Diethyl ether extract of Senna siamea Lam. (Fabaceae) exhibits antiplasmodial polypharmacology activity via inhibition of DOXP reductoisomerase, reverse overexpression of pbEMPI, hepatolipodystrophy, and hepatic portal inflammatory genes

doi:10.21203/rs.3.rs-4824778/v1

Download PDF

Research Article

Diethyl ether extract of Senna siamea Lam. (Fabaceae) exhibits antiplasmodial polypharmacology activity via inhibition of DOXP reductoisomerase, reverse overexpression of pbEMPI, hepatolipodystrophy, and hepatic portal inflammatory genes

https://doi.org/10.21203/rs.3.rs-4824778/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Senna siamea/Cassia siamea (SS) has been used by the locals for the management of malaria over the years. The aim of the research is to experimentally justify the usage of different extracts of Senna siamea in the treatment of malaria using both in vitro and in vivo models and unveiling the probable mechanism of action. Aqueous extract of SS (AQ) was observed to possess a weak antiplasmodial activity due to 10.20 ± 2.52% and 1.44 ± 0.52% suppression and curation, respectively. Upon subjection to confirmatory bioassay, diethyl ether (DeE) extract showed IC50 of 0.0650 ± 0.01, which is significantly different from 0.8838 ± 0.01 observed in the chloroquine treated group (CqN). About100 mg/kg of DeE also significantly suppresses the expression of the Pb-EMPI gene of Plasmodium berghei (post-treatment), relative to the untreated group (UNT), CqN methanol-treated group (MeE). Also, 100 mg/kg of DeE also showed reversed hepatic lipodystrophy by down-regulating FAS, HMG CoA reductase, and Acetyl CoA carboxylase genes relative to overexpressions observed in UnT, CqN, and MeE treated groups. Inhibition of overexpression of 1L-1b, TNF-G, and 1L-10 hepatic portal tract inflammation genes was noted in 100 mg/kg of DeE when compared with UnT,CqN, and MeE extract of SS. GC-MS of bioactive DeE showed that squalene was the main constituent. Bioactive constituents are suggested to be non-polar in nature and they also exhibit antiplasomodial polypharmacology potential, while squalene was also suggested to be abundant in the non-polar extract.

Antiplasmodial

DOXP reductoisomerase.

Plasmodium berghei

Senna siamea

Squalene

Major efforts to reduce malaria incidence have been carried out in the last decade in the world, the diseases remain one of the leading causes of death in developing nations of the world, most especially in Africa (Al-Awadhi, Ahmad, and Iqbal 2021). In 2020, there were an estimated 241 million cases of malaria worldwide, the estimated number of malaria deaths stood at 627 000 in 2020. In 2020, Africa was home to 95% of malaria cases and 96% of malaria deaths, with children under 5 years of age accounting for about 80% of all malaria deaths in the region (Cotter et al. 2013). However, several drugs have been tested as curative in the management of the disease but Artemisinin and its derivatives (ARTs) are the recommended first-line drugs (Conway 2007; Hatz 2001). Within the last decade, the usefulness of ARTs and their combinatorial forms is threatened by rising cases of resistance by P. falciparum strains, which can be linked to reduced susceptibility of ring-stage parasites to ART exposure in patients that abuse ART (Al-Adhroey et al. 2011; Conway 2007).

However, high mortality and morbidity associated with malaria have necessitated the development of novel therapy to overcome resistance and numerous limitations associated with current antimalarial therapy (Ikem et al. 2020). Plasmodium falciparum synthesizes isoprenoids via the non-mevalonate or 2-C-methyl-erythritol-4-phosphate (MEP) pathway, while humans obtain these essential molecules via the orthogonal mevalonate pathway, it is interesting to state that, blocking the MEP pathway (1-Deoxy-d-xylulose-5-phosphate reductoisomerase, catalyzes the first committed/rate-limiting step in the MEP pathway) became a key point in the development of novel drugs for management of malaria (Qidwai et al. 2014; Guggisberg, Amthor, and Odom 2014).

The challenges stated above have necessitated the search for novel natural antimalarial principles and or medicinal plants with ethnomedicinal usage in malaria treatment. Although the list of plants used in making antimalarial decoctions in Africa is long, one of the most potent is perhaps Senna siamea (Deguchi et al. 2012; Kumar et al. 2013; Wongchum and Dechakhamphu 2021). Although, several chromone-based alkaloidal compounds including cassiadinine have been isolated from S. siamea; chrobisiamone, cassiarin A and B have exhibited the most potent antimalariall activities (Ajaiyeoba et al. 2008; Bachtiar and Ahmad 2019). It should be however noted that toxicities of several alkaloidal fractions in experimental animals have also been reported (Wang et al. 2019; Wongchum and Dechakhamphu 2021).

This study was designed to evaluate the antimalarial effect of different extracts of S. siamea using both in vitro and in vivo assay models, to subject the promising extract(s) to further confirmatory bioassays using gene marker experiments, characterization of the most promising extract and molecular docking of the suspected bioactive principle.

Plant collection and authentication

Senna siamea was collected from the wild in Benin City, Edo State, Nigeria. The identity of the plant was confirmed by Dr. Thimothy Odaro of herbarium unit in the Department of Plant Biology and Biotechnology, and the voucher specimen was deposited at the herbarium section of the University of Benin, Nigeria, with herbarium number UBH-R613. The plant sample was air dried in the laboratory for two weeks at room temperature. Grinding to powder form was carried out using a laboratory electric mill. The powdered sample was kept in an airtight container until required.

Experimental Animals, Test Parasite, and Standard Drug

Both sexes of Swiss albino mice aged 7–8 weeks and weighing 23–35 g were obtained from National Institute of Medical Research, Nigeria. Mice were kept for acclimatization for one week prior to the experiment and they were exposed to 12 hours of light and 12 hours of dark. They were given water and standard pellet diet. Chloroquine sensitive strain of Plasmodium berghei (ANKA strain) was obtained from the National Institute of Medical Research, Nigeria. On weekly basis, the parasite was kept by serial passage of blood from infected to non-infected mice. At the end of each experiment, the mice were euthanized with halothane. Chloroquine phosphate was obtained from Addis Pharmaceutical Factory (APF), Adigrat, Tigray, Ethiopia (Alson et al. 2018; Ikem et al. 2020).

Plant extraction

Sequential maceration of 0.5 kg of the powdered sample of S. siamea (SS) was carried out using diethyl ether, ethyl acetate, methanol and water for 72 hours at room temperature for each solvent, followed by concentration using a rotary evaporator under vacuum and the extracts obtained were weighed and kept in the refrigerator 4^oC (Oluwasegun Adedokun et al. 2021)(Adedokun, Gbolade, and Ayinde 2021; Oluwasegun, Nasiru, and John 2015)

Acute Oral Toxicity Test

Oral toxicity studies were performed as per the Organization for Economic Co-operation and Development (OECD) guideline, where the limit test dose of 2 g/kg body weight was used. Five non-infected female Swiss albino mice aged 8–12 weeks and weighing 23–30 g were used for each extract (diethyl ether, ethyl acetate, methanol and aqueous extracts), implying that twenty animals were used in all. The mice were fasted for three hours before dosing and one hour after dosing, but they were not deprived of water. For each extract, a single mouse was dosed first, and subsequently, four mice were dosed after the survival of the first mouse. Each mouse received an oral single dose of 2 g/kg body weight and the mice were observed continuously for the first 30 minutes for any signs of toxicity, followed by observations every four hours for the first 24 hours and once a day for the next 13 days. Gross physical and behavioral changes like hair erection, loss of appetite, diarrhea, sleep, and coma were observed (Oloya et al. 2022; Kusumawati et al. 2021).

Biological studies

Suppressive antimalarial screening

The antimalarial activity of the extracts was determined using Peter’s 4-day suppressive test. The experimental animals were inoculated intravenously with 1 × 10⁶ red blood cells infected with the CQ-resistant P. berghei ANKA strain. The day of inoculation was defined as day zero (D0). The infected animals were distributed randomly into fourteen groups of five animals per cage and were treated once daily with diethyl ether (DeE), ethyl acetate (EaE), methanol (MeE), and aqueous (AQ) extracts by oral route. The animals in groups I -III, IV-VI, VII-IX, and X – XII received 200, 400, and 800 mg/kg doses each of DeE, EaE, MeE, and AQ extracts of SS, respectively. Group XIII and XIV were also treated with 10 mg/kg chloroquine (positive control) and 5% dimethylsulphoxide (negative control), respectively. The survival rate of animals was monitored till day 14. On day 4 of the experiment, the animals’ tail tip was cut to prepare the blood smears. The air-dried films were fixed with methanol and stained with Giemsa solution. Parasitemia was determined by counting the number of parasitized erythrocytes among at least 1000 RBCs (Kweyamba et al. 2019).

However, the difference between the mean values of the control group (defined as 100%) and those of the experimental groups was calculated and expressed as the percent suppression of parasite growth (Kweyamba et al. 2019).

Suppression of parasite = 100 − a/b * 100

a - Mean parasitemia of treated animal

b- Mean parasitemia of control×100

Curative antimalarial screening

The chemotherapeutic activity of the four extracts was carried out after infection has been established. On the first day (Day 0), 0.2 mL standard inocula of 1 × 10⁷ P. berghei infected erythrocytes were inoculated in mice intraperitoneally. Seventy-two hours later (Day 3), the infected animals were distributed randomly into fourteen groups of five animals per cage and were treated once daily with diethyl ether, ethyl acetate, methanol, and aqueous extracts by oral route. The animals in groups I -III, IV-VI, VII-IX, and X – XII received 200, 400, and 800 mg/kg doses each of DeE, EaE, MeE, and AQ extracts of SS, respectively. Group XIII and XIV were treated with 10 mg/kg chloroquine (positive control) and 5% dimethylsulphoxide (negative control). Giemsa-stained thin blood film was prepared from the tail of each mouse on days 3 and 7 to monitor the parasitemia level (Alson et al. 2018).

Prophylactic antimalarial screening

The prophylactic activity of the extracts was tested using the residual infection procedure. The animals were distributed randomly into fourteen groups of five animals per cage and were treated once daily for three consecutive days (days 0–2) with diethyl ether, ethyl acetate, methanol and aqueous extracts by oral route. The animals in groups I -III, IV-VI, VII-IX, and X – XII received 200, 400, and 800 mg/kg doses each of DeE, EaE, MeE, and AQ extracts of SS, respectively. Group XIII and XIV were treated with 10 mg/kg chloroquine (positive control) and 5% dimethylsulphoxide (negative control). On the fourth day (Day 3), all mice were infected with 0.2 mL standard inocula of 1 × 10⁷ P. berghei infected erythrocytes intraperitoneally and 72 h later, thin blood films were prepared to determine the level of parasitemia (Alson et al. 2018).

Confirmatory antimalarial bioassays on S. siamea extracts

The molecular approach to antimalarial screening was carried out on the most active extract(s) namely: diethyl ether, ethyl acetate, and methanol using the model below;

In vitro antiplasmodial assay

Seven duplicate dilutions (0.1–100 mg/L) each of chloroquine (water vehicle, Sigma Aldrich), diethyl ether, ethyl acetate, and methanol extracts of SS were evaluated for in vitro anti-plasmodial inhibitory kinetics as described b with some modifications. Uninfected and infected freshly prepared red blood cells containing early trophozoites were diluted in complete RPMI medium to a final parasitemia of 0.5% and 1% of hematocrit and added at 200 µL (per well) into 25 µL drug (plant extract) or water (control) in flat bottom 96-well plates. The plates were incubated at 37⁰C under the following conditions (5% CO2, 5% O2, and 90% N₂) for 12 hr. 100 µL aliquot from each plate was retrieved for total RNA isolation (Trizol) and semi-quantitative RT-PCR of 18s rRNA copy using the primers:18S rRNA (F)-5-‘ AAGCATTAAATAAAGCGAATACATCCTTAC-3’/(R)-5’ GGAGATTGGTTTTGACGTTTATGTG3’. The IC₅₀ value for each agent tested was determined following a drug-response plot generated in GraphPad Prism (ver. 7). Data were expressed as mean ± standard deviation (SD) of three independent determinations (Peter et al. 2020; Fang et al. 2019).

In vivo anti-Plasmodium berghei experiments

Plasmodium berghei NK65 strain (PbNK65) obtained Institute for Medical Research and Training (IMRAT), University of Ibadan, Nigeria was used for the induction of malaria in experimental mice. Prior to infection, the parasites were maintained by serial passage of blood from the donor-infected mice to naïve mice via intraperitoneal (IP) injection every 5 days.

For experiments, 25 naïve mice (male, 6 weeks old) were divided into two groups of 20 and 5 mice respectively. The 20 naïve mice were intraperitoneally injected with 200 mL blood (1x10⁷ parasitized erythrocytes) donor-infected mice (parasitemia level, 30%) previously diluted with 0.9% normal saline solution. Parasitemia levels were monitored daily from a blood sample obtained from tail vain by microscopic examination of Giemsa-stained thin blood smears and P. berghei erythrocyte membrane protein 1 (pbEMP1) copy number evaluation using semi-quantitative RT-PCR method. On day 10 post-infection, the 20 mice were grouped into four (4) of five mice each (Diethyl ether (DeE), Chloroquine (CqN), Methanol extract (MeE), and Untreated (UnT)). Except for the UnT group, and CqN (30 mg/kg) all other groups were treated with 100 mg/kg body weight once daily for five days (ethyl acetate extract was excluded due to weak activity observed in confirmatory in vitro antiplasmodial bioassay carried out). Giemsa-stained thin blood smears were used to monitor drug response daily but blood samples were taken on day 5 post treatment for pbEMP1 copy number evaluation (Al-Adhroey et al. 2011; Ikem et al. 2020; Alson et al. 2018).

Hepato-lipodystrophy studies in Plasmodium berghei-infected mice

Following 5 days of treatment in infected mice, animals were sacrificed under light anesthesia and the liver tissues were removed for total RNA isolation using Trizol reagent following the manufacturer’s protocol. DNA contamination was removed following treatment with DNAse I treatment (NEB, Cat: M0303S) as specified by the manufacturer. RNA-to-cDNA conversion was done using 2 µL (100 ng) DNA-free RNA sample in a 20 µL total reaction volume containing M-MuLV Reverse transcriptase (NEB, Cat: M0253S, 2 µL), N⁹ random primers (2 µL), 10X M-MuLV buffer (2 µL), M-MuLV RT (200 U/µL, 2 µL), 10 mM dNTP (0.2 µL), RNase Inhibitor (40 U/µL, 1 µL) and 8.8 µL nuclease-free water). The reaction proceeded at 42⁰C for 1hr and while M-MuLV Reverse transcriptase inactivation was performed at 65°C/8 min. Inflammatory mediators (1L-1b, TNF-a, and IL-10), lipogenic (Fatty acid synthase (FAS), HMG-CoA reductase and Acetyl-CoA carboxylase) and hepatic necrosis (calpain − 2, and serpin-6) genes were evaluated using semi-quantitative RT-PCR methods (Ikem et al. 2020) .

GC-MS Characterization of bioactive diethyl ether extract of S. siamea

Identification of secondary metabolites from most active extract (DeE) was performed using Gas chromatography-mass spectroscopy (GC-MS) Perkin-Elmer Clarus 680 system (Perkin-Elmer, Inc. U.S.A) equipped with a fused silica column, packed with Elite-5MS) capillary column (30 m in length × 250 µm in diameter × 0.25 µm in thickness). Pure helium gas (99.99%) was used as the carrier gas at a constant flow rate of 1 mL/min. For GC–MS spectral detection, an electron ionization energy method was adopted with high ionization energy of 70 eV (electron Volts) with 0.2 s of scan time and fragments ranging from 40 to 600 m/z. The injection quantity of 1 µL was used (split ratio 10:1), and the injector temperature was maintained at 250°C (constant). The column oven temperature was set at 50°C for 3 min, raised at 10°C per min up to 280°C, and the final temperature was increased to 300°C for 10 min. The contents of phytochemicals present in the DeE were identified based on a comparison of their retention time (min), peak area, peak height, and mass spectral patterns with that spectral database of compounds stored in the National Institute of Standards and Technology (NIST) library (Omolaso et al. 2021; Peter et al. 2020)

Molecular docking of squalene

Preparation of protein crystal via protein preparation wizard.

The X-ray crystallographic structures of DOXP and MEP were retrieved from the protein databank (PDB) (https://www.rcsb.org) with accession ID 5JO0 and 2XWL, respectively. The protein preparation wizard of the Glide software (Schrodinger Suite 2018–1) was used to rectify specific errors such as missing hydrogen atoms in the protein during X-ray crystallography. The bond orders were assigned and possible missing hydrogen atoms in the PBD structure were added. Also, disulfide bonds were created between two sulfur atoms in proximity, and other options were left as default. Full energetic optimization was performed in the find refinement step using the OPLS3 force field and the RMSD of heavy atoms was set at 0.3A (Mvondo et al. 2021; Parquet et al. 2010).

Preparation of ligands

The two compounds (squalene) were uploaded to the workspace of the Maestro molecular interface (version 11v5) of Schrodinger Suite. Low energy 3D conformers with satisfactory bond lengths and angles for each two-dimensional structure were generated. The possible ionization states for each ligand structure were generated at a physiological pH of 7.2 ± 0.2. All other options were kept as default and the ligands were minimized using an optimized potential liquid simulation (OPLS3) force field (Simon et al. 2017).

Docking Studies

The glide grid file was generated via the reporter grid generation panel by picking to co-crystallized ligand located at the active site of the protein to automatically reveal x,y, and z coordinates (-31.2, 21.89, and 30.09), respectively. Glide uses the position and size of the ligand to calculate a default center and a default size for the region for which grids will be calculated (Thovarai 2009).

The virtual screening of the two compounds was carried out using three hierarchical Glide Docking Filtering, namely: High Throughput Virtual Screening (HTVS), Standard Precision (SP), and Extra Precision (XP). HTVS docking is intended for the rapid screening of vast numbers of ligands. HTVS has much more restricted conformational sampling than SP docking, Standard-Precision (SP) docking is appropriate for screening ligands of unknown quality in large numbers. Extra-precision (XP) docking and scoring is a more robust and discriminating procedure, which takes longer to run than SP. XP is designed to be used on ligand poses that have been determined to be high-scoring using SP docking. The database was run through SP docking. First, the top 30% of the final poses were further docked using XP, to score the compound’s binding affinity via a more expensive docking simulation on worthwhile poses. To accurately predict the binding affinity of the novel inhibitors with the protein crystal, Induced-Fit Docking (IFD) was implemented. IFD protocol aims to improve the docking of ligands in which it is believed that the receptor adjusts significantly to the presence of the ligand. The protocol performs a constrained minimization of the receptor followed by initial glide docking of the ligands using a softened potential. A selected set of docked poses is passed on to prime for a refinement step. After a prime side chain prediction and minimization, the best receptor structures for each ligand are passed back to glide for re-docking of the ligand (Ye et al. 2021; Bhowmik et al. 2021).

Statistical analysis

Results were expressed as mean ± SEM (standard error of the mean) and analyzed using Graph Pad Prism software version 6. Comparisons were performed by a one-way analysis of variance (ANOVA) followed by the means multiple comparison method of Bonferroni–Dunnett. Differences were considered significant if p < 0.05.

Percentage yield of extraction

About 0.5 kg of S. siamea was extracted sequentially with diethyl ether, ethyl acetate, methanol and water using maceration, the result of extraction yield is shown in Table 1 below. Although a low extraction yield was observed using maceration, improved yield, with limited extraction period and menstruum would have been achieved if hot or cold continuous extraction was used. The choice of maceration was based on the ethnomedicinal history of usage of the plant in management of malaria fever among locals.

Table 1

Sequential percentage extraction yield of *S. siamea*
Sample (S. siamea)	Weight of plant powder (g)	Weight of extract (g)	% Yield
Diethyl ether (DeE)	500.00	25.21	5.04
Ethyl acetate (EtA)	470.00	17.59	3.74
Methanol (MeE)	451.49	15.51	3.44
Water (Aq)	430.79	18.70	4.34

Result of acute toxicity study

Results from the acute toxicological studies revealed that all extracts of SS exhibited LD₅₀ > 2 g/kg when administered orally and no toxic symptoms or adverse behavioral changes were observed as zero mortality was recorded after 24 hours and 1 week after the single oral administration of all the extracts at all doses, the result also confirm previous toxicological report stated by (Tasiam, Primaharinastiti, and Ekasari 2020).

Result of preliminary antimalarial studies

Effect of SS extracts on P. berghei suppression

Comparative evaluation of the parasite average suppression index was shown in Fig. 1A – F. Result from Fig. 1A showed that DeE extract possess the highest suppressive index in a dose dependent manner with the lowest and highest at 200 and 800 mg/kg with average suppressive index of 0.19 ± 0.05 and 0.10 ± 0.03, respectively relative to 1.23 ± 0.31 observed with negative control at p < 0.05. The pattern of parasite suppression is in the following order: DeE < EaE < MeE < AQ. However, no significant difference was observed in the parasite suppression of aqueous extract with that of negative control at p < 0.05 as shown in Fig. 1A. In addition, Fig. 1B – E showed the average parasite index of each extract, which can also support Fig. 1A and F in terms of promising and weak parasite suppression prose of DeE and AQ extract, respectively

Curative effect of SS extracts on P. berghei infection

Comparative curative effect of SS extracts on P. berghei infection is shown in Fig. 2A – E. Also, DeE extract likewise showed a promising curative effect after six days of administration as shown in Fig. 2B, with the lowest parasite density observed at the highest dose of 800 mg/kg across the days examined. Percentage curative of all the extracts at the highest dose (800 mg/kg) showed that DeE exhibited percentage parasite curation of 83.97 ± 5.12%, which is 61.63 and 41.37% higher than 32.22 ± 7.95% and 49.23 ± 3.28% observed in EeE and MeE extracts, respectively at p < 0.05. AQ extract showed relatively no percentage parasite curative potential (1.44 ± 0.51%) as indicated in Fig. 2F.

Prophylactic effect of SS extracts on P. berghei infection

Results from Fig. 3 showed the comparative prophylactic effect of SS extracts using average prophylaxis index. All the extracts showed a weak prophylactic effect across the doses examined, with no significant different from values observed with negative control as shown in Fig. 3.

From the preliminary antimalarial studies, DeE extract of SS showed to be the most active in term of curative and suppressive models, which implies that the antimalarial principle(s) might be a highly non-polar compound. Based on this, all extracts were subjected to confirmatory antimalarial screening in the absence of AQ extract (characterized with no antimalarial activity).

Diethyl ether fraction of S. siamea exhibit potent in vitro anti-plasmodial activity

With the increasing spate of artemisinin resistance in malaria patients, there is a need to research novel antiplasmodial agents for the treatment of malaria. The success of artemisinin as an isolate of Artemisia annua has in no doubt paved the way for the investigation of other bioresources. One such plant with good promise is S. siamea. Here, solvents with increasing polarity have been used to isolate compounds from S. siamea and tested in vitro for anti-plasmodial activities in comparison with chloroquine. In order of increasing potency, DeE (IC₅₀ = 0.06 mg/L) > CqN (IC₅₀ = 0.09 mg/L) > MeE (IC₅₀ = 0.52 mg/L) > EaE (IC₅₀ = 1.90 mg/L) (Fig. 4 and Table 2). Surprisingly, the DeE fraction is marginally more potent than chloroquine but 8-fold more potent than MeE and 30-fold more potent than EaE.

Table 2

IC₅₀ value of *in vitro* antimalarial bioassay of three most promising SS extracts
	CqN	EaE	DeE	MeE
IC₅₀	0.8838	1.904	0.0650	0.5158

Confirmatory in vivo antimalarial result of most active DeE and MeE extract

Next, the curative anti-malarial potencies (in vivo) of the DeE and MeE extracts were determined in comparison with chloroquine (CqN) whilst dropping the EaE extract as a result of its low relative potency.

Naïve mice passaged P. berghei (NK65 strain) exhibit parasitemia after 9 days as shown in the representative gel chromatogram depicting high copy number of pb-EMP1 and Giemsa-stained thin blood smears in passaged and not the control animals (as shown in Fig. 5A and B), on day 10 (p.i.) DeE, MeE and CqN (30 mg/kg) were administered once daily for 5 days at 100 mg/kg. High Pb-EMP1 copies were found in the untreated, CqN and MeE-treated groups but not in the DeE-treated and control groups (Fig. 5A), which is consistent with the representative Giemsa-stained thin blood films (Fig. 5B). Despite similar in vitro IC₅₀ values of DeE and CqN. However, DeE has shown better in vivo activity being able to clear the erythrocytic parasites.

Diethylether extract of S. siamea reverses hepatic inflammatory and lipodystrophy episodes in P. berghei-treated mice

After demonstrating that parasitemia had been cleared in groups treated with DeE extract, next we determined the effects on hepatic lipogenic gene expression pattern. It was observed that there was a down regulation of FAS, HMG-COA reductase and acetyl-coA carboxylase genes in P. berghei-infected liver samples relative to other solvent extract of SS as shown in Fig. 6A – C, hence the potential of constituents in DeE to induces significant hepatic lipodystrophy.

Effect of DeE on hepatic inflammation and necrotic damage

In addition to causing lipodystrophy, malaria is known to cause hepatic inflammation and necrotic damage, these biochemical episodes are linked to over expression of interleukin (IL)-1α gene (Mustafi et al. 2012; Happi et al. 2020). IL-1α is a known pro-inflammatory cytokine during acute infection and driver of hepatic necrosis in synergism with tumour necrosis factor (TNF)-α. IL-1α and TNF-α overexpressed in untreated animal groups and groups with partially cleared parasitemia were completely reversed in DeE-treated groups (Fig. 7A - C).

The results obtained so far are not surprising as TNF-a or IL-1 when combined with a low dose of interferon (IFN)-a is known to increase serum triglycerides in rats via de novo hepatic fatty acid synthesis, thus explaining the abrogation of lipogenic genes in DeE-treated animals which also showed blocked expression of TNF-a or IL-1.

Effect of DeE on hepatic necrosis gene expression

Finally, to assess the level of liver injury, calpain-2 and serpin-6 gene expression levels were monitored. Calpain-2 over-expression associated with liver damage was observed in untreated group and treatments which partially cleared parasitemia was completely downregulated following DeE treatment. Conversely, serine protease inhibitor (SERPIN)-6 known to protect tissues from inflammatory damage tend to be upregulated in DeE-treated group but not in untreated group

Result of GC-MS analysis of DeE extract

In order to validate the compounds enriched in DeE, GCMS analysis was performed. Seventeen (17) compounds were recordable (Fig. 9), but squalene was identified in large quantity (high % abundance) with a retention time of 2.123. However, squalene has not been tested extensively for antimalarial potency, its role in antimalarial adjuvant formulation has been well documented.

Result of molecular docking of squalene on DOXP and MEP receptors

As an intermediate of the isoprenoid pathway, it is not known whether accumulation of squalene would inhibit the two key enzymes of apicoplast isoprenoid pathway; 1-deoxy-D-xylulose-5-phosphate (DOXP) reductoisomerase (Silber et al. 2005; Oluyemi et al. 2022) and 2-C-Methyl-D-erythritol 4-Phosphate (MEP) Cytidyltransferas (Oluyemi et al. 2022; Silber et al. 2005).

To this end, computational docking simulation was used to evaluate the binding and possible inhibition by squalene in comparison to co-crystallized ligands as standards. The crystal structure of DOXP reductoisomerase has been resolved in complex with beta-substituted fosmidomycin analogue (PDB ID: 5JO0). The binding score of the beta-substituted fosmidomycin analogue (L59) is -7.1 kcal/mol while squalene (SQU) docked with − 6.7 kcal/mol (Thovarai 2009; Bentlage et al. 2016; Röhrich et al. 2005; Wanke, Skorupinska-Tudek, and Swiezewska 2001; Chaurasiya et al. 2012; Silber et al. 2005). Unlike L59 which binds proximal and displaces W296, squalene on the other hand has a 15.7 Å stretch through the entire active site in a pose which blocks the entrance of the active site (Fig. 10). Whether SQU remains bound to this position is only speculative and awaits verification using molecular dynamics simulation. SQU was also docked into the CTP-binding crevice of plasmodium MEP cytidyltransferase (PDB ID 2XWL template) with a value of -6.2 kcal/mol in comparison with − 10.0 kcal/mol recorded for CTP (data not shown) (Oluyemi et al. 2022). These data therefore support squalene may possess anti-malaria activity acting in part via DOXP reductoisomerase inhibition (Thovarai 2009).

Medicinal plants may play a critical role in synthesizing novel and potent antimalarial agents. Pharmacological studies have been performed on plant extracts, and purified metabolites for antimalarial activity have indicated the efficacy of most plants in the treatment of malaria. It is noteworthy to state that different medicinal plants have been screened with anti-protozoan/anti-malarial potential; these have resulted to average and non-encouraging outcomes (Fikadu and Ashenafi 2023).

However, the usage of SS have been shown to produced unprecedented findings, that is worthy of unveiling. The extractive yield of SS is shown in Table 1 above. An improved yield would have been observed for the various menstruum used if an advanced extraction method such as supercritical extraction procedure was used in the studies. Previous studies also indicated that a 10–16% yield of SS was achieved with the application of modern extraction method, relative to maceration utilized in this research (Jones and Kinghorn 2012; Capuzzo, Maffei, and Occhipinti 2013).

Also, the SS has been shown to possess different classes of secondary metabolites (Abdillah et al. 2015; Wang et al. 2019; Ajaiyeoba et al. 2008; Sholikha and Wulandari 2020). Researchers have shown that some compounds in these classes have been demonstrated to possess antimalarial potential as shown by different authors (Ajaiyeoba et al. 2008; Wang et al. 2019; Deguchi et al. 2012).

The acute toxicity profile of SS carried out in this research was observed to confirm the previous studies on the toxicological profile of SS. Previous studies also suggested that SS possess LD₅₀ of 9600 mg kg^− 1 (Pumpaisalchai et al. 2005). The observed result showed that SS is safe when administered orally

SS was subjected to batch extraction using different solvents of varying polarities. This was carried out to separate the SS compounds based on their polarity. Subjection of the different extract namely; DeE, EaE, MeE, and AQ to preliminary in vivo antimalarial study is shown in Fig. 1–3. Figure 1A showed that DeE extract possess the highest suppressive index in a dose dependent manner with the lowest and highest at 200 and 800 mg/kg with average suppressive index of 0.19 ± 0.05 and 0.10 ± 0.03, respectively relative to 1.23 ± 0.31 observed with negative control at p < 0.05. The pattern of parasite suppression is in the following order: DeE < EaE < MeE < AQ. Percentage curative of all the extracts at the highest dose (800 mg/kg) showed that DeE exhibited percentage parasite curation of 83.97 ± 5.12%, which is 61.63 and 41.37% higher than 32.22 ± 7.95% and 49.23 ± 3.28% observed in EeE and MeE extracts, respectively at p < 0.05. Also, all the extracts showed a weak prophylactic effect across the doses examined, with no significant different from values observed with negative control and all the extracts as shown in Fig. 3. The findings of this research support the previous studies on Cassia siamea, also known as Senna siamea (SS). Other species of Cassia such as Cassia spectabilis leaves as reported by (Ajaiyeoba et al. 2008; Abdillah et al. 2015; Tasiam, Primaharinastiti, and Ekasari 2020).

To further established the antimalarial potential of SS. The various extracts of SS were subjected to in vitro antiplasmodial assay. The following order of increasing potency is as follows, DeE (IC₅₀ = 0.06 mg/L) > CqN (IC₅₀ = 0.09 mg/L) > MeE (IC₅₀ = 0.52 mg/L) > EaE (IC₅₀ = 1.90 mg/L) (Fig. 4 and Table 2). However, the DeE fraction is marginally more potent than chloroquine but 8-fold more potent than MeE and 30-fold more potent than EaE. The observed in vitro activity noted SS further confirm the previous activity noted by previous researchers’ (Tasiam, Primaharinastiti, and Ekasari 2020)

However, to further confirm the antimalariall potential of DeE extract of SS, the various extracts were subjected to confirmatorty bioassay using naïve mice infected with P. berghei (NK65 strain). High Pb-EMP1 copies were found in the untreated, CqN and MeE-treated groups but not in the DeE-treated and control groups (Fig. 5A), which is consistent with the representative Giemsa-stained thin blood films (Fig. 5B). These findings also support the previous antimalarial potential of SS (Abdillah et al. 2015; Ajaiyeoba et al. 2008; Tasiam, Primaharinastiti, and Ekasari 2020)

Molecular basis of the antimalarial potential of SS showed that SS down regulated FAS, HMG-COA reductase, and acetyl-coA carboxylase genes in P. berghei-infected liver of the experimental animals as shown in Fig. 6A – C. Also, IL-1α and TNF-α overexpressed in untreated animal groups and groups with partially cleared parasitemia were completely reversed in DeE-treated groups (Fig. 7A - C). Also, DeE was also observed to upregulate serpin-6 genes and likewise down-regulate calpain-2 genes, these genes play a key role in liver injury (Acero et al. 2022; de Menezes et al. 2019; Fikadu and Ashenafi 2023; Mahittikorn et al. 2022; Megnekou et al. 2021). Although, different mechanisms have been elucidated with different antimalarial medications, but the probable antimalarial mechanism of SS was suggested for the first time.

In addition, GC-MS analysis of DeE extract of SS showed the presence of different compounds, with squalene (with a retention time of 2.123) observed to be the major constituents in DeE. Squalene (SQU) was observed to possess a promising binding affinity with DOXP reductoisomerase (-6.7 kcal/mol) relative to all the proteins implicated in malaria patholophysiology (Noushahi et al. 2022). Although, the molecular dymamic simulation is yet to be carried out to validate if the interaction with DOXP reductoisomerase might probably be the mechanism involve in the antimalarial potential observed.

As artemisinin resistance is on now on the rise, the chance of losing its position as the gold-standard for malaria treatment is a grim possibility. In order to prevent future loss of lives especially infants, there is a need to quickly research alternative anti-malarials. The alkaloidal component of Senna siamea has very potent anti-plasmodial property but with toxicity may be a bottleneck to its use in the treatment of malaria in human population. In the present work, we examined its less-toxic non-alkaloidal (lipophilic) extract. The results here demonstrate that the lipophilic extract is rich in squalene, and has exhibit marginally higher in vitro anti-plasmodial potency but significantly better in vivo anti-parasitemia potency than chloroquine and alkaloid-rich methanolic fraction. The efficacy of squalene rich DeE extract may be traced to the adjuvant role of squalene and other non-polar constituents present in DeE but the ability of squalene to also inhibit DOXP reductoisomerase but not MEP cytidyltransferase along the isoprenoid pathway has also been revealed using computational methods, it however, remains to be validated in kinetic assay. Finally, all lipogenic, inflammatory and cell necrosis markers upregulated in plasmodium-treated groups, were completely abrogated by DeE-treatment. The major strength of the present study is that Senna siamea is yet an unexploited bioresource for the development of high-potency anti-plasmodial secondary metabolites which may be ultimately developed for the treatment of human malaria.

GC-MS Gas chromatography-mass spectroscopy

CQ Chloroquine

SS Cassia siamea/Senna siamea

EaE Ethyl acetate extract

MeE Methanol extract

AQ Aqueous extract

DeE Diethyl ether extract

Ethics approval

This research involve the use of experimental animals. All applicable international, national, and/or institutional guidelines for the care and use of animals were followed. Also, appropriate consent and ethical clearance /approval was given by Animal and Experimental Ethical Committee of University of Benin with Approval number LS20218

Competing interests

No conflict of interest among authors

Authors' contributions

IM - conceptualization, WA, OA, GB –methodology, experimentation, data collection and analysis, OA – manuscript writing, IM – edition and supervision

Funding

The funds were generated among the researchers

Availability of data and material

Data are available on request

Acknowledgments

We the authors appreciate the entire management and staff of the University of Benin, Benin City, Nigeria. Special thanks to the researchers in the Department of Plant Biology and Biotechnology, University of Benin, Benin City, Nigeria.

Abdillah S, Tambunan RM, Farida Y, Sandhiutami NMD, and Rita Marleta Dewi (2015) Phytochemical Screening and Antimalarial Activity of Some Plants Traditionally Used in Indonesia. Asian Pac J Trop Disease 5(6). https://doi.org/10.1016/S2222-1808(15)60814-3
Acero C, Tovar J, Ramírez-Montoya MaríaC, Velasco, Paula A, Avilés-Vergara DR-C, Duran-Frigola M, Quintero G et al (2022) IL-4, IL-10, CCL2 and TGF-β as Potential Biomarkers for Severity in Plasmodium vivax Malaria. PLoS Negl Trop Dis 16(9). https://doi.org/10.1371/journal.pntd.0010798
Adedokun O, Gbolade A, Ayinde B (2021) 13, 14-Epoxyoleanan-3-Ol-Acetate: A Male Fertility Enhancing Constituent from Hexane Fraction of Momordica charantia Linn (Curcubitaceae). Turkish J Pharm Sci 0(0). https://doi.org/10.4274/tjps.galenos.2021.48264
Ajaiyeoba EO, Ashidi JS, Okpako LC, Houghton PJ, Wright CW (2008) Antiplasmodial Compounds from Cassia siamea Stem Bark Extract. Phytother Res 22(2). https://doi.org/10.1002/ptr.2254
Al-Adhroey AH, Zurainee M, Nor, Hesham M, Al-Mekhlafi AA, Amran, and Rohela Mahmud (2011) Antimalarial Activity of Methanolic Leaf Extract of Piper betle L. Molecules 16(1):107–118. https://doi.org/10.3390/molecules16010107
Al-Awadhi M, Suhail Ahmad, and Jamshaid Iqbal (2021) Current Status and the Epidemiology of Malaria in the Middle East Region and Beyond. Microorganisms. https://doi.org/10.3390/microorganisms9020338
Alson SG, Jansen O, Cieckiewicz E, Rakotoarimanana H, Rafatro H, Degotte G, Francotte P, Frederich M (2018) In-vitro and in-vivo Antimalarial Activity of Caffeic Acid and Some of Its Derivatives. Journal of Pharmacy and Pharmacology 70 (10). https://doi.org/10.1111/jphp.12982
Bachtiar B, and Andi Hamka Ahmad (2019) Analisis Kandungan Hara Kompos Johar Cassia siamea Dengan Penambahan Aktivator Promi. Jurnal Biologi Makassar 4 (1)
Bentlage B, Rogers TS, Bachvaroff TR, Delwiche CF (2016) Complex Ancestries of Isoprenoid Synthesis in Dinoflagellates. J Eukaryot Microbiol 63(1). https://doi.org/10.1111/jeu.12261
Bhowmik R, Roy S, Sengupta S, and Sameer Sharma (2021) Biocomputational and Pharmacological Analysis of Phytochemicals from Zingiber officinale (Ginger), Allium sativum (Garlic), and Murray akoenigii (Curry Leaf) in Contrast to Type 2-Diabetes. Int J Appl Pharm 13(5). https://doi.org/10.22159/ijap.2021v13i5.42294
Capuzzo A, Maffei ME, and Andrea Occhipinti (2013) Supercritical Fluid Extraction of Plant Flavors and Fragrances. Molecules. https://doi.org/10.3390/molecules18067194
Chaurasiya ND, Neelam S, Sangwan F, Sabir L, Misra, and Rajender S. Sangwan (2012) Withanolide Biosynthesis Recruits Both Mevalonate and DOXP Pathways of Isoprenogenesis in Ashwagandha Withania somnifera L. (Dunal). Plant Cell Rep 31(10). https://doi.org/10.1007/s00299-012-1302-4
Conway DJ (2007) Molecular Epidemiology of Malaria. Clin Microbiol Rev. https://doi.org/10.1128/CMR.00021-06
Cotter C, Hugh JW, Sturrock MS, Hsiang J, Liu AA, Phillips J, Hwang CS, Gueye N, Fullman RD, Gosling, Richard GA, Feachem (2013) The Changing Epidemiology of Malaria Elimination: New Strategies for New Challenges. Lancet. https://doi.org/10.1016/S0140-6736(13)60310-4
Deguchi J, Hirahara T, Hirasawa Y, Ekasari W, Widyawaruyanti A, Shirota O, Shiro M, and Hiroshi Morita. New Tricyclic Alkaloids, Cassiarins G (2012) H, J, and K from Leaves of Cassia siamea. Chemical and Pharmaceutical Bulletin 60 (2). https://doi.org/10.1248/cpb.60.219
Fang Y, He X, Zhang P, Shen C, Mwangi J, Xu C, Mo G, Lai R, Zhang Z (2019) In vitro and in vivo Antimalarial Activity of LZ1, a Peptide Derived from Snake Cathelicidin. Toxins 11 (7). https://doi.org/10.3390/toxins11070379
Fikadu M, and Ephrem Ashenafi (2023) Malaria: An Overview. Infect Drug Resist. https://doi.org/10.2147/IDR.S405668
Guggisberg AM, Rachel E, Amthor, Odom AR (2014) Isoprenoid Biosynthesis in Plasmodium falciparum. Eukaryot Cell 13:11. https://doi.org/10.1128/EC.00160-14
Happi G, Mouthé, Gesquiere Laure M, Tiani, Bel Youssouf M, Gbetnkom H, Hussain IR, Green (2020) Bonaventure Tchaleu Ngadjui, and Simeon Fogue Kouam. Phytochemistry and Pharmacology of Harungana madagascariensis: Mini Review. Phytochemistry Letters 35 (October 2019): 103–12. https://doi.org/10.1016/j.phytol.2019.11.015
Hatz C (2001) Management of Severe Malaria. A Practical Handbook. Transactions of the Royal Society of Tropical Medicine and Hygiene. 95. https://doi.org/10.1016/s0035-9203(01)90208-1
Ikem CJ, Appiah-Opong R, Oli AN, Ugwu MC, Amoateng P, Agyemang K, Nwobodo DC (2020) and Charles Okechukwu Esimone. In vitro and in vivo Antiplasmodial Assays of Selected Nigerian Commercial Herbal Formulations. Journal of HerbMed Pharmacology 9 (4). https://doi.org/10.34172/jhp.2020.47
Jones WP, Douglas Kinghorn A (2012) Extraction of Plant Secondary Metabolites. Methods Mol Biol 864. https://doi.org/10.1007/978-1-61779-624-1_13
Kumar D, Karmase A, Jagtap S, Shekhar R, Bhutani KK (2013) Pancreatic Lipase Inhibitory Activity of Cassiamin A, a Bianthraquinone from Cassia siamea. Nat Prod Commun 8(2). https://doi.org/10.1177/1934578x1300800216
Kusumawati I, Mahatmaputra S, Hadi R, Rohmania R, Rullyansyah S, Yusuf H, and Abdul Rahman (2021) Aphrodisiac Activity of Ethanolic Extracts from the Fruits of Three Pepper Plants from Piperaceae Family. JURNAL FARMASI DAN ILMU KEFARMASIAN INDONESIA 8(2). https://doi.org/10.20473/jfiki.v8i22021.194-199
Kweyamba PA, Zofou D, Efange N, Jules Clement N, Assob J, Kitau, and Mramba Nyindo (2019) In Vitro and in Vivo Studies on Anti-Malarial Activity of Commiphora africana and Dichrostachys cinerea Used by the Maasai in Arusha Region, Tanzania. Malar J 18(1). https://doi.org/10.1186/s12936-019-2752-8
Mahittikorn A, Mala W, Srisuphanunt M, Masangkay FR, Kotepui KU, Wilairatana P, and Manas Kotepui (2022) Tumour Necrosis Factor-α as a Prognostic Biomarker of Severe Malaria: A Systematic Review and Meta-Analysis. J Travel Med 29(4). https://doi.org/10.1093/jtm/taac053
Megnekou T, Ako S, Rose GF, Leke, Diane Wallace Audrey Davidson Thévenon, and, James AZ (2021) Inflammation Markers for Malaria-Associated Parasitemia in Pregnant Women: Potential Plasmodium falciparum and 2 Correlate with Elevated Levels of Soluble TNF Receptors 1. J Immunol References 185
de Menezes MN et al (2019) Érika Machado Salles, Flávia Vieira, Eduardo Pinheiro Amaral, Vanessa Zuzarte-Luís, Alexandra Cassado, Sabrina Epiphanio,. IL-1α Promotes Liver Inflammation and Necrosis during Blood-Stage Plasmodium Chabaudi Malaria. Scientific Reports 9 (1). https://doi.org/10.1038/s41598-019-44125-2
Mustafi R, Dougherty U, Shah H, Dehghan H, Gliksberg A, Wu J, Zhu H et al (2012) Both Stromal Cell and Colonocyte Epidermal Growth Factor Receptors Control HCT116 Colon Cancer Cell Growth in Tumor Xenografts. Carcinogenesis 33(10). https://doi.org/10.1093/carcin/bgs231
Mvondo JGM, Matondo A, Mawete DT, Sylvie-Mireille N, Bambi BM, Mbala, and Pierre O. Lohohola (2021) In silico ADME/T Properties of Quinine Derivatives Using SwissADME and PkCSM Webservers. Int J Trop Disease Health. https://doi.org/10.9734/ijtdh/2021/v42i1130492
Noushahi H, Armghan AH, Khan UF, Noushahi M, Hussain T, Javed M, Zafar M, Batool et al (2022) Biosynthetic Pathways of Triterpenoids and Strategies to Improve Their Biosynthetic Efficiency. Plant Growth Regul. https://doi.org/10.1007/s10725-022-00818-9
Oloya B, Namukobe J, Ssengooba W, Afayoa M, and Robert Byamukama (2022) Phytochemical Screening, Antimycobacterial Activity and Acute Toxicity of Crude Extracts of Selected Medicinal Plant Species Used Locally in the Treatment of Tuberculosis in Uganda. Trop Med Health 50(1). https://doi.org/10.1186/s41182-022-00406-7
Oluwasegun A, Nasiru A, and Efosa John (2015) In vitro Antioxidant Potential of Methanol Extracts of Allamanda schottii Pohl and Thevetia peruviana. (Apocyanaceae) 5(1):10–13
Oluwasegun Adedokun O, Ume M, Odunola D, Nnamani C, Jesumirhewe T, Ojo, and Ifeatu Aniebue (2021) Evaluation of Toxicological Profile of Methanol Leaf Extract of Waltheria indica (Sterculiaceae). GSC Biol Pharm Sci 17(2). https://doi.org/10.30574/gscbps.2021.17.2.0267
Oluyemi WM, Babatunde B, Samuel AT, Adewumi, Yemi A, Adekunle, Mahmoud ES, Soliman, and Liselotte Krenn (2022) An Allosteric Inhibitory Potential of Triterpenes from Combretum racemosum on the Structural and Functional Dynamics of Plasmodium falciparum Lactate Dehydrogenase Binding Landscape. Chem Biodivers 19(2):1–20. https://doi.org/10.1002/cbdv.202100646
Omolaso BO, Francis S, Oluwole OA, Odukanmi, Julius K, Adesanwo AA, Ishola, Adewole KE (2021) Evaluation of the Gastrointestinal Anti-Motility Effect of Anacardium occidentale Stem Bark Extract: A Mechanistic Study of Antidiarrheal Activity. J Pharm Anal 11(6). https://doi.org/10.1016/j.jpha.2020.06.009
Parquet Véronique, Henry M, Wurtz N, Dormoi J, Briolant Sébastien, Gil M, Baret E, Amalvict Rémy, Rogier C, and Bruno Pradines (2010) Atorvastatin as a Potential Anti-Malarial Drug: In vitro Synergy in Combinational Therapy with Quinine against Plasmodium falciparum. Malar J 9. https://doi.org/10.1186/1475-2875-9-139
Peter K, Kamau, Ng’ang’a Zipporah M, Njeruh Francis, and Thuita John (2020) In Vitro Antiplasmodial, Cytotoxicity Assay and Partial Chemical Characterization of Kenyan Physalis peruviana L. (Solanaceae Family) Extracts. J Med Plants Res 14(2). https://doi.org/10.5897/jmpr2019.6882
Pumpaisalchai W, Kaewvichit S, Taesothikul T, Sanichwankul K, Siriaunkgul S, Niwatananun W (2005) Toxicity of Barakol: Hepatotoxicity and Subacute Toxicity. In Acta Horticulturae. Vol. 679. https://doi.org/10.17660/ActaHortic.2005.679.19
Qidwai T, Jamal F, Khan MY, and Bechan Sharma (2014) Exploring Drug Targets in Isoprenoid Biosynthetic Pathway for Plasmodium falciparum. Biochem Res Int. https://doi.org/10.1155/2014/657189
Röhrich RenéC, Englert N, Troschke K, Reichenberg A, Hintz M, Seeber F, Balconi E et al (2005) Reconstitution of an Apicoplast-Localised Electron Transfer Pathway Involved in the Isoprenoid Biosynthesis of Plasmodium falciparum. FEBS Lett 579:28. https://doi.org/10.1016/j.febslet.2005.10.037
Sholikha M, and Ainun Wulandari (2020) Phytochemical Screening And Tyrosinase Inhibition Activity of Leaves Cassia siamea L. Jurnal Midpro 12(2). https://doi.org/10.30736/md.v12i2.240
Silber K, Heidler P, Kurz T, Klebe G (2005) AFMoC Enhances Predictivity of 3D QSAR: A Case Study with DOXP-Reductoisomerase. J Med Chem 48(10). https://doi.org/10.1021/jm0491501
Simon L, Imane A, Srinivasan KK, Pathak L, Daoud I (2017) In Silico Drug-Designing Studies on Flavanoids as Anticolon Cancer Agents: Pharmacophore Mapping, Molecular Docking, and Monte Carlo Method-Based QSAR Modeling. Interdisciplinary Sciences: Comput Life Sci 9(3):445–458. https://doi.org/10.1007/s12539-016-0169-4
Tasiam E, Primaharinastiti R, Ekasari W (2020) In Vitro Antimalarial Activity and Toxicity Studies of Johar (Cassia siamea) Leaves from Three Different Locations. Afr J Infect Dis 14(2). https://doi.org/10.21010/ajid.v14i2.4
Thovarai V (2009) In Silico Drug Design of Potential Novel Anti Malarial Agents. ProQuest Dissertations and Theses
Wang S, Shan WZ, Huang GZ, Zeng H, Zhu Z, Zhang GP, Li MY, Jiang, Xue Mei Gao (2019) Chemical Constituents of Cassia siamea. Zhongguo Zhongyao Zazhi 44(4). https://doi.org/10.19540/j.cnki.cjcmm.20181121.007
Wanke Małgorzata, Karolina Skorupinska-Tudek, and Ewa Swiezewska (2001) Isoprenoid Biosynthesis via 1-Deoxy-D-Xylulose 5-Phosphate/2-C-Methyl-D-Erythritol 4-Phosphate (DOXP/MEP) Pathway. Acta Biochim Pol. https://doi.org/10.18388/abp.2001_3901
Wongchum N, and Ananya Dechakhamphu (2021) Ethanol Extract of Cassia Siamea L. Increases Life Span in Drosophila melanogaster. Biochem Biophys Rep 25. https://doi.org/10.1016/j.bbrep.2021.100925
Ye C, Liang H, Li E, Xu L, Li P, and Guanghui Chen (2021) High-Throughput Virtual Screening of CDK2/Cyclin A2 Target Inhibitors. Gaodeng Xuexiao Huaxue Xuebao/Chemical J Chin Universities 42(10). https://doi.org/10.7503/cjcu20210405

Graphicalabstract.docx

Download PDF

Editorial decision: Major revisions
21 Aug, 2024
Reviewers agreed at journal
08 Aug, 2024
Reviewers invited by journal
07 Aug, 2024
Editor invited by journal
01 Aug, 2024
Editor assigned by journal
31 Jul, 2024
First submitted to journal
29 Jul, 2024

You are reading this latest preprint version

Diethyl ether extract of Senna siamea Lam. (Fabaceae) exhibits antiplasmodial polypharmacology activity via inhibition of DOXP reductoisomerase, reverse overexpression of pbEMPI, hepatolipodystrophy, and hepatic portal inflammatory genes

Status:

Version 1

Abstract

Figures

Introduction

Materials and Methods

Plant collection and authentication

Experimental Animals, Test Parasite, and Standard Drug

Plant extraction

Acute Oral Toxicity Test

Biological studies

Suppressive antimalarial screening

Curative antimalarial screening

Prophylactic antimalarial screening

Molecular docking of squalene

Preparation of ligands

Docking Studies

Statistical analysis

Results

Percentage yield of extraction

Result of acute toxicity study

Result of preliminary antimalarial studies

Effect of DeE on hepatic inflammation and necrotic damage

Effect of DeE on hepatic necrosis gene expression

Result of GC-MS analysis of DeE extract

Result of molecular docking of squalene on DOXP and MEP receptors

Discussion

Conclusion

Abbreviations

Declarations

References

Supplementary Files

Status:

Version 1