The transcription factor Bcl11a is essential for functional B-1a cell maintenance during aging

doi:10.21203/rs.3.rs-4825323/v1

Download PDF

Article

The transcription factor Bcl11a is essential for functional B-1a cell maintenance during aging

https://doi.org/10.21203/rs.3.rs-4825323/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

B-1a cells, key natural IgM producers, are established during fetal and neonatal stages and maintained through self-renewal in adulthood. Essential for initial immune responses, these cells experience a functional decline and clonal expansion as they age, a process not yet fully understood. Our study identifies the transcription factor Bcl11a as crucial for maintaining B-1a cell numbers, showing variable expression between aged male and female mice. Enhanced Bcl11a expression in females correlates with increased B-1a cell counts, whereas its reduction in males leads to fewer cells. Deleting Bcl11a markedly reduces B-1a cell numbers across both sexes and all ages, highlighting its essential role in cell maintenance. Bcl11a's loss upregulates FcγRIV (Fcgr4), facilitating NK cell-mediated antibody-dependent cellular cytotoxicity (ADCC). By repressing Fcgr4 directly and indirectly through Fcer1g, Bcl11a protects B-1a cells from ADCC, thus preserving their viability. This discovery emphasizes the potential of modulating Bcl11a expression to boost immune function in the elderly, underscoring its importance in immune surveillance and cellular integrity.

Biological sciences/Immunology/Cell death and immune response

Biological sciences/Immunology/Innate immune cells/Innate lymphoid cells

B-1a cells, a specialized subset of B cells, are integral to the innate immune system due to their ability to produce natural antibodies, primarily of the IgM class, without prior exposure to pathogens ¹. Originating predominantly during fetal and neonatal stages ^{2, 3, 4}, these cells are maintained throughout life in a self-renewing manner ^{5, 6, 7, 8, 9, 10}, primarily residing in the peritoneal and pleural cavities ¹. Prior research has detailed the developmental pathway of B-1 cell precursors in fetal and neonatal mice ^{11, 12}, highlighting a restricted BCR repertoire and clonal expansion in the aging B-1a cell pool ^{11, 13, 14}. Notably, B-1a cells function as lifelong residents in body cavities, continuously producing natural antibodies and serving as a first line of defense against infections ¹⁵.

These cells are critical for the rapid immune response to common bacterial and viral pathogens, effectively bridging the gap until the adaptive immune response is fully mobilized ¹⁶. However, it has been noted that the functional capacity of B-1a cells declines in elderly individuals, resulting in compromised immunity and increased rates of pneumonia morbidity and mortality, especially among males ^{13, 17, 18, 19}. Despite their crucial role, the mechanisms that regulate and maintain B-1a cells are poorly understood—a significant gap in knowledge that could potentially be bridged to enhance cell therapies and personalized medicine approaches for the elderly.

Antibody-dependent cellular cytotoxicity (ADCC) is a key immune response where cells, such as NK cells and macrophages, destroy antibody-tagged cells ²⁰. Recent findings suggest ADCC's role in eliminating senescent cells ^{21, 22}, accentuating its importance in immune surveillance during aging.

Bcl11a, a key transcription factor in hematopoiesis, plays pivotal roles across various hematopoietic cells, including B cells, early T cell progenitors, common lymphoid progenitors, and hematopoietic stem cells (HSCs) ^{23, 24, 25, 26, 27}. Essential for normal lymphocyte development, Bcl11a also influences the formation of other hematopoietic cells such as erythrocytes ²⁸ and plasmacytoid dendritic cells (pDCs) ²⁹, thereby impacting hematopoietic homeostasis extensively. Previous studies have highlighted Bcl11a’s critical role in maintaining HSC self-renewal and multipotency ^{25, 26}, crucial for the generation of mature blood cells. Additionally, Bcl11a is necessary for the viability of B cell progenitors in the bone marrow by regulating key molecules such as Bcl2, Bcl-xL, and Mdm2 ²⁴. Insights into genetic variations of Bcl11a further underscore its importance in various hematologic disorders ³⁰, emphasizing its role in maintaining normal blood cell function and integrity.

This study aims to systematically explore the aging features of B-1a cells and investigate the role of Bcl11a in maintaining these cells during aging. Understanding how Bcl11a contributes to B-1a cell longevity could provide critical insights into aging and immunity, potentially leading to novel therapeutic strategies to boost immune function in the elderly.

Characterization of B-1a cells from aged mice

To dissect B-1a cell cellular and molecular characteristics, we isolated B-1a cells from both young (3-month-old) and aged (24-month-old) C57BL/6 mice (Fig. 1A). Notably, B-1a cells from both aged males and females exhibited increased DNA double-strand breaks, higher rates of apoptosis, and decreased cell cycle activity compared to their younger counterparts (Fig. 1, B-E). Additionally, we noted a decline in the polar distribution of polarity proteins like tubulin and Cdc42 in aged cells (Fig. S1, A and B), mirroring observations in aged hematopoietic stem cells ^{31, 32}.

Our quantitative assessments showed that aged female mice had a 19.4-fold increase in peritoneal B-1a cell numbers compared to young females, while aged males had only a 2.4-fold increase relative to their younger counterparts (Fig. 1F). The proportion of B-1a cells among total peritoneal B cells was significantly higher in aged females than in young females and notably lower in aged males compared to young males (Fig. 1G). This suggests that aged female mice maintain a higher number and proportion of peritoneal B-1a cells.

Acknowledging the essential role of mitochondria in cell maintenance ³³, we measured the mitochondrial membrane potential (MMP) in B-1a cells. There was a significant decrease in MMP in B-1a cells from both aged males and females compared to younger mice (Fig. 1, H and I). Mitochondrial stress tests indicated that aged B-1a cells, while having similar basal oxygen consumption rates as younger cells, showed significantly reduced maximal respiration and spare respiration capacities (Fig. 1, J and K). Metabolically, B-1a cells from aged males exhibited reductions in both basal and compensatory glycolysis, whereas those from aged females showed increases (Fig. 1, L and M), indicating an enhanced capacity to generate energy, correlating with the higher numbers of peritoneal B-1a cells in females.

Further molecular characterization using RNA-seq and ATAC-seq revealed 165 upregulated and 148 downregulated differentially expressed genes (DEGs) in aged male B-1a cells compared to younger ones (Fig. S1 C). In contrast, aged females exhibited 577 upregulated and 542 downregulated DEGs (Fig. S1 D), pointing to more extensive gene expression changes with age in female B-1a cells. Gene ontology (GO) terms such as "negative regulation of cell activation", “negative regulation of cell cycle”, “regulation of leukocyte apoptotic process”, and "response to amyloid-beta” were prevalent across both genders (Fig. S1, E and F). Remarkably, chromatin accessibility substantially increased in aged female B-1a cells (Fig. 1N and S1 G), especially in regions associated with “metabolic process” and “chromatin function”. (Fig. S1 H). These findings emphasize pronounced gender-specific differences in gene expression among aged B-1a cells. Given that aged females maintain a higher number of B-1a cells that protect against Streptococcus pneumoniae infection ¹⁸, we hypothesized that genes with increased chromatin accessibility in these cells might be key regulators for maintaining functional B-1a cells. We identified Bcl11a, a crucial factor for bone marrow B cell precursor viability ²⁴, as having substantially increased locus accessibility (Fig. 1O).

Functional maintainence of B-1a cell requires Bcl11a

We employed Bcl11a-eGFP reporter mice ²⁴ to assess Bcl11a expression changes during B-1a cell aging. Bcl11a expression was upregulated in B-1a cells from aged females, while it was downregulated in those from aged males (Fig. 2, A and B). This pattern corresponds with changes in chromatin accessibility at the Bcl11a locus, increasing in females and decreasing in males (Fig. 1O). Both qRT-PCR and immunostaining analyses confirmed these gender-specific expression patterns (Fig. 2, C-E). A study suggested that interleukin-5 (IL-5) upregulation in females might drive this increase in B-1a cells ¹⁸. Our hypothesis that IL-5 could be inducing Bcl11a expression was confirmed by significant enhancement upon IL-5 supplementation in vitro (Fig. 2, F-I), implying Bcl11a plays pivotal role in the maintenance of B-1a cells during aging.

To investigate Bcl11a's role in B-1a cell maintenance, we utilized Bcl11a conditional knockout mice (Bcl11a^fl/fl) ²⁴ crossed with Mb1-cre mice ³⁴, which specifically express cre recombinase in B cells. This genetic manipulation resulted in a significant reduction in B-1a cell numbers across both genders during aging (Fig. 2, J and K). Recognizing that Mb1-cre expression starts in early pro-B cells ³⁴, we aimed to specifically target mature B-1a cells for Bcl11a deletion. To this end, we generated Bhlhe41-CreERT2 mice by inserting an IRES-creERT2 cassette into the 3’UTR of the Bhlhe41 locus (Fig. 2L), which predominantly expresses IRES-creERT2 in mature B-1 cells ^{35, 36}. These mice were then crossed with Bcl11a^fl/fl mice to enable inducible deletion in mature B-1a cells. Following tamoxifen induction, we observed a marked decrease in peritoneal B-1a cell numbers across both genders (Fig. 2, M and N), further confirming Bcl11a's essential role in the maintenance of mature B-1a cells.

We further elucidated Bcl11a’s functional significance using a polybacterial sepsis model ^{37, 38}, employing Bcl11a^fl/fl mice crossed with Bhlhe41-dTomato-cre mice ³⁶. Post-cecal ligation and puncture (CLP) to induce sepsis, Bhlhe41^{dTomato − cre/+};Bcl11a^fl/fl mice displayed a more pronounced decrease in B-1a cell numbers and lower survival rates compared to controls (Fig. 2, O-Q). These results reinforce that Bcl11a is crucial for the functional maintenance of B-1a cells under stress conditions.

Elimination of Bcl11a-deleted B-1a cells depends on ADCC

To explore Bcl11a’s role in B-1a cell maintenance further, we conducted adoptive transfer experiments using B-1a cells isolated from Mb1^cre/+;Bcl11a^fl/fl mice and control Mb1^cre/+;Bcl11a^+/+ mice, covering both genders since Bcl11a is vital for maintaining B-1a cells in both male and female mice. These cells (CD45.2) were co-transferred at a 1:1 ratio with wild-type B-1a cells (CD45.1) into Il2rg^−/−;Rag2^−/− mice, which lack all lymphocytes, and into Bhlhe41-deficient mice, noted for a specific deficiency in B-1a cells but retention of other lymphocyte types ³⁶ (Fig. 3A). Eight weeks post-transfer, analysis of peritoneal B-1a cells revealed that, unlike cells from Mb1^cre/+;Bcl11a^+/+ mice which demonstrated engraftment similar to wild-type B-1a cells in both recipient types, B-1a cells from Mb1^cre/+;Bcl11a^fl/fl mice exhibited a reduced ratio of 1:2 to wild-type B-1a cells in Il2rg^−/−;Rag2^−/− recipients and were nearly absent in recipients (Fig. 3, B and C). This suggests that Bcl11a-deleted B-1a cells were likely eliminated by lymphocytes in Bhlhe41-deficient recipients, indicating a critical dependency on Bcl11a for their survival and maintenance.

To further elucidate the mechanism of elimination of these Bcl11a-deleted B-1a cells, we investigated the role of antibody-dependent cellular cytotoxicity (ADCC). A 1:1 mixture of Bcl11a-deleted and wild-type B-1a cells was injected into Fcer1g^−/− mice (Fig. 3D), which have an ADCC deficiency ³⁹. Eight weeks later, the ratio of Bcl11a-deleted to wild-type B-1a cells remained approximately 1:1 (Fig. 3, E and F), indicating that the elimination of Bcl11a-deleted B-1a cells depends on ADCC.

Considering the NK cells are the major effector cells in ADCC, we assessed their involvement in the elimination of Bcl11a-deleted B-1a cells by adoptively transferring NK cells into Il2rg^−/−;Rag2^−/− recipients accompanied with mouse IgG antibodies injection after the introduction of a mixture of Bcl11a-deleted and wild-type B-1a cells (Fig. 3G). Notably, the introduction of NK cells efficiently cleared the Bcl11a-deleted B-1a cells in these recipients (Fig. 3, H and I), underscoring the critical role of NK cells in this process.

These findings collectively demonstrate that the loss of Bcl11a in B-1a cells triggers an NK cell-mediated ADCC response, underscoring a vital immune surveillance mechanism against abnormal cells during aging.

Expression of FcγRIV on Bcl11a-deleted B-1a cells triggers ADCC-mediated elimination

To elucidate the molecular mechanisms behind Bcl11a's role in maintaining B-1a cells, particularly its function in repressing ADCC, we performed Cleavage Under Targets and Tagmentation (CUT&Tag) sequencing on primary B-1a cells from the peritoneal cavities of mice of mixed gender. This analysis identified both established Bcl11a targets such as Asb2 and Fcgr3 (encoding FcγRIII) ⁴⁰ (Fig. S2A), and new potential targets including Fcer1g (encoding the gamma subunit of Fc receptors), Fcgr1 (encoding FcγRI), Fcgr2b (encoding FcγRIIB), and Fcgr4 (encoding FcγRIV) (Fig. 4A). Subsequent ATAC-seq analysis indicated increased chromatin accessibility at the loci of these genes following Bcl11a deletion (Fig. 4B). Flow cytometry confirmed the upregulation of Fcer1g, Fcgr2b, and Fcgr4 in B-1a cells, with no changes in Fcgr1 and Fcgr3 expression, upon Bcl11a deletion (Fig. 4, C-F).

Further investigations using CUT&Tag qPCR and dual luciferase assays verified direct binding of Bcl11a to the Fcer1g promoter and a enhancer for Fcgr4 (Fig. S2, B-E). Interestingly, deletion of Fcer1g attenuated the Bcl11a-deletion-induced increase in Fcgr4 expression but did not affect Fcgr2b expression (Fig. 4, E and F), confirming that Fcer1g is essential for optimal Fcgr4 expression ³⁹.

To assess whether the elimination of Bcl11a-deleted B-1a cells by ADCC is mediated through the regulation of Fcer1g or Fcgr4, we utilized Mb1^cre/+;Bcl11a^fl/fl;Fcer1g^−/− mice lacking Fcgr4 expression on B-1a cells. After mixing and transferring these cells with wild-type B-1a cells into Bhlhe4-deficient mice (Fig. 4G), we observed that the ratio of Bcl11a-Fcer1g double knockout B-1a cells to wild-type B-1a cells stabilized at approximately 1:1 (Fig. 4, H and I), suggesting that the ADCC-mediated elimination of Bcl11a-deleted B-1a cells depends on the expression of both Fcer1g and Fcgr4.

To further demonstrate that Bcl11a-mediated repression of ADCC involves regulating Fcgr4 expression on the cell surface, we employed a B-1a cell and NK cell co-culture system (Fig. 4J). Initially, Bcl11a-deficient B-1a cells isolated from Mb1^cre/+;Bcl11a^fl/fl mice displayed a significantly increased binding capacity to IgG2a-ovalbumin immune complexes compared to cells from Mb1^cre/+;Bcl11a^+/+ mice (Fig. S2, F-H). The addition of NK cells significantly increased apoptosis in Bcl11a-deficient B-1a cells in the presence of these immune complexes (Fig. 4, K and L). However, when Fcer1g was deleted, reducing Fcgr4 cell surface expression (Fig. 4, E and F), NK cell-induced apoptosis was notably diminished, reinforcing that effective killing of Bcl11a-deficient B-1a cells necessitates the expression of both Fcer1g and Fcgr4 (Fig. 4, K and L).

Additional experiments confirmed that Fcgr4 expression is crucial for apoptosis induction in Bcl11a-deficient B-1a cells. Blocking Fcgr4 with an antibody protected these cells from NK cell-mediated cytotoxicity (Fig. 4, K and L). Furthermore, NK cells co-cultured with Bcl11a-deficient B-1a cells exhibited significantly higher levels of granzyme B and perforin (Fig. S2, I-L). This was not the case when NK cells were co-cultured with Bcl11a and Fcer1g double knockout B-1a cells (Fig. S2, I-L), underscoring the essential role of Fcgr4 in facilitating NK cell functionality.

Collectively, these results demonstrate that the upregulation of Fcgr4 due to Bcl11a deletion in B-1a cells triggers their apoptosis through enhanced NK cell activity, highlighting a critical immune regulatory pathway.

Maintaining B-1a cell viability requires Bcl11a to repress NK cell-mediated ADCC during aging

Our investigation into Bcl11a's role in ADCC during physiological aging involved examining Fc receptors for IgGs (FcγRs) in aged B-1a cells. We discovered that all Fcgrs, including Fcgr1, Fcgr2b, Fcgr3, and Fcgr4, were upregulated in B-1a cells from aged males (Fig. 5, A and B). In contrast, only Fcgr2b and Fcgr4 showed increased expression in cells from aged females (Fig. 5, A and S3, B). Both aged female and male B-1a cells upregulated Fcgr4 suggest that its upregulation-triggered ADCC is a common mechanism for the elimination of B-1a cells in both genders during the aging process.

To further explore this mechanism, we isolated B-1a cells with high (top 15%) and low (bottom 15%) Bcl11a expression from aged male and female mice (Fig. 5C and S3 C). Bcl11a-low B-1a cells from both sexes exhibited significantly higher expression of Fcer1g and Fcgr4 at mRNA and protein levels (Fig. 5, D-I and S3, D-I). Subsequent experiments demonstrated that these Bcl11a-low B-1a cells, regardless of the mouse’s sex, were more susceptible to NK cell-mediated ADCC, driven by the upregulated expression of Fcgr4 (Fig. 5, J-L and S3, J-L).

These findings reveal that endogenous Bcl11a in aged B-1a cells actively represses the expression of critical receptors, Fcer1g and Fcgr4. By regulating these receptors, Bcl11a shields B-1a cells from NK cell-mediated ADCC, thus preserving their viability during aging. This regulatory mechanism underscores Bcl11a's vital role in the immune surveillance and functional preservation of B-1a cells, highlighting its importance in maintaining cellular integrity as they age.

Our study thoroughly explores the cellular and molecular changes in aging B-1a cells, underscoring the crucial role of Bcl11a in maintaining their functionality. We observed significant age-related alterations across both genders, including increased DNA damage, enhanced apoptosis, reduced cell cycle activity, diminished polarity protein distribution, and decreased oxidative phosphorylation. Remarkably, in line with recent findings ^{18, 19}, aged female mice maintain a substantially higher number of B-1a cells, equipped with enhanced glycolytic pathways to meet their energy needs.

Our findings reveal dynamic regulation of Bcl11a expression, which is markedly upregulated in B-1a cells from aged females and downregulated in males. This differential expression correlates with the observed disparities in B-1a cell counts between genders, suggesting a gender-specific regulatory mechanism by Bcl11a that could significantly impact immune competence in aging populations.

Our multi-omics analysis demonstrates that Bcl11a both directly and indirectly suppresses Fcgr4 expression. Bcl11a deletion leads to Fcgr4 upregulation, promoting clearance of these cells by NK cells through ADCC. The inverse relationship between Bcl11a and Fcgr4 levels in aged B-1a cells confirms Bcl11a’s effective repression of Fcgr4.

Additionally, abnormally expressed Fcgr4 on Bcl11a-deleted B-1a cells enhances immune complex binding, as evidenced in our co-culture system. Despite the upregulation of Fcgr2b, there was no corresponding increase in immune complex binding due to its lower antibody affinity ⁴¹.

Moreover, while NK cells are the primary mediators of ADCC, our studies indicate that other leukocytes, such as neutrophils and macrophages, also contribute, albeit to a lesser extent. This was demonstrated when Bcl11a-deleted B-1a cells, mixed with wild-type cells and transferred into immune-deficient mice, showed a reduced survival ratio, suggesting that multiple cell types can mediate cytotoxicity against Bcl11a-deleted B-1a cells.

NK cells eliminate target cells through a "missing-self" mechanism ^{42, 43}. Our RNA-seq analysis of Bcl11a-deleted B-1a cells shows decreased expression of MHC-I genes, including Qa-1 (H2-T23) and the H2-D/K/L/M/Q family, and increased expression of several NKG2D-activating genes, such as Rae1 and Ulbp1, and the NKp46-activating gene Calr (Fig. S3 M). These changes likely enhance NK cell cytotoxicity against Bcl11a-deleted B-1a cells, a mechanism that warrants further investigation.

In conclusion, the sex-specific regulation of Bcl11a expression is crucial for developing tailored interventions for the elderly. Enhancing Bcl11a expression through methods like IL-5 stimulation, agonist antibodies, or epigenetic modulators could offer effective prophylaxis against infections, particularly in older males. This study illustrates how B-1a cells experience diminished fitness with age and how Bcl11a's upregulation counteracts this decline by suppressing FcγRIV expression and inhibiting ADCC-mediated clearance. Understanding these mechanisms is essential for developing therapies that enhance immune competence in aged individuals, paving the way for innovations in geriatric medicine and immune resilience.

Mice

Bcl11a ^eGFP/eGFP and Bcl11a^fl/fl mice ²⁴, as well as Bhlhe41^{dTomato − cre/+} mice ³⁶, have been previously reported. Mb1-cre (020505), Il2rg^−/− (002479), Rag2^−/− (008449) mice were obtained from The Jackson Laboratory. B6-Ly5.1/Cr mice were purchased from Charles River, and Fcer1g^−/− (NM-KO-190187) mice were acquired from the Shanghai Model Organisms Center, Inc. Wild-type C57BL/6 mice, both male and female, were purchased from the Beijing Vital River Laboratory Animal Technology Company.

The Bhlhe41^creERT2/+ mice on a C57BL/6 background were generated by Cyagen Biosciences Inc. using CRISPR-Cas9 technology. Briefly, a gRNA targeting the Bhlhe41 gene, a donor vector containing the "IRES-CreERT2" cassette, and Cas9 mRNA were co-injected into fertilized mouse eggs to produce targeted knockin offspring. F0 founder animals were identified by PCR and sequence analysis, and then bred with wild-type mice to test for germline transmission and produce F1 animals. The gRNA target sequence is 5' TCCTCCCTGGCACGCTTTAGAGG 3'. The IRES-CreERT2 cassette was inserted into the 3' UTR of the Bhlhe41 locus. For wild-type allele genotyping, a forward primer 5' TTTCCCTTGCTTGTCGTCCG 3' and a reverse primer 5' CTTAAGTCATTCCACATGGCTCTC 3' (PCR product size 556 bp) were used. For transgenic allele genotyping, a forward primer 5' ATGAAGTGCAAGAACGTGGTG 3' and a reverse primer 5' ACGAGAACTAAAGGTAAGGAGAGTA 3' (PCR product size 412 bp) were used.

Both male and female mice were used in this study. The specific pathogen-free mice were housed under standard conditions on a 12-hour light/dark cycle, with ad libitum access to food and water, in the animal facility at Tongji University, Shanghai, China. All experiments were approved by the Animal Care Committee of Tongji University and conducted in accordance with their guidelines, under approval number TJAB03423101.

Antibody

Fluorochrome-labeled monoclonal antibodies (with clones denoted in parentheses) against CD16 (2.4G2), CD3 (17A2), CD19 (6D5), CD5 (53 − 7.3), CD23 (B3B4), CD45.1 (A20), CD45.2 (104), FcγRI (S18017D), FcγRIIB (AT130-2), FcγRIII (S18017D), FcγRIV (9E9), NK1.1 (PK136), NKp46 (29A1.4), BrdU (3D4), Granzyme B (GB11), and Perforin (S16009A) were purchased from BioLegend or Invitrogen. Tubulin (YL1/2), Cdc42 (EPR15620), γH2AX (JBW301), and Bcl11a (EPR14943-44) were purchased from Abcam. The following antibodies were also purchased from Invitrogen: Fcer1g polyclonal antibody, donkey anti-rabbit Alexa Fluor 488, donkey anti-mouse Alexa Fluor 488, donkey anti-rabbit Alexa Fluor 647, goat anti-rabbit Alexa Fluor 546, and goat anti-rat Alexa Fluor 647. Mouse IgG (CSB-NP001601m) was obtained from Cusabio Technology LLC, and purified FcγRIV (9E9) was purchased from Bio X cell. Anti-Ovalbumin IgG2a (M12E45) was sourced from Chondrex.

Cell sorting and flow cytometry analyses

Peritoneal lavage was performed on euthanized mice. All samples were treated with RBC lysis buffer for 2 min (Gibco), subsequently diluted with the FACS buffer (PBS with 2.0% FBS), and then centrifuged at 350 x g for 10 min. Single-cell suspension was analyzed or sorted on BD LSRFortessa™ X-20 or BD FACSAria™ Fusion sorter, respectively. Data was analyzed with FlowJo 10.0 software (BD Biosciences).

Murine model of polymicrobial sepsis

Mice were randomly assigned to groups before modeling. Bhlhe41^{dTomato − cre/+};Bcl11a^fl/fl and Bhlhe41^{dTomato − cre/+};Bcl11a^+/+ mice were anesthetized with 2% isoflurane inhalation and underwent cecal ligation and puncture (CLP). A 2-cm incision was made in the abdominal wall, the cecum was exposed, and ligated 0.5 cm from the tip with a 4–0 silk suture. A 22-gauge needle was used to puncture the distal cecum, extruding a small amount of fecal material. The cecum was then replaced into the abdominal cavity, and the abdominal wall was closed in two layers with a running 4–0 silk suture. Peritoneal B-1a cells were collected and counted 3 days post-CLP.

Adoptive cell-transfer experiments

An equal number (10,000 cells) of flow cytometry-sorted CD45.2⁺ B-1a cells from Mb1^cre/+;Bcl11a^fl/fl or Mb1^cre/+;Bcl11a^+/+ mice, mixed with CD45.1⁺ B-1a cells from B6-Ly5.1/Cr mice, were transferred into Bhlhe41-deficient (Bhlhe41^{dTomato − cre/dTomato−cre}) or Il2rg^−/−;Rag2^−/− recipient mice by intraperitoneal injection, respectively. Similarly, 10,000 eGFP + B-1a cells from Bcl11a^eGFP/eGFP reporter mice, mixed with dTomato + B-1a cells from Bhlhe41^{dTomato − cre/+};Bcl11a^fl/fl mice, were transferred into Fcer1g^−/− recipients. For NK cell cytotoxicity experiments, Il2rg^−/−;Rag2^−/− mice received mixed B-1a cells and 40,000 wild-type spleen NK cells, while the control group was injected with PBS. All recipient mice were given weekly injections of 120 µg mouse IgG antibody. The frequency of donor B-1a cells among total peritoneal B cells was analyzed 2 months post-transfer.

NK cell-mediated antibody-dependent cellular cytotoxicity (ADCC) in vitro assay

The ADCC assay was modified based on a previously reported method ²¹. Briefly, spleen NK cells were freshly isolated from normal mice to serve as effectors (E), while Bcl11a-deleted B-1a cells were used as target cells (T). Ovalbumin (10 µg/mL) and anti-Ovalbumin IgG2a antibody (10 µg/mL) were incubated for 1 hour at 37°C to form immune complexes. B-1a cells isolated from Mb1^cre/+;Bcl11a^+/+ mice, Mb1^cre/+;Bcl11a^fl/fl mice, and Mb1^cre/+;Bcl11a^fl/fl;Fcer1g^−/− mice were incubated with or without FcγRIV block antibody (Bio X Cell, BE0378) on ice for 15 minutes before incubating with or without the immune complexes on ice for 2 hours. The mixture was then washed to remove unbound immune complexes. Wild-type spleen NK cells were added to the B-1a cells at an E : T ratio of 4:1 (1 × 10⁵ NK cells versus 0.25 × 10⁵ B-1a cells), along with 1500 U hIL-2, 200 U mIL-4, and 200 U mIL-5. The cells were then incubated at 37°C in a 5% CO2 incubator for 36 hours. B-1a cell apoptosis and NK cell cytotoxicity were assessed by flow cytometry.

In vivo BrdU incorporation assay

The mice were given water containing 0.8 mg/mL BrdU (Sigma-Aldrich, B5002) and 1% sucrose for 6 days. On Day 6, they were intraperitoneally injected with a single dose of 100 mg/kg BrdU. The mice were euthanized on Day 7, and peritoneal cells were collected and analyzed by FACS.

Cell metabolism assays

The Mito Stress Test Kit (Agilent, 103015–100) was used to measure the oxygen consumption rate (OCR), while the Glycolytic Rate Assay Kit (Agilent, 103344–100) was used to measure the glycolytic proton efflux rate (GlycoPER). Prior to measurement, the probe plate was hydrated with HPLC-grade water in a CO2-free incubator. The phenol red-free assay solution, containing 10 mM glucose, 2 mM glutamine, 1 mM pyruvate, and 5 mM HEPES, was kept in a 37°C CO2-free incubator to maintain pH. The HPLC-grade water in the hydration plate was then replaced with a calibration solution and kept in the same incubator.

B-1a cells were seeded into XF96 cell culture microplates coated with 0.1 mg/mL poly-lysine (Seahorse Bioscience) at a density of 2 × 10⁵ cells per well. The cells were incubated at 37°C in a CO2-free environment for 20 minutes. OCR and GlycoPER, indicators of mitochondrial oxidative phosphorylation and glycolysis, respectively, were measured using the Agilent Seahorse XF96 Extracellular Flux Analyzer (Agilent Technologies) according to the manufacturer’s instructions.

For OCR measurement, oligomycin, FCCP, and Rot/AA (mitochondrial electron transport chain inhibitors) were added as instructed. For GlycoPER detection, Rot/AA and 2-deoxy-D-glucose (2-DG, a glycolysis inhibitor) were used, following the manufacturer’s protocol.

Immunofluorescence imaging

B-1a cells were sorted directly onto poly-lysine-coated slides and allowed to adhere for 30 minutes at 37°C in a cell incubator. The slides were then washed with DPBS and fixed in PBS containing 4% PFA for 30 minutes at room temperature. Following fixation, the slides were permeabilized in PBS with 0.15% Triton X-100 for 10 minutes at room temperature and blocked in PBS with 1% BSA for 1 hour at room temperature. The slides were incubated overnight at 4°C in PBS with 1% BSA containing primary antibodies. After incubation, the slides were washed three times with PBS and incubated for 1 hour at room temperature with appropriate secondary antibodies in PBS with 1% BSA.

The following primary antibodies were used: rabbit anti-Bcl11a (Abcam, Ab191401, 1:200), rat anti-Tubulin (Abcam, Ab6160, 1:500), rabbit anti-CDC42 (Abcam, Ab187643, 1:500), and mouse anti-p-H2AX (Millipore, 05-636, 1:400). Secondary antibodies included donkey anti-rabbit Alexa Fluor 488 (Invitrogen, A-21206, 1:500), donkey anti-mouse Alexa Fluor 488 (Invitrogen, A-21202, 1:500), donkey anti-rabbit Alexa Fluor 647 (Invitrogen, A-31573, 1:500), goat anti-rabbit Alexa Fluor 546 (Invitrogen, A-11035, 1:500), and goat anti-rat Alexa Fluor 647 (Invitrogen, A-21247, 1:500).

Finally, the slides were washed three times with PBS, and nuclei were stained with 1 mg/mL DAPI for 10 minutes before mounting. Cells were imaged using a Nikon microscope (ECLIPSE NI-E) and analyzed with NIS Elements Viewer (v4.11.0, Nikon) or ImageJ (v1.53a).

Dual luciferase reporter gene assay

Fragments of DNA containing the Fcer1g promoter region and both the promoter region and enhancer region (~ 20 bp upstream) of Fcgr4 were amplified and cloned into the PGL4.10 luciferase reporter vector (Promega, E6651). Site-directed mutagenesis of the Bcl11a binding sites within the Fcer1g promoter and Fcgr4 enhancer was performed using the TaKaRa MutanBEST Kit (Takara, R401). The coding region of Bcl11a (NM_001242934.1) was inserted into the pcDNA3.1 vector for overexpression studies.

HEK293T cells were seeded in 24-well plates overnight and transfected in triplicate using Hieff TransTM Liposomal Transfection Reagent (Yeasen, 40802ES03). Each well received 0.5 µg of pcDNA3.1 or the constructed vector, 200 ng of PGL4.10 or the constructed vector, and 20 ng of the Renilla pRL-CMV vector (Promega, E2261) as an internal control. After 24 hours, relative luminescence units (RLUs) were measured using the Dual-Luciferase Reporter Assay System kit (Promega, E1910) according to the manufacturer’s instructions. The ratio of Firefly RLUs to Renilla RLUs was calculated to determine relative luciferase activity.

Quantitative real‑time PCR (qPCR)

Total RNA was extracted using the RNeasy Plus Micro Kit (Qiagen, 74034) following the manufacturer's protocol. Reverse transcription was carried out with the PrimeScript™ RT Reagent Kit with gDNA Eraser (Perfect Real Time) (Takara, RR047A). Quantitative PCR (qPCR) was performed with TB Green™ Premix Ex Taq™ II (Tli RNaseH Plus) (Takara, RR820A) on a CFX384 real-time system (Bio-Rad). Data quantification was achieved using the 2^−ΔΔCt method. All primers were synthesized by Tsingke Biotech (Beijing, China), with the following sequences: Bcl11a (Forward primer: CTTTCTAACCCGGCTCTCCC, Reverse primer: CAAGAGGTTCGGGCGAGAAT); Fcer1g (Forward primer: TATAGC CA GCCGTGAGAAAGC, Reverse primer: AGCCAAGCACGTCTGTTCTG); Fcgr4 (Forward primer: GAAA GCCTCATCCCACACCA, Reverse primer: TGAAGC AATAGCCAGCCCA).

Low input RNA-seq library construction and data analysis

Low-input libraries were constructed using the Smart-seq2 method ⁴⁴. Sequencing was performed on the Illumina NovaSeq 6000 platform with the PE150 mode. RNA sequencing data were analyzed using the nf-core/rnaseq pipeline (v3.12.0) (https://github.com/nf-core/rnaseq). FASTQ files were trimmed to remove adapters with TrimGalore (v0.6.7) ⁴⁵. Reads were aligned to the mouse reference genome (mm10 assembly) using STAR (v2.7.10a) ⁴⁶ and quantified with RSEM (v1.3.1) ⁴⁷. Differential gene expression was assessed using the RNAseqStat R package (v0.1.0) (https://github.com/xiayh17/RNAseqStat) with output from the DESeq2 algorithm ⁴⁸. Genes with log2 fold change > 1 and a P value < 0.05 were considered significantly differentially expressed.

ATAC-seq library construction and data analysis

ATAC-seq was performed according to the protocol provided by Jiayin Biotechnology Ltd. (Shanghai, China). Libraries were sequenced on an Illumina NovaSeq 6000 platform using a paired-end (PE) 150-bp configuration. The nf-core/atacseq pipeline (v2.1.2) (https://github.com/nf-core/atacseq) was used for data analysis. Briefly, raw reads were trimmed to remove adapters using TrimGalore (v0.6.7) ⁴⁵, and then mapped to the mm10 mouse reference genome using BWA (v0.7.17) ⁴⁹. Mitochondrial DNA, blacklisted regions, and duplicate reads marked by Picard (v3.0.0) (https://github.com/broadinstitute/picard) were removed from BAM files using Samtools (v1.15.1) ⁵⁰. Normalized BigWig files for genomic track visualization were generated using deepTools (v3.5.1) ⁵¹. Peak calling was performed with MACS2 (v2.2.7.1) ⁵², and peak annotation was carried out using the annotatePeak function in ChIPseeker (v1.38.0) ⁵³. Motif analysis was conducted with the findMotifsGenome.pl program in HOMER (v4.11) ⁵⁴ using default settings. Differential peak calling was performed using the DiffBind R package (v3.12.0) [DiffBind: differential binding analysis of ChIP-Seq peak data. Bioconductor http://bioconductor.org/packages/release/bioc/vignettes/DiffBind/inst/doc/DiffBind.pdf], with peaks showing a P value < 0.05 considered significant.

CUT&Tag sequencing and analysis

CUT&Tag libraries of sorted B-1a cells were prepared using the Hyperactive Universal CUT&Tag Assay Kit for Illumina Pro (Vazyme, TD904). Library quality was assessed with a Qubit 3.0 Fluorometer (Invitrogen, Carlsbad, CA, USA) and an Agilent Bioanalyzer 2100 (Agilent Technologies, Palo Alto, CA, USA). Libraries with different indices were multiplexed and sequenced on an Illumina HiSeq 4000 instrument (Illumina, San Diego, CA, USA) following the manufacturer’s instructions, using a 2 × 150 paired-end configuration. The antibodies used for CUT&Tag were rabbit anti-Bcl11a (Abcam, Ab191401, 1:50), normal mouse IgG control (CST, 68860L, 1:50), and goat anti-Rabbit IgG (H + L) secondary antibody (Vazyme, Ab208).

We employed the nf-core/cutandrun pipeline (v3.2.2) (https://github.com/nf-core/cutandrun) for analyzing CUT&Tag data. Specifically, adapter and quality trimming were performed using TrimGalore (v0.6.6) ⁴⁵, followed by alignment of reads to the mm10 genome using Bowtie 2 (v2.4.4) ⁵⁵. E. coli was used as the spike-in species. Peak calling was conducted with SEACR (v1.3) ⁵⁶, and peak annotation was performed using the ChIPseeker R package (v1.38.0) ⁵³. Fragment-based quality control and heatmap peak analysis were carried out with deepTools (v3.5.1) ⁵¹. BedGraph files were generated with BEDTools (v2.30.0) ⁵⁷, and bigWig coverage files were created using the bedGraphToBigWig program ⁵⁸. All track files were visualized using IGV software (v2.16.2) ⁵⁹.

CUT&Tag for qPCR

CUT&Tag (Vazyme, TD904) for qPCR assays was performed following the manufacturer’s protocol. Briefly, B-1a cells were incubated with ConA Beads Pro at room temperature for 10 minutes. Rabbit anti-Bcl11a antibody (Abcam, Ab191401, 1:200) was added and incubated with the cells overnight at 4°C. The cells were then further incubated with goat anti-rabbit IgG (H + L) secondary antibody (Vazyme, Ab208) at room temperature for 1 hour. After two washes, pA/G-Transposon Pro Enzyme was added and incubated with the cells at 4°C for 1 hour, followed by fragmentation with MgCl2. Finally, a stop buffer was added and incubated at 95°C for 5 minutes. DNA was purified for qPCR, and spike-in DNA derived from the genomic DNA of E. coli was used for uniform correction. Primer sequences used were: Fcer1g (Forward primer: TGGGAGCTGGTGATCGC, Reverse primer: CTGAAAGGGCTGAGTCTTAG); Fcgr4 (Forward primer: GCTTTTCCTGTTTAAGGAACG, Reverse primer: GATCACGTGAACATGGCTG).

Functional enrichment analysis

Gene functional enrichment analyses, including Gene Ontology (GO) term was conducted using the clusterProfiler package (v4.10.1) ⁶⁰ in R (v4.3.1).

Statistical analysis

Data are presented as means ± SEM and analyzed using GraphPad Prism 9 (GraphPad Software). Differences between means were assessed using two-tailed Student’s t-test or one-way analysis of variance (ANOVA) with Sidak’s multiple comparisons or two-way analysis of variance (ANOVA) with Tukey’s multiple comparison test. Significance was denoted as follows: *P ≤ 0.05; **P ≤ 0.01; ***P ≤ 0.001; ****P ≤ 0.0001. Detailed statistical information for each experiment is provided in the corresponding figure legends.

Data Availability Statement

Bulk RNA-seq (GSE272987), ATAC-seq (GSE272985), and CUT&Tag (GSE272986) have been deposited to the Gene Expression Omnibus (GEO) database. This paper does not report the original code. We use referenced sources of code that can be found in the vignettes of the cited packages as listed in the method.

Acknowledgments

This work was supported by the Natural Science Foundation of China (82371736) and the National Key R&D Program of China (2021YFA1100903)

S.X. carried out most of the experiments and analyzed the data. L.H. and Y.H. performed the bioinformatics data analysis. L.Z., J.W., and Y.Y. performed experiments. X.S., C.L., R.W., and Z.M. provided intellectual inputs for the manuscript. Y.Y. designed research, analyzed the data and wrote the manuscript. All authors provided critical feedback on the manuscript.

The authors thank Pro. Pentao Liu for providing Bcl11a^eGFP/eGFPand Bcl11a^fl/fl mice and thank Pro. Hui Wang for providing Bhlhe41^{dTomato-cre/+}mice.

The authors declare no competing financial interests.

Baumgarth N. The double life of a B-1 cell: self-reactivity selects for protective effector functions. Nat Rev Immunol 11, 34-46 (2011).
Montecino-Rodriguez E, Dorshkind K. B-1 B cell development in the fetus and adult. Immunity 36, 13-21 (2012).
Montecino-Rodriguez E, Fice M, Casero D, Berent-Maoz B, Barber CL, Dorshkind K. Distinct Genetic Networks Orchestrate the Emergence of Specific Waves of Fetal and Adult B-1 and B-2 Development. Immunity 45, 527-539 (2016).
Ghosn E, Yoshimoto M, Nakauchi H, Weissman IL, Herzenberg LA. Hematopoietic stem cell-independent hematopoiesis and the origins of innate-like B lymphocytes. Development 146, (2019).
Sawen P, et al. Murine HSCs contribute actively to native hematopoiesis but with reduced differentiation capacity upon aging. Elife 7, (2018).
Vergani S, et al. A self-sustaining layer of early-life-origin B cells drives steady-state IgA responses in the adult gut. Immunity 55, 1829-1842 e1826 (2022).
Hayakawa K, Hardy RR, Herzenberg LA, Herzenberg LA. Progenitors for Ly-1 B cells are distinct from progenitors for other B cells. J Exp Med 161, 1554-1568 (1985).
Hayakawa K, Hardy RR, Stall AM, Herzenberg LA, Herzenberg LA. Immunoglobulin-bearing B cells reconstitute and maintain the murine Ly-1 B cell lineage. Eur J Immunol 16, 1313-1316 (1986).
Lalor PA, Herzenberg LA, Adams S, Stall AM. Feedback regulation of murine Ly-1 B cell development. Eur J Immunol 19, 507-513 (1989).
Lalor PA, Stall AM, Adams S, Herzenberg LA. Permanent alteration of the murine Ly-1 B repertoire due to selective depletion of Ly-1 B cells in neonatal animals. Eur J Immunol 19, 501-506 (1989).
Luo Y, et al. Single-cell genomics identifies distinct B1 cell developmental pathways and reveals aging-related changes in the B-cell receptor repertoire. Cell Biosci 12, 57 (2022).
Wong JB, et al. B-1a cells acquire their unique characteristics by bypassing the pre-BCR selection stage. Nat Commun 10, (2019).
Holodick NE, Vizconde T, Hopkins TJ, Rothstein TL. Age-Related Decline in Natural IgM Function: Diversification and Selection of the B-1a Cell Pool with Age. J Immunol 196, 4348-4357 (2016).
Tsuji N, Rothstein TL, Holodick NE. Antigen Receptor Specificity and Cell Location Influence the Diversification and Selection of the B-1a Cell Pool with Age. J Immunol 205, 741-759 (2020).
Smith FL, Baumgarth N. B-1 cell responses to infections. Curr Opin Immunol 57, 23-31 (2019).
Aziz M, Holodick NE, Rothstein TL, Wang P. The role of B-1 cells in inflammation. Immunol Res 63, 153-166 (2015).
Holodick NE, Rothstein TL. B cells in the aging immune system: time to consider B-1 cells. Ann N Y Acad Sci 1362, 176-187 (2015).
Webster SE, Ryali B, Clemente MJ, Tsuji NL, Holodick NE. Sex Influences Age-Related Changes in Natural Antibodies and CD5(+) B-1 Cells. J Immunol 208, 1755-1771 (2022).
Webster SE, Tsuji NL, Clemente MJ, Holodick NE. Age-related changes in antigen-specific natural antibodies are influenced by sex. Front Immunol 13, 1047297 (2022).
Fanger MW, Shen L, Graziano RF, Guyre PM. Cytotoxicity mediated by human Fc receptors for IgG. Immunol Today 10, 92-99 (1989).
Kim KM, et al. Identification of senescent cell surface targetable protein DPP4. Genes Dev 31, 1529-1534 (2017).
Takaya K, Asou T, Kishi K. Selective Elimination of Senescent Fibroblasts by Targeting the Cell Surface Protein ACKR3. Int J Mol Sci 23, (2022).
Liu P, et al. Bcl11a is essential for normal lymphoid development. Nat Immunol 4, 525-532 (2003).
Yu Y, et al. Bcl11a is essential for lymphoid development and negatively regulates p53. J Exp Med 209, 2467-2483 (2012).
Tsang JC, et al. Single-cell transcriptomic reconstruction reveals cell cycle and multi-lineage differentiation defects in Bcl11a-deficient hematopoietic stem cells. Genome Biol 16, 178 (2015).
Luc S, et al. Bcl11a Deficiency Leads to Hematopoietic Stem Cell Defects with an Aging-like Phenotype. Cell Rep 16, 3181-3194 (2016).
Zhou W, Gao F, Romero-Wolf M, Jo S, Rothenberg EV. Single-cell deletion analyses show control of pro-T cell developmental speed and pathways by Tcf7, Spi1, Gata3, Bcl11a, Erg, and Bcl11b. Sci Immunol 7, eabm1920 (2022).
Esteghamat F, et al. Erythropoiesis and globin switching in compound Klf1::Bcl11a mutant mice. Blood 121, 2553-2562 (2013).
Ippolito GC, et al. Dendritic cell fate is determined by BCL11A. Proc Natl Acad Sci U S A 111, E998-1006 (2014).
Yin J, Xie X, Ye Y, Wang L, Che F. BCL11A: a potential diagnostic biomarker and therapeutic target in human diseases. Biosci Rep 39, (2019).
Florian MC, et al. Cdc42 activity regulates hematopoietic stem cell aging and rejuvenation. Cell Stem Cell 10, 520-530 (2012).
Florian MC, et al. Aging alters the epigenetic asymmetry of HSC division. PLoS Biol 16, e2003389 (2018).
Suomalainen A, Nunnari J. Mitochondria at the crossroads of health and disease. Cell 187, 2601-2627 (2024).
Hobeika E, et al. Testing gene function early in the B cell lineage in mb1-cre mice. Proc Natl Acad Sci U S A 103, 13789-13794 (2006).
Kreslavsky T, et al. Essential role for the transcription factor Bhlhe41 in regulating the development, self-renewal and BCR repertoire of B-1a cells. Nature Immunology 18, 442-+ (2017).
Li H, et al. Identification of novel B-1 transitional progenitors by B-1 lymphocyte fate-mapping transgenic mouse model. Frontiers in Immunology 13, (2022).
Aziz M, Holodick NE, Rothstein TL, Wang P. B-1a Cells Protect Mice from Sepsis: Critical Role of CREB. J Immunol 199, 750-760 (2017).
Murata K, Murao A, Tan C, Wang P, Aziz M. B-1a Cells Scavenge NETs to Attenuate Sepsis. J Leukoc Biol, (2024).
Takai T, Li M, Sylvestre D, Clynes R, Ravetch JV. Fcr Gamma-Chain Deletion Results in Pleiotropic Effector Cell Defects. Cell 76, 519-529 (1994).
Sunami Y, et al. BCL11A promotes myeloid leukemogenesis by repressing PU.1 target genes. Blood Adv 6, 1827-1843 (2022).
Nimmerjahn F, Ravetch JV. Fcgamma receptors as regulators of immune responses. Nat Rev Immunol 8, 34-47 (2008).
Herberman RB, Reynolds CW, Ortaldo JR. Mechanism of cytotoxicity by natural killer (NK) cells. Annu Rev Immunol 4, 651-680 (1986).
Prager I, Watzl C. Mechanisms of natural killer cell-mediated cellular cytotoxicity. J Leukoc Biol 105, 1319-1329 (2019).
Picelli S, Faridani OR, Bjorklund AK, Winberg G, Sagasser S, Sandberg R. Full-length RNA-seq from single cells using Smart-seq2. Nat Protoc 9, 171-181 (2014).
Felix Krueger FJ, Phil Ewels, Ebrahim Afyounian, Michael Weinstein, Benjamin Schuster-Boeckler, Gert Hulselmans, & sclamons. FelixKrueger/TrimGalore - add default decompression path. Zenodo. (2023).
Dobin A, et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15-21 (2013).
Li B, Dewey CN. RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinformatics 12, 323 (2011).
Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15, 550 (2014).
Li H, Durbin R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 25, 1754-1760 (2009).
Danecek P, et al. Twelve years of SAMtools and BCFtools. Gigascience 10, (2021).
Ramirez F, Dundar F, Diehl S, Gruning BA, Manke T. deepTools: a flexible platform for exploring deep-sequencing data. Nucleic Acids Res 42, W187-191 (2014).
Zhang Y, et al. Model-based analysis of ChIP-Seq (MACS). Genome Biol 9, R137 (2008).
Wang Q, et al. Exploring Epigenomic Datasets by ChIPseeker. Curr Protoc 2, e585 (2022).
Heinz S, et al. Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities. Mol Cell 38, 576-589 (2010).
Langmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2. Nat Methods 9, 357-359 (2012).
Meers MP, Tenenbaum D, Henikoff S. Peak calling by Sparse Enrichment Analysis for CUT&RUN chromatin profiling. Epigenetics Chromatin 12, 42 (2019).
Quinlan AR, Hall IM. BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics 26, 841-842 (2010).
Kent WJ, Zweig AS, Barber G, Hinrichs AS, Karolchik D. BigWig and BigBed: enabling browsing of large distributed datasets. Bioinformatics 26, 2204-2207 (2010).
Robinson JT, et al. Integrative genomics viewer. Nat Biotechnol 29, 24-26 (2011).
Wu T, et al. clusterProfiler 4.0: A universal enrichment tool for interpreting omics data. Innovation (Camb) 2, 100141 (2021).

There is NO Competing Interest.

Fig.S1.pdf
Figure S1. Characterization of B-1a cells from aged mice. (A and B)Detection of the polar distribution of polarity proteins (Tubulin and Cdc42) in B-1a cells by single-cell immunofluorescence staining (n = 3). (C and D)Volcano plots illustrating differentially expressed genes (DEGs) between young and old B-1a cells from males (C) and females (D), analyzed by RNA-seq. Significant DEGs (Benjamini-Hochberg adjusted P < 0.05, log2 Fold Change > 1) are highlighted: violet dots indicate upregulated genes and blue dots indicate downregulated genes for males; red dots indicate upregulated genes and yellow dots indicate downregulated genes for females. (E) Bar chart showing Gene Ontology (GO) pathways enriched in upregulated DEGs in B-1a cells from old males (OM) compared to young males (YM). (F) Bar chart showing GO pathways enriched in upregulated DEGs in B-1a cells from old females (OF) compared to young females (YF). (G) Histogram depicting the number of differentially accessible regions (DARs) in aged B-1a cells compared to young B-1a cells, identified by ATAC-seq assay. In male mice, young males (YM) serve as the control group and old males (OM) as the test group. Peaks with higher intensities in the OM group are labeled as open DARs, while those with lower intensities are labeled as closed DARs. In female mice, young females (YF) serve as the control group and old females (OF) as the test group, with similar labeling for open and closed DARs. (H) GO pathways analysis of genes enriched in open DARs from old female B-1a cells. Means and SEM are depicted. Statistical significance is denoted as ns (no significance), *p ≤ 0.05, **p ≤ 0.01. One-way ANOVA with Sidak’s multiple comparison test was performed in (B). The analyses in (E), (F), and (H) were conducted using clusterProfiler, applying a two-sided hypergeometric test with Benjamini-Hochberg correction for multiple comparisons.
Fig.S2.pdf
Figure S2. Expression of FcγRIV on Bcl11a-deleted B-1a cells triggers ADCC-mediated Elimination. (A) Representative illustration of Bcl11a CUT&Tag genomic binding patterns at the regions of genes Asb2 and Fcgr3 in B-1a cells from C57BL/6 wild-type mice . (B and C) Dual luciferase assays showing that Bcl11a suppresses Fcer1g expression by binding to its promoter region (B) and restrains Fcgr4 expression by binding to its enhancer region (C). (D and E) CUT&Tag qPCR confirming Bcl11a binding sites at the promoter locus of Fcer1g (D) and at an enhancer locus 20kb upstream of the Fcgr4 transcriptional start site in B-1a cells (E). (F) 1×10⁴ B-1a cells isolated from Mb1^cre/+;Bcl11a^+/+ mice, Mb1^cre/+;Bcl11a^fl/fl mice, and Mb1^cre/+;Bcl11a^fl/fl;Fcer1g^-/-mice were incubated with the Ova-IgG2a immune complex (IC) for 2 hours on ice, followed by examination of IgG2a surface expression by flow cytometry. (G) Representative dot plots showing the surface expression of IgG2a on indicated B-1a cells after incubation with the Ova-IgG2a immune complex. (H) Quantification of the proportion of IgG2a+ B-1a cells in the indicated groups after incubation with the IgG2a-Ova immune complex (n = 5). (I-L) Examination of NK cell cytotoxicity in an NK cell-mediated antibody-dependent cellular cytotoxicity in vitro assay: 1×10⁴ B-1a cells from wild-type, Mb1^cre/+;Bcl11a^+/+, Mb1^cre/+;Bcl11a^fl/fl, Mb1^cre/+;Bcl11a^fl/fl;Fcer1g^-/- mice were incubated with or without anti-OVA IgG2a immune complexes for 2 hours on ice. After washing, 4×10⁴ wild-type NK cells were added along with cytokines (1500U hIL-2, 200U mIL-4, 200U mIL-5) and cultured for 36 hours at 37°C, 5% CO2. Intracellular expression levels of Granzyme B and Perforin in NK cells were analyzed by flow cytometry (n = 5). Means and SEM are depicted. Statistical significance is indicated as no significance (ns), **p ≤ 0.01, ***p ≤ 0.001, and ****p ≤ 0.0001. Statistical analyses include one-way ANOVA with Sidak’s multiple comparison test for (B), (C), (J), and (K), and unpaired two-tailed Student's t-test for (D) and (E).
Fig.S3.pdf
Figure S3. Maintaining B-1a cell vability requires Bcl11a to repress NK cell-mediated ADCC during female mice aging. (A) Representative flow cytometry plots showing the surface expression levels of Fcγ receptors (Fcgr1, Fcgr2b, Fcgr3, and Fcgr4) on B-1a cells from young female (YF) and old female (OF) mice. (B) Quantification of the proportions of B-1a cells expressing Fcgr1, Fcgr2b, Fcgr3, and Fcgr4 in YF and OF groups (n = 5). (C) Isolation of B-1a cells with high (top 15%) and low (bottom 15%) Bcl11a expression from aged Bcl11a^eGFP/eGFPreporter female mice (24-month-old). (D) Quantitative RT-PCR analysis of Fcer1g mRNA levels in the indicated B-1a cells (n = 6). (E and F) Intracellular flow cytometry analysis of Fcer1g protein expression in the indicated B-1a cells (n = 5). (G) Quantitative RT-PCR analysis of Fcgr4 mRNA levels in the indicated B-1a cells (n = 6). (H and I) Flow cytometry analysis of Fcgr4 expression on the indicated B-1a cells (n = 6). (J) Schematic of the NK cell-mediated antibody-dependent cellular cytotoxicity (ADCC) in vitro assay: High and low Bcl11a expression B-1a cells (1×10⁴) from old female mice were incubated with or without an Fcgr4 blocking antibody for 15 minutes on ice, followed by incubation with or without anti-OVA IgG2a immune complexes for 2 hours on ice. After washing, 4×10⁴ wild-type NK cells were added along with cytokines (1500U hIL-2, 200U mIL-4, 200U mIL-5) and cultured for 36 hours at 37°C, 5% CO2. Apoptosis and cytotoxicity were analyzed by flow cytometry. (K and L) Analysis of apoptotic B-1a cells (AnnexinV⁺7-AAD^- and AnnexinV⁺7-AAD⁺) in the indicated groups by flow cytometry (n = 5). "IC" denotes immune complex. (M) Heatmap of selected differentially expressed genes (DEGs) following Bcl11a deletion in B-1a cells from both young and old male mice. Genes are color-coded based on their expression levels. Statistical analyses include no significance (ns), **p ≤ 0.01, ***p ≤ 0.001, and ****p ≤ 0.0001. Two-way ANOVA with Tukey’s multiple comparison test was used for (B). One-way ANOVA with Sidak’s multiple comparison test was used for (L), and an unpaired two-tailed Student’s t-test for (D), (F), (G), and (I). Means and SEM are shown.

Download PDF

Version 1

posted

You are reading this latest preprint version

The transcription factor Bcl11a is essential for functional B-1a cell maintenance during aging

Status:

Version 1

Abstract

Figures

Introduction

Results

Characterization of B-1a cells from aged mice

Functional maintainence of B-1a cell requires Bcl11a

Maintaining B-1a cell viability requires Bcl11a to repress NK cell-mediated ADCC during aging

Disscussion

Materials and methods

Mice

Antibody

Cell sorting and flow cytometry analyses

Murine model of polymicrobial sepsis

Adoptive cell-transfer experiments

In vivo BrdU incorporation assay

Cell metabolism assays

Immunofluorescence imaging

Dual luciferase reporter gene assay

Quantitative real‑time PCR (qPCR)

Low input RNA-seq library construction and data analysis

ATAC-seq library construction and data analysis

CUT&Tag sequencing and analysis

CUT&Tag for qPCR

Functional enrichment analysis

Statistical analysis

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1