited a depolarization like state after IVH, with more diffuse fluorescence not located along blood vessels, but more distributed in the brain parenchyma (Fig. 5C and E). The projection analysis of AQP4 fluorescence within 20 µm around large blood vessels more intuitively showed this state (Fig. 5F). However, knocking down CCR2 could improve the depolarization state of AQP4 after IVH, and the polarization analysis of AQP4 also confirmed this result (Fig. 5D).

6. Knocking down CCR2 can effectively alleviate motor and cognitive dysfunction after IVH in mice

Results showed that on the first day after IVH, mice exhibited severe neurological dysfunction. Compared to the other groups, the CCR2_KD + IVH group showed significant neurological recovery by the third day. Motor abilities and anxiety levels of the mice were assessed using the suspended wire test and open field test, while spatial exploration and memory abilities were evaluated using the water maze test. The results indicated that, compared to the CCR2_VC + IVH group, the CCR2_KD + IVH group significantly mitigated the motor and memory deficits induced by IVH in mice (Fig. 6).

7. Knocking down CCR2 can alleviate AQP4 internalization by regulating endoplasmic reticulum stress and the NF - κ B signaling pathway

To further investigate how CCR2 regulates the polarization of AQP4, we selected astrocytes, the most critical cells in the glymphatic system, as the in vitro experimental model, and used Hemin to simulate intracerebral hemorrhage. Firstly, we measured the viability of astrocytes under different concentrations of Hemin, and ultimately selected 120 µmol as the concentration for subsequent experiments (Fig. 7A). The results showed that the expression of CCR2 protein in astrocytes was significantly upregulated after Hemin stimulation (Fig. 7B and C), consistent with the in vivo experimental results. Subsequently, we achieved CCR2 knockdown in astrocytes through viral transfection and confirmed it by WB (Fig. 7D and E). The results of dual immunofluorescence staining for AQP4 and early endosome antigen 1 (EEA1) colocalization analysis indicated that the colocalization of AQP4 with EEA1 significantly increased in the IVH and CCR2_VC + IVH groups compared to the sham group, and the expression level of AQP4 was down regulated. Whereas this AQP4 internalization phenomenon was significantly improved in the CCR2_KD + IVH group (Fig. 7F and J).

Hemin stimulation of astrocytes can activate PERK and IRE1α, subsequently inducing and aggravating ER stress and NF-κB signaling pathway. Compared to the CCR2_VC + IVH group, the expression levels of GRP78, p-PERK, p-eIF2α, NF-κB, and MMP-9 were significantly downregulated in the CCR2_KD + IVH group, while β-DG expression was significantly upregulated (Fig. 8).

We obtained similar results in vivo. WB results showed that after IVH, ER stress and NF-κB signaling pathway activation were observed in the IVH and CCR2_VC + IVH groups, with upregulated expression of GRP78, p-PERK, p-eIF2α, NF-κB, and MMP-9 (Fig. 9), and significantly downregulated β-DG and AQP4 (Fig. 10A-E). These changes were markedly alleviated in the CCR2_KD + IVH group with pre-knockdown of CCR2. Immunofluorescence staining results indicated that compared to the IVH and CCR2_VC + IVH groups, the number of AQP4 and β-DG positive cells increased in the CCR2_KD + IVH group (Fig. 10F), with linear analysis of immunofluorescence intensity showing uniform recovery around blood vessels (Fig. 10G), and reduced AQP4 internalization (Fig. 10H). The close contact between astrocytic endfeet and the vascular basement membrane is crucial for the function of the glymphatic system. Using TEM imaging, we observed the ultrastructure of astrocytes around blood vessels. In the IVH and CCR2_VC + IVH groups, we noted that astrocytic endfeet retracted and partially separated from the vascular basement membrane and the contact between the vascular basement membrane and astrocytic endfeet was restored in the CCR2_KD + IVH group, (Fig. 10I).

Hydrocephalus is a pathological condition in which CSF accumulates abnormally in the ventricular system, at the cost of ventricular dilation. It often causes intracranial hypertension and compression of brain tissue, leading to neurological dysfunction and even death. This study selected a post-intraventricular hemorrhage (IVH) hydrocephalus model as the research object. IVH is an independent risk factor for poor clinical outcomes and increased mortality in intracranial hemorrhage (ICH) patients[25, 26]. Patients with post-hemorrhagic hydrocephalus (PHH) have even worse prognoses[27].More and more evidence suggest that neuroinflammation plays a major role in PHH. After IVH, inflammatory markers in the damaged ependymal layer significantly increase, along with increased permeability to proteins such as IgG[28]. Hemoglobin (Hb) and peroxiredoxin-2 (Prx2) from lysed red blood cells are potent inflammatory activators that can activate and recruit inflammatory cells to cause damage to nearby tissues. This has been confirmed in animal models of SAH, IVH, and ICH[29–31]. Our study found that after IVH, ependymal disruption allows blood components to enter the brain parenchyma, leading to astrocyte activation, especially in the subependymal area. Concurrently, we observed that hydrocephalus occurred after IVH, leading to severe neurological dysfunction and decreased motor and memory functions.

GS is a network composed of perivascular spaces (PVS). PVS are narrow spaces located between blood vessels (mainly endothelial cells and smooth muscle cells) and the astrocyte end-feet surrounding the vessels. It consists of three parts: AQP4 at the astrocytes endfeet drives CSF to flow into the brain parenchyma through the perivascular spaces around arteries; CSF exchanges substances with ISF; metabolic waste (such as amyloid-beta (Aβ) and tau protein) is cleared via perivascular spaces around veins. Therefore, the function of the GS is closely related to PVS, astrocytes, and AQP4 on astrocyte endfeet. Studies have shown that CSF and ISF can be absorbed by arachnoid granulations into the blood system, and can also enter the lymphatic system through cranial nerve sheaths[32]. Additionally, meningeal lymphatic vessels can absorb CSF from the GS in the nearby subarachnoid space and transport it to the deep cervical lymph nodes(dCLN)[33]. The GS is not just a specific structure, but a summary summarizing fluid dynamics and transport functions in the brain. In this study, ultrastructural analysis showed disruption of PVS structure after IVH, with astrocyte endfeet disorganized, retracted, and partially separated from the vascular basement membrane. There was obvious fluid retention in subependymal area and around blood vessels, the ventricles were significantly enlarged, and the fluid distribution in the brain was significantly changed. Through CSF tracing, we observed a marked slowdown in CSF flow post-IVH, decreased amount of tracer entry into the brain parenchyma, and significantly prolonged time to reach the dCLN. Furthermore, the absorption rate of tracers injected into the brain parenchyma was also significantly reduced. Concurrently, there was substantial accumulation of p-Tau protein in the striatum and cortex. These findings confirm that the GS exhibits significant functional impairment following IVH, affecting CSF circulation and distribution, which is likely a key factor contributing to PHH.

To further explore the pathogenesis of PHH and identify potential therapeutic targets, we conducted bioinformatics analysis. The results indicated significant differential expression of genes related to the chemokine signaling pathway after IVH, confirming the crucial role of CCR2 in IVH. CCR2 is a G protein-coupled receptor that plays a key role in inflammatory responses and immune regulation, particularly in central nervous system diseases. Naert et al. suggested that CCR2 could induce neuroinflammation in Alzheimer's disease, leading to the phosphorylation and deposition of Aβ and tau proteins[34]. PVS, as a key structure of the GS, is also an essential component of the blood-brain barrier (BBB). Multiple studies have shown that under inflammatory conditions, activation of the CCR2 signaling pathway can disrupt BBB structure, increasing its permeability[35–37]. Therefore, we assume that knocking out CCR2 could restore the functional structure of the GS, reduce the deposition of toxic metabolites, and alleviate damage following IVH. In subsequent experiments, we found that pre-knockdown of CCR2 in mice significantly alleviated water retention and p-tau protein deposition, with astrocyte endfeet re-establishing close contact with the vascular wall. Additionally, CSF flow and ISF absorption were significantly restored compared to the IVH group, and the progression of hydrocephalus was also mitigated. This confirms our hypothesis that CCR2 mediates hydrocephalus through the GS.

AQP4 is abundant in the brain and is a crucial protein for maintaining the normal function of the GS. Its polarized distribution at the end-feet of astrocytes is key to facilitating the rapid flow and exchange of CSF. Kress et al. found that the polarized distribution of AQP4 changes in aged mice, affecting the flow of CSF in the brain parenchyma and the clearance of metabolic waste[38]. Huang et al. discovered that in the early stages of ischemic injury, AQP4 colocalizes with EEA1, indicating that the internalization of AQP4 following ischemia obstructs CSF flow and causes its accumulation in the brain parenchyma, leading to edema[39]. Fang et al. proposed that pituitary adenylate cycle-activating polypeptide can improve GS and alleviate SAH injury by restoring the polarity of AQP4[40]. We found internalization of AQP4 after IVH through in vivo and in vitro experiments, which is consistent with previous studies. Additionally, it was also confirmed that post-IVH, the expression of AQP4 at the astrocyte endfeet decreases, vascular coverage diminishes, and AQP4 is no longer highly concentrated near blood vessels but is more dispersed in the brain parenchyma. However, the knockout of CCR2 can reverse this condition.

The dystrophin-associated complex (DAC) can anchor AQP4 to the end-feet membrane by interacting with astrocyte cytoskeletal components and extracellular matrix proteins such as agrin, facilitating the close connection between end-feet and the vascular basement membrane[41]. Research has found that the N-terminus of β-DG, an important member of DAC, can be specifically cleaved by matrix metalloproteinase 9 (MMP-9)[15, 42–45]. In this study, we detected upregulation of MMP-9 and loss of β-DG in the perivascular region after IVH. Under inflammatory conditions, NF-κB is the main regulator of MMP-9 transcription and a critical participant in the pathophysiology of hydrocephalus[46, 47]. Activation of IκB kinase (IKK) releases NF-κB, which translocates to the nucleus to promote MMP-9 gene transcription[48]. The occurrence of neuroinflammation and GS dysfunction post-IVH leads to the release of inflammatory factors, the increase of harmful metabolites, and the accumulation of misfolded proteins, which can induce endoplasmic reticulum (ER) stress and activate the unfolded protein response (UPR)[49]. The UPR signaling cascade is primarily initiated by three protein sensors: IRE1α, PERK, and ATF6[50]. Under resting conditions, these sensors bind to the ER chaperone BiP (also known as GRP78) to remain inactive. Sustained or excessive ER stress can lead to cellular damage and even death[51]. The UPR can directly promote NF-κB activation through PERK–eIF2α-mediated translational attenuation[52], and IRE1α recruits IKK, phosphorylating IκB and causing its degradation, leading to NF-κB nuclear translocation[53]. Therefore, we hypothesized that CCR2 might activate ER stress and cause AQP4 depolarization after IVH. In subsequent experiments, we confirmed that ER stress and abnormal expression of NF-κB pathway-related proteins occurred after IVH, accompanied by a downregulation of AQP4. Knocking out CCR2 can alleviate endoplasmic reticulum stress, inhibit the NF-κB signaling pathway, and thus restore polarization of AQP4.

This study has certain limitations. Firstly, the study mainly focuses on the short-term effects of CCR2 inhibition on PHH, without a systematic evaluation of long-term effects. Secondly, knocking down CCR2 alone may not completely prevent the formation of hydrocephalus and neurological dysfunction after IVH. A multi-target combination therapy might be a more effective approach, which will be further explored in subsequent studies.

This study explored the mechanism by which knocking down the CCR2 receptor alleviates hydrocephalus after IVH. The results demonstrated that the CCR2 signaling pathway plays a critical role in the inflammation and ER stress induced by IVH. By knocking down CCR2, ER stress can be reduced, AQP4 polarization restored, GS function significantly improved, and CSF dynamics and harmful metabolite clearance enhanced, thereby alleviating the occurrence and progression of hydrocephalus and restoring neurological function. These findings not only reveal the crucial role of CCR2 in the pathogenesis after IVH but also provide new targets and strategies for the treatment of hydrocephalus, providing a new theoretical basis for developing CCR2-targeted therapies with significant clinical potential.

Aβ	Amyloid-beta
ALPS	Analysis along the perivascular space
AQP4	Aquaporin 4
BBB	Blood-brain barrier
β-DG	β-dystroglycan
CCR2	C-C chemokine receptor type 2
CSF	Cerebrospinal fluid
DAC	Dystrophin-associated complex
dCLN	Deep cervical lymph nodes
DEGs	Differentially expressed genes
DTI	Diffusion tensor imaging
EEA1	Early endosome antigen 1
ER	Endoplasmic reticulum
GMH	Gastric matrix hemorrhage
GS	Glymphatic system
ICH	Intracranial hemorrhage
IKK	IκB kinase
iNPH	Normal intracranial pressure hydrocephalus
IVH	Post-intraventricular hemorrhage
ISF	Interstitial fluid
MMP-9	Matrix metalloproteinase 9
PHH	Post-hemorrhagic hydrocephalus
PVS	Perivascular spaces
SAH	Subarachnoid hemorrhage
TBI	Traumatic brain injuries
UPR	Unfolded protein response

Acknowledgements

We extend our gratitude to all the researchers who assisted in data collection. Special thanks to Professors Liangxue Zhou and Aiping Tong for their professional advice and strong support for this study.

Author contributions

HD conducted the study design, optimized experiments, interpreted data, and wrote the manuscript. HW performed data collection and manuscript writing. KZ, BG and KH conducted statistical analysis and data interpretation. YL and ZD collected and organized data. LZ and AT contributed to the study design and data interpretation, and reviewed and revised the manuscript. All authors contributed to the article, and all read and approved the final manuscript.

Funding

This work was supported by the the Major Scientific and Technological Achievements Transformation Project of Ningxia Hui Autonomous Region (grant number 2022CJE09013)

Availability of data and materials

The data sets used and/or analyzed during the current study are available from the corresponding authors upon request.

Ethics approval and consent to participate

All experiments were conducted in accordance with internationally accepted principles for the care and use of laboratory animals. All experimental protocols and procedures have been approved by the Experimental Animal Ethics Committee of West China Hospital of Sichuan University (20230426002).

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interest.

Hochstetler A, Raskin J, Blazer-Yost BL. Hydrocephalus: historical analysis and considerations for treatment. Eur j med res. 2022;27(1):168.
Salman MM, Kitchen P, Halsey A, Wang MX, Törnroth-Horsefield S, Conner AC, Badaut J, Iliff JJ, Bill RM. Emerging roles for dynamic aquaporin-4 subcellular relocalization in CNS water homeostasis. Brain. 2022;145(1):64–75.
Shah VA, Thompson RE, Yenokyan G, Acosta JN, Avadhani R, Dlugash R, McBee N, Li Y, Hansen BM, Ullman N, et al. One-Year Outcome Trajectories and Factors Associated with Functional Recovery Among Survivors of Intracerebral and Intraventricular Hemorrhage With Initial Severe Disability. Jama neurol. 2022;79(9):856–68.
Berns J, Priddy B, Belal A, Seibold RD, Zieles K, Jea A. Standardization of cerebrospinal fluid shunt valves in pediatric hydrocephalus: an analysis of cost, operative time, length of stay, and shunt failure. J neurosurg-pediatr. 2021;27(4):400–5.
Lim J, Tang AR, Liles C, Hysong AA, Hale AT, Bonfield CM, Naftel RP, Wellons JC, Shannon CN. The cost of hydrocephalus: a cost-effectiveness model for evaluating surgical techniques. J neurosurg-pediatr. 2018;23(1):109–18.
Alperin N, Oliu CJ, Bagci AM, Lee SH, Kovanlikaya I, Adams D, Katzen H, Ivkovic M, Heier L, Relkin N. Low-dose acetazolamide reverses periventricular white matter hyperintensities in iNPH. Neurology. 2014;82(15):1347–51.
Hanley DF, Lane K, McBee N, Ziai W, Tuhrim S, Lees KR, Dawson J, Gandhi D, Ullman N, Mould WA, et al. Thrombolytic removal of intraventricular haemorrhage in treatment of severe stroke: results of the randomised, multicentre, multiregion, placebo-controlled CLEAR III trial. Lancet. 2017;389(10069):603–11.
Schoeman JF, Van Zyl LE, Laubscher JA, Donald PR. Effect of corticosteroids on intracranial pressure, computed tomographic findings, and clinical outcome in young children with tuberculous meningitis. Pediatrics. 1997;99(2):226–31.
Shurtleff DB, Hayden PW. The treatment of hydrocephalus with isosorbide, and oral hyperosmotic agent. J Clin Pharmacol New Drugs. 1972;12(2):108–14.
Georgiopoulos C, Tisell A, Holmgren RT, Eleftheriou A, Rydja J, Lundin F, Tobieson L. Noninvasive assessment of glymphatic dysfunction in idiopathic normal pressure hydrocephalus with diffusion tensor imaging. J neurosurg. 2024;140(3):612–20.
Ding Y, Zhang T, Wu G, McBride DW, Xu N, Klebe DW, Zhang Y, Li Q, Tang J, Zhang JH. Astrogliosis inhibition attenuates hydrocephalus by increasing cerebrospinal fluid reabsorption through the glymphatic system after germinal matrix hemorrhage. Exp neurol 2019, 320(null):113003.
Liu E, Peng X, Ma H, Zhang Y, Yang X, Zhang Y, Sun L, Yan J. The Involvement of Aquaporin-4 in the Interstitial Fluid Drainage Impairment Following Subarachnoid Hemorrhage. Front Aging Neurosci 2020, 12(null):611494.
Liu M, Huang J, Liu T, Yuan J, Lv C, Sha Z, Wu C, Jiang W, Liu X, Nie M, et al. Exogenous interleukin 33 enhances the brain's lymphatic drainage and toxic protein clearance in acute traumatic brain injury mice. Acta Neuropathol Commun. 2023;11(1):61.
Xiong A, Xiong R, Yu J, Liu Y, Liu K, Jin G, Xu J, Yan J. Aquaporin-4 is a potential drug target for traumatic brain injury via aggravating the severity of brain edema. Burns trauma. 2021;9(null):tkaa050.
Michaluk P, Kolodziej L, Mioduszewska B, Wilczynski GM, Dzwonek J, Jaworski J, Gorecki DC, Ottersen OP, Kaczmarek L. Beta-dystroglycan as a target for MMP-9, in response to enhanced neuronal activity. J biol chem. 2007;282(22):16036–41.
Karimy JK, Reeves BC, Damisah E, Duy PQ, Antwi P, David W, Wang K, Schiff SJ, Limbrick DD, Alper SL, et al. Inflammation in acquired hydrocephalus: pathogenic mechanisms and therapeutic targets. Nat rev neurol. 2020;16(5):285–96.
Ye Q, Jo J, Wang CY, Oh H, Zhan J, Choy TJ, Kim KI, D'Alessandro A, Reshetnyak YK, Jung SY, et al. Astrocytic Slc4a4 regulates blood-brain barrier integrity in healthy and stroke brains via a CCL2-CCR2 pathway and NO dysregulation. Cell Rep. 2024;43(5):114193.
Tian Q, Guo Y, Feng S, Liu C, He P, Wang J, Han W, Yang C, Zhang Z, Li M. Inhibition of CCR2 attenuates neuroinflammation and neuronal apoptosis after subarachnoid hemorrhage through the PI3K/Akt pathway. J Neuroinflammation. 2022;19(1):312.
Zhang K, Wang H, Xu M, Frank JA, Luo J. Role of MCP-1 and CCR2 in ethanol-induced neuroinflammation and neurodegeneration in the developing brain. J Neuroinflammation. 2018;15(1):197.
Okuma T, Terasaki Y, Kaikita K, Kobayashi H, Kuziel WA, Kawasuji M, Takeya M. C-C chemokine receptor 2 (CCR2) deficiency improves bleomycin-induced pulmonary fibrosis by attenuation of both macrophage infiltration and production of macrophage-derived matrix metalloproteinases. J pathol. 2004;204(5):594–604.
Yang J, Lv X, Chen J, Xie C, Xia W, Jiang C, Zeng T, Ye Y, Ke L, Yu Y, et al. CCL2-CCR2 axis promotes metastasis of nasopharyngeal carcinoma by activating ERK1/2-MMP2/9 pathway. Oncotarget. 2016;7(13):15632–47.
Wang HX, Liu C, Li YY, Cao Y, Zhao L, Zhao YJ, Deng ZA, Tong AP, Zhou LX. TUG-891 inhibits neuronal endoplasmic reticulum stress and pyroptosis activation and protects neurons in a mouse model of intraventricular hemorrhage. Neural regen res. 2023;18(10):2278–84.
Zhu W, Gao Y, Wan J, Lan X, Han X, Zhu S, Zang W, Chen X, Ziai W, Hanley DF, et al. Changes in motor function, cognition, and emotion-related behavior after right hemispheric intracerebral hemorrhage in various brain regions of mouse. Brain behav immun. 2018;69(null):568–81.
Harrison IF, Ismail O, Machhada A, Colgan N, Ohene Y, Nahavandi P, Ahmed Z, Fisher A, Meftah S, Murray TK, et al. Impaired glymphatic function and clearance of tau in an Alzheimer's disease model. Brain. 2020;143(8):2576–93.
Gluski J, Garling RJ, Kappel A, Fathima B, Johnson R, Harris CA. Factors Impacting Hydrocephalus Incidence in Intracerebral Hemorrhage: A Retrospective Analysis. World neurosurg. 2021;148(null):e381–9.
Trifan G, Arshi B, Testai FD. Intraventricular Hemorrhage Severity as a Predictor of Outcome in Intracerebral Hemorrhage. Front Neurol. 2019;10(null):217.
Steiner T, Diringer MN, Schneider D, Mayer SA, Begtrup K, Broderick J, Skolnick BE, Davis SM. Dynamics of intraventricular hemorrhage in patients with spontaneous intracerebral hemorrhage: risk factors, clinical impact, and effect of hemostatic therapy with recombinant activated factor VII. Neurosurgery. 2006;59(4):767–73. discussion 773 – 764.
Simard PF, Tosun C, Melnichenko L, Ivanova S, Gerzanich V, Simard JM. Inflammation of the choroid plexus and ependymal layer of the ventricle following intraventricular hemorrhage. Transl stroke res. 2011;2(2):227–31.
Du Y, Wang J, Zhang J, Li N, Li G, Liu X, Lin Y, Wang D, Kang K, Bian L, et al. Intracerebral hemorrhage-induced brain injury in mice: The role of peroxiredoxin 2-Toll-like receptor 4 inflammatory axis. Cns neurosci ther. 2024;30(3):e14681.
Li XJ, Pang C, Peng Z, Zhuang Z, Lu Y, Li W, Zhang HS, Zhang XS, Hang CH. Dihydromyricetin confers cerebroprotection against subarachnoid hemorrhage via the Nrf2-dependent Prx2 signaling cascade. Phytomedicine 2023, 119(null):154997.
Wan Y, Fu X, Zhang T, Hua Y, Keep RF, Xi G. Choroid plexus immune cell response in murine hydrocephalus induced by intraventricular hemorrhage. Fluids Barriers CNS. 2024;21(1):37.
Lundgaard I, Lu ML, Yang E, Peng W, Mestre H, Hitomi E, Deane R, Nedergaard M. Glymphatic clearance controls state-dependent changes in brain lactate concentration. J cerebr blood f met. 2017;37(6):2112–24.
Aspelund A, Antila S, Proulx ST, Karlsen TV, Karaman S, Detmar M, Wiig H, Alitalo K. A dural lymphatic vascular system that drains brain interstitial fluid and macromolecules. J exp med. 2015;212(7):991–9.
Naert G, Rivest S. A deficiency in CCR2 + monocytes: the hidden side of Alzheimer's disease. J mol cell biol. 2013;5(5):284–93.
Alemán-Ruiz C, Wang W, Dingledine R, Varvel NH. Pharmacological inhibition of the inflammatory receptor CCR2 relieves the early deleterious consequences of status epilepticus. Sci Rep. 2023;13(1):5651.
Huang Y, Wang J, Cai J, Qiu Y, Zheng H, Lai X, Sui X, Wang Y, Lu Q, Zhang Y, et al. Targeted homing of CCR2-overexpressing mesenchymal stromal cells to ischemic brain enhances post-stroke recovery partially through PRDX4-mediated blood-brain barrier preservation. Theranostics. 2018;8(21):5929–44.
Stamatovic SM, Shakui P, Keep RF, Moore BB, Kunkel SL, Van Rooijen N, Andjelkovic AV. Monocyte chemoattractant protein-1 regulation of blood-brain barrier permeability. J cerebr blood f met. 2005;25(5):593–606.
Kress BT, Iliff JJ, Xia M, Wang M, Wei HS, Zeppenfeld D, Xie L, Kang H, Xu Q, Liew JA, et al. Impairment of paravascular clearance pathways in the aging brain. Ann neurol. 2014;76(6):845–61.
Huang J, Sun SQ, Lu WT, Xu J, Gan SW, Chen Z, Qiu GP, Huang SQ, Zhuo F, Liu Q, et al. The internalization and lysosomal degradation of brain AQP4 after ischemic injury. Brain res. 2013;1539(null):61–72.
Fang Y, Shi H, Ren R, Huang L, Okada T, Lenahan C, Gamdzyk M, Travis ZD, Lu Q, Tang L, et al. Pituitary Adenylate Cyclase-Activating Polypeptide Attenuates Brain Edema by Protecting Blood-Brain Barrier and Glymphatic System After Subarachnoid Hemorrhage in Rats. Neurotherapeutics. 2020;17(4):1954–72.
Simon MJ, Murchison C, Iliff JJ. A transcriptome-based assessment of the astrocytic dystrophin-associated complex in the developing human brain. J neurosci res. 2018;96(2):180–93.
Dou Y, Tan Y, Yu T, Ma X, Zhou Y, Zhao Y, Zhao Y, Liu X. MiR-132 down-regulates high glucose-induced β-dystroglycan degradation through Matrix Metalloproteinases-9 up-regulation in primary neurons. J cell mol med. 2021;25(16):7783–95.
Si X, Dai S, Fang Y, Tang J, Wang Z, Li Y, Song Z, Chen Y, Liu Y, Zhao G, et al. Matrix metalloproteinase-9 inhibition prevents aquaporin-4 depolarization-mediated glymphatic dysfunction in Parkinson's disease. J adv res. 2024;56(null):125–36.
Yuan Y, Peng W, Lei J, Zhao Y, Zhao B, Li Y, Wang J, Qu Q. AQP4 Endocytosis-Lysosome Degradation Mediated by MMP-9/β-DG Involved in Diabetes Cognitive Impairment. Mol neurobiol 2024, null(null):null.
Zhu B, Cao A, Chen C, Zhou W, Luo W, Gui Y, Wang Q, Xu Z, Wang J. MMP-9 inhibition alleviates postoperative cognitive dysfunction by improving glymphatic function via regulating AQP4 polarity. Int immunopharmacol 2024, 126(null):111215.
Cao Y, Liu C, Li G, Gao W, Tang H, Fan S, Tang X, Zhao L, Wang H, Peng A, et al. Metformin Alleviates Delayed Hydrocephalus after Intraventricular Hemorrhage by Inhibiting Inflammation and Fibrosis. Transl stroke res. 2023;14(3):364–82.
Lin T, Ding L, Lin Y, Liu C, Wang C, Wu D, Li Z, Li M, Sun J. Pharmacological inhibition of TLR4-NF-κB signaling by TAK-242 attenuates hydrocephalus after intraventricular hemorrhage. Int immunopharmacol 2022, 103(null):108486.
Chen D, Xiao T, Lin D, Zhu H, Xu J, Luo X, Ren J, Zheng Z, Chen Z, Hu J, et al. DNA Methylation-Mediated Silencing of Mir-204 Enhances the Occurrence of T-Cell Acute Lymphoblastic Leukemia By Upregulating MMP-2 and MMP-9 through the NF-Κb Signaling Pathway. Blood. 2020;136(Supple 1):11–11.
Sprenkle NT, Sims SG, Sánchez CL, Meares GP. Endoplasmic reticulum stress and inflammation in the central nervous system. Mol Neurodegener. 2017;12(1):42.
Ron D, Walter P. Signal integration in the endoplasmic reticulum unfolded protein response. Nat rev mol cell bio. 2007;8(7):519–29.
Zhang K, Kaufman RJ. From endoplasmic-reticulum stress to the inflammatory response. Nature. 2008;454(7203):455–62.
Deng J, Lu PD, Zhang Y, Scheuner D, Kaufman RJ, Sonenberg N, Harding HP, Ron D. Translational repression mediates activation of nuclear factor kappa B by phosphorylated translation initiation factor 2. Mol cell biol. 2004;24(23):10161–8.
Hu P, Han Z, Couvillon AD, Kaufman RJ, Exton JH. Autocrine tumor necrosis factor alpha links endoplasmic reticulum stress to the membrane death receptor pathway through IRE1alpha-mediated NF-kappaB activation and down-regulation of TRAF2 expression. Mol cell biol. 2006;26(8):3071–84.

No competing interests reported.

WB.pdf

Download PDF

Reviewers invited by journal
16 Sep, 2024
Editor assigned by journal
31 Jul, 2024
Submission checks completed at journal
31 Jul, 2024
First submitted to journal
29 Jul, 2024

You are reading this latest preprint version

CCR2 receptor inhibition alleviated post-intraventricular hemorrhage hydrocephalus through the glymphatic pathway

Status:

Version 1

Abstract

Background

Methods

Results

Conclusion

Figures

Introduction

Materials and Methods

Experimental Animals and Grouping

Animal Model of IVH

Neurologic Deficit Scoring

Morris Water Maze (MWM)

Open Field Test

Hematoxylin and Eosin Staining

Immunofluorescence and Immunohistochemistry Analysis

Transmission and Scanning Electron Microscopy

7.0T Magnetic Resonance Imaging (MRI)

Western Blot (WB) Analysis

RNA-seq and bioinformatics analysis of tissue samples

Cell Culture and Cell Viability Assay

CCR2 knockdown

CSF Tracing

Statistical Analysis

Results

1. GS Involvement in the Development of Hydrocephalus Post-IVH

2. Transcriptomic data bioinformatics analysis

3. Knocking down CCR2 reduces fluid retention and alleviates hydrocephalus after IVH

4. Knocking down CCR2 improves GS dysfunction post-IVH

5. Knocking down CCR2 can improve the depolarization state of AQP4 after IVH

6. Knocking down CCR2 can effectively alleviate motor and cognitive dysfunction after IVH in mice

Discussion

Conclusion

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1