Pathogenicity of tick-derived lymphocytic choriomeningitis virus in BALB/c mice

doi:10.21203/rs.3.rs-4833465/v1

Download PDF

Research Article

Pathogenicity of tick-derived lymphocytic choriomeningitis virus in BALB/c mice

https://doi.org/10.21203/rs.3.rs-4833465/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Background

Lymphocytic choriomeningitis virus (LCMV) is a zoonotic pathogen primarily transmitted by rodents. Recently, we identified LCMV in ticks in northeastern China; however, the pathogenicity of the virus in mice remains unknown.

Results

Here, we examined the tick-derived LCMV strain JX14 by inoculating BALB/c mice with 3.5×10⁵ PFU of virus. The mice infected with LCMV displayed clinical manifestations including unkempt fur, anorexia, depression, and oliguria, which subsequently resolved by 10 days post infection (dpi) leading to survival of the infection. Viral RNA was detectable in throat and anal swabs during the early phase of infection and exhibited proliferation in Vero cells. Viral RNA was detected in the blood and various organs, with detectable levels persisting for up to 6 months specifically in the heart. Pathological lesions were identified in most organs within 5 dpi except for the kidneys and testicles. Elevated production of pro-inflammatory cytokines, including interleukin (IL)-5, IL-6, keratinocyte chemoattractant (KC), and interferon gamma (IFN-γ), was observed during the early stages of infection.

Conclusions

This study provides crucial insights into the pathogenic characteristics of LCMV strain JX14, isolated from ticks in northeastern China, thereby offering a valuable in vivo research tool for investigating immunological responses induced by chronic viral infections.

Lymphocytic choriomeningitis virus

Ticks

Pathogenicity

BALB/c mice

Rodents

LCMV is a neglected zoonotic virus transmitted by rodents, belonging to the Mammarenavirus genus within the Arenaviridae family [1]. Infection in humans can occur through direct contact with infected rodents and their contaminated fomites, inhalation of aerosols containing the virus, transplantation of organs infected with LCMV, or congenital transmission [2]. For individuals with normal immune function, the virus typically induces mild, self-limiting, or asymptomatic infections; however, some cases may manifest as thrombocytopenia and leukopenia and progress to aseptic meningitis without long-term sequelae [3]. In contrast, immunocompromised patients are at risk of developing severe systemic infection leading to mortality. Congenital infection can result in profound damage to the central nervous system and retina of fetuses, potentially causing microcephaly or even abortion [4–6].

LCMV exhibits a broad geographical distribution worldwide, including Africa, Europe, Asia, Australia, and America [7]. The common house mouse (Mus musculus) is the major reservoir of LCMV, which can develop a chronic, asymptomatic infection, shedding the virus via their excreta and body fluids throughout their lives. Notably, LCMV has been detected and isolated from Ixodes ricinus in Ukraine, as well as from at least three tick species in northeastern China [8–10]. The tick-derived LCMV strains in China exhibited distinct clades in phylogenetic trees, and demonstrated only 75.4–82.2% sequence identity with other genotype I strains at the nucleotide level [9]. These findings suggest that the tick-derived LCMV strains may possess divergent pathogenicity towards humans and mice. In this study, we established a persistent infection model in BALB/c mice using the tick-derived LCMV strain JX14, thereby facilitating the comprehensive evaluation of pathogenicity and potential transmission patterns associated with this viral strain.

Virus and animals

Tick-derived LCMV strain JX14 (GenBank Accession No. MG554175 and MG554171) was used in the present study, which was isolated from Dermacentor silvarum ticks in 2015 in Jilin, northeastern China. The virus was propagated in Vero cells, and stored at -80 ℃ until use. Three-week-old SPF BALB/c mice were obtained from Changsheng Biotechnology Co., Ltd. (Benxi, China). Following a one-week acclimation period in separate cages at the Biosafety Level 3 laboratory of the Changchun Veterinary Research Institute (Changchun, China), the mice were utilized for the experiment.

Animal infection and sample collection

The mice were intraperitoneally inoculated with 3.5×10⁵ PFU of LCMV strain JX14, followed by a six-month monitoring period post-inoculation. Clinical examinations were conducted at one dpi, and lasted until to 30 dpi. The mice were subjected to throat and anal swab sampling, followed by suspension in 0.3 mL of Dulbecco's Modified Eagle Medium (DMEM), and subsequent storage at − 80°C until use. After serial retroorbital blood draws, the blood samples were subjected to centrifugation at 1,000 rpm for 10 minutes to obtain serum. Macroscopic observations were conducted at 3, 5, 7, 10, 15, 30, 90, and 180 dpi. At each timepoint, three male and three female mice were euthanized for brain, heart, lung, spleen, liver, kidney, intestine, and testicle tissues collection.

Virus isolation

All the collected throat and anal swab specimens were used for the virus isolation with Vero cells as described elsewhere [9]. Briefly, 50 µL of samples were diluted 10-fold in DMEM, filtered through a syringe-driven 0.22-µm filter, and then applied onto the Vero cell monolayer for 1 hour. The Vero cells in the control group were incubated with DMEM alone for the same duration. Then the cells were maintained in DMEM supplemented with 2% fetal calf serum at 37°C in a 5% carbon dioxide atmosphere. After three blind passages, the cells were observed for cytopathic effects, and the culture supernatant was collected for LCMV RNA detection using RT-qPCR.

RNA extraction and RT-qPCR detection

The RNA extraction was performed on 140 µL of serum, throat swab, anal swab, and tissue homogenate supernatant specimens using a TIANamp Virus RNA Kit (TIANGEN, China). Subsequently, the extracted RNA was converted into complementary DNA utilizing a Reverse Transcription kit (TaKaRa, Japan). The detection of LCMV was performed using RT-qPCR with primers designed based on the nucleocapsid protein, F (5′-TGATGAGTCYTTCACGTCCCA‐3′), R (5′‐GACAACACAGCAGCTTGACC‐3′), and probe (FAM-TCACCACACCAGTTGCACCCT-BHQ1), under the following conditions: 95°C for 30 s; followed by 50 cycles of amplification at 60°C for 5 s and denaturation at 95°C for 30 s. A positive result for LCMV was defined as a cycle threshold value below 40.

Pathological examinations and fluorescence in situ hybridization

Tissues comprising the spleen, lung, liver, kidney, heart, brain, intestine, and testicle from a male and a female mouse at 5 and 15 dpi, respectively, were utilized for histopathological examinations. After being preserved in formalin for 1 week and embedded in paraffin, the tissues were sectioned to a thickness of 10-µm and subsequently stained with hematoxylin and eosin.

The tissue sections were further detected for LCMV RNA distribution using fluorescence in situ hybridization (FISH), with situ hybridization probes listed in Table S1. The assay was performed according to the instructions of RNASweAMITM RNA FISH Kit (Servicebio, China). Following the sequential steps of deparaffinization, deproteination, prehybridization, and denaturation, the tissue sections were subjected to an overnight incubation in a Cy3-labeled probe solution at a temperature of 37°C. Subsequently, the slides underwent washing with a specific buffer and staining with DAPI prior to mounting for subsequent immunofluorescence imaging.

Measurement of cytokine and chemokine

The levels of cytokines and chemokines in mouse sera were quantified using a Bio Plex Pro Mouse Cytokine Assay Kit (Bio-rad, USA). After being inactivated by ultraviolet irradiation for 10 minutes, the serum samples were subsequently subjected to testing following the manufacturer's instructions using Luminex 200. The following chemokines and cytokines were quantified using the assay: tumor necrosis factor-alpha (TNF-α), KC, IFN-γ, IL-1β, IL-2, IL-4, IL-5, IL-6, IL -10, and IL-12p70.

Statistical analysis

The figures were generated using GraphPad Prism 8 (San Diego, USA), and the statistical analyses were performed using IBM SPSS Statistics 19.0 (Chicago, USA). Statistical significance was set at p < 0.05.

Clinical signs of LCMV infection

The male and female mice infected with the LCMV strain JX14 exhibited weight loss starting from 7 and 3 dpi, respectively, and subsequently regained their original body weight at 18 and 14 dpi, correspondingly (Fig. 1A). During the first 15 dpi, the LCMV-infected mice were observed three times daily in the morning, afternoon, and evening, and the clinical symptoms were recorded every day. At 6 dpi, the subjects exhibited signs of unkempt fur, anorexia, and depression, which subsequently resolved by 10 dpi. Oliguria was observed from one dpi and returned to normal levels at 15 dpi. No mortality was recorded among the mice infected with LCMV.

LCMV viral RNA detection in mice excreta

After LCMV infection, throat and anal swabs were collected every day across the first month to evaluate viral RNA load. LCMV was detected in the anal swabs of both male and female mice at 4 dpi, and lasted up to 8 dpi (Fig. 1B). Meanwhile, viral RNA was also detectable in the throat swabs of the BALB/c mice at 4 dpi, and lasted up to 8 and 10 dpi in female and male mice, respectively (Fig. 1B). The viral RNA load in the swabs various from 10 to 1000 copies/µL, and was slightly higher in male mice than that in female. Moreover, LCMV was successfully isolated from qPCR-positive swabs using Vero cells, and cytopathic effects were observed upon the third passage, which were subsequently confirmed by RT-qPCR (Fig. 1C, 1D).

LCMV RNA load in mice tissues

To investigate the pathogenesis of the virus, male and female BALB/c mice were sacrificed at 3, 5, 7, 10, 15, 30, 90, and 180 dpi, respectively. Subsequently, viral RNA load in mouse tissues was assessed using RT-qPCR. Viral RNA was detected in all major organs, including the heart, liver, spleen, lung, kidney, brain, intestine, and testis of mice (Fig. 2A). Although viremia lasts for 15 days in all the mice, the LCMV RNA was not detectable on 10 dpi in the brain of both the male and female mice, and the brains showed the lowest LCMV RNA levels compared with other organs (Fig. 2B). In contrast to the brains, viral RNA was consistently detectable in the hearts of male mice and in both the hearts and kidneys of female mice throughout the infection, which can persist for up to 6 months (Fig. 2). Overall, the viral RNA levels in all the organs of mice peaked on 3 dpi and gradually declined with the duration of infection ranged from 7 days to 6 months, and the duration and RNA load of LCMV in all organs exhibited prolonged persistence or sustained elevation in male mice compared to female mice (Fig. 2).

Pathological lesions in LCMV-infected mice

The tissue samples were collected from LCMV-infected mice at 5 and 15 dpi for the assessment of pathological lesions. At 5 dpi, pathological lesions were identified in most of the organs except in kidneys and testicles. There were moderate neutrophils infiltrate in the hearts and livers, and scattered neutrophils infiltrate in the spleens, lungs, and intestines (Fig. S1, Table S2). Of these tissues, pathological changes within the spleen were maximal on 5 dpi, and nearly recovered on 15 dpi (Fig. S1, Table S2). The red pulp of the spleens in LCMV-infected mice exhibited a visually reduced lymphocyte cellularity, while a significant elevation in the number of megakaryocytes was observed, suggesting the extramedullary hematopoiesis in spleen induced by LCMV (Fig. 3A). Fluorescence in situ hybridization revealed the widespread distribution of LCMV in the spleens, with a reduction observed on 15 dpi (Fig. 3B).

Cytokine and chemokine induced by LCMV infection

To establish cytokine production induced by LCMV infection in mice, serum samples collected on 3, 5, 7, 10, 15, 20, and 30 dpi were analyzed between control and LCMV infected mice. LCMV infection induced the production of inflammatory cytokines and chemokines, including IFN-γ, IL-5, IL-6, and KC (CXCL1). The expression of IFN-γ, the most upregulated cytokine in LCMV-infected mice, exhibited a significant increase from 3 dpi onwards and reached its peak at 5 dpi. Subsequently, there was a rapid decline observed at 7 dpi in both male and female mice. The level of IL-5, IL-6, and KC was peaked at 5 dpi, and reduced at 7 dpi (Fig. 4). Overall, most of the cytokines produced by LCMV-infected mice did not exhibit significant differences and returned to baseline levels within a short timeframe (within 10 days) (Fig. S2).

The present study aimed to evaluate the potential transmission routes, clinical manifestations, lethality, and viral RNA load in tissues of LCMV strain JX14 isolated from ticks in northeastern China using BALB/c mice. Rodents, as the natural reservoir of LCMV, can shed LCMV via excrement, urine, and saliva [1]. In this study, viral shedding kinetics in anal and throat were detected in all BALB/c mice between 4 and 8 dpi. Notably, the shed virions can proliferate and cause cytopathic effects in Vero cells. These findings suggest that this LCMV strain can be transmitted through mice droppings and saliva during the acute infection phase, potentially contributing to virus transmission among rodents in natural epidemic foci and increasing the risk of human LCMV infection.

To date, over 30 strains of LCMV have been identified in humans and rodents, with the viral strains classified into acute and chronic groups based on their virology and pathogenicity [7]. Of these viral strains, Armstrong 53b and WE isolated from infected patients in the 1930s, are highly pathogenic and can cause acute infection [11, 12]. Strain Clone 13, derived from the Armstrong 53b strain, exhibited a difference of only two amino acids compared to its parental strain. Nevertheless, was considered as the representative chronic strain that can cause persistent infection for up to 90 days [7, 13, 14]. Another LCMV strain (BRC), discovered in Japan, has been found to have low or non-pathogenic effects in mice. This strain demonstrated no clinical signs or lethality in dBa/1 mice and maintained high levels of viral genome load in the lungs of C57BL/6 mice even up to 112 dpi [15]. In this study, although severe symptoms (anorexia, emaciation, and depression) were occurred in the strain JX14 infected mice, no one died, and our viral strain can maintain persistent nonlethal infection in BALB/c mice. High levels of viral RNA can be detected for up to 180 dpi in the hearts of male mice, and in both hearts and kidneys of female mice (Fig. 3). Notably, the viral load in BALB/c mice infected with JX14 was found to be high in the lungs and low in other tissues at 30 dpi, which exhibited a similar tissue tropism as observed for BRC and OQ28 strains but differed from that of Clone13, thereby emphasizing the shared tissue preference between JX14 and Japan strains (BRC and OQ28) [13, 15].

Dysregulation of the immune responses often result in excessive production of pro-inflammatory cytokines, leading to the onset of cytokine storm, which has been confirmed in LCMV infected perforin-deficient (Prf1−/−) mice [16–18]. However, in this study, the tick-derived LCMV did not induce cytokine storm syndrome in BALB/c mice, effectively mitigating the clinical symptoms and thereby promoting long-term establishment of LCMV infection. IFN-γ plays a crucial role in the pathophysiology of LCMV-infected mice, and modulation of IFN-γ expression in mice can effectively ameliorate the disease and significantly extend survival [17, 18]. As the most upregulated cytokine in our mice model, although IFN-γ peaked at 5 dpi, rapidly declined to baseline levels at 10 dpi in both male and female mice. This timepoint is consistent with the resolution of clinical signs and effectively mitigates the severity of LCMV infection in mice, potentially contributing to the establishment of persistent infection.

The LCMV mouse model serves as an indispensable in vivo research tool in the field of immunology, making significant contributions to the comprehension of fundamental principles pertaining to both innate and specific immunity [19, 20]. For instance, the involvement of PD-1 in modulating T-cell responses to persistent viral infections was initially elucidated by employing LCMV infection in mice [21]. In this study, we successfully established a non-lethal mouse model of chronic infection using JX14, thereby providing valuable insights into the fundamental principles underlying both innate and specific immunity elicited during persistent viral infections.

There are certain limitations in this study. Firstly, it has been established by previous studies that the clinical signs, lethality, and virus distribution in mice can be influenced by factors such as mouse strain and route of inoculation. However, in our study, we only used one mouse strain (BALB/c) and administered the virus through one route (intraperitoneal injection), which may potentially introduce bias into the interpretation of our findings. Furthermore, while it has been established that shed virions are capable of replicating in Vero cells, we did not carry out contact or aerosol transmission experiments of LCMV in mice in this study, nor did we compare with mice chronically infected with a mouse-derived LCMV strain. This omission may lead to an incomplete assessment of the transmissibility of the tick-derived viral strain. Lastly, due to the limited visibility of small plaques or foci of infection formed by the tick-derived LCMV strain, we only conducted a plaque assay using a restricted number of swab and tissue samples. In addition, plaque assay is time-consuming, and the increased biosecurity risks associated with prolonged virus operations render it unsuitable for large-scale sample testing. Therefore, in conjunction with the existing studies [15, 22], we employed real-time RT-PCR to quantitatively measure viral genome load, enabling rapid results within a few hours and significantly reducing workload and biosafety risks.

In conclusion, this study provides significant insights into the pathogenic characteristics of tick-derived LCMV strain JX14 identified in China. Although the viral infection was found to be nonlethal in both male and female BALB/c mice, persistent infection was observed in hearts and kidneys for up to six months. Considering that the mouse strain and inoculation route can influence clinical manifestations, virus distribution, and lethality of LCMV infection in mice, further investigation involving experimental infections on other mouse strains is recommended to comprehensively evaluate the pathogenic characteristics of this viral strain.

Acknowledgements

No applicable.

Author contributions

ZW and FW conceived the study. ZL, LX, and LL performed analysis. NL provided assistance in data analysis. ZW and ZL wrote the manuscript. ZW and FW revised the manuscript. All authors read and approved the final manuscript.

Funding

This study was supported by the National Natural Science Foundation of China (32072887 and 82272327), the National Key Research and Development Program of China (2022YFC2601900), and the Bethune Project of Jilin University (2022B01). The funders had no role in study design, data collection and analysis, publication decisions, or manuscript preparation.

Data availability statement

The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/Supplementary material.

Ethics statement

The animal study was approved by the Animal Administration and Ethics Committee of Changchun Veterinary Research Institute of the Chinese Academy of Agricultural Sciences (Approval number: IACUC of AMMS -11-2020-026). The BALB/c mice were treated in accordance with the Animal Ethics Procedures and Guidelines of the People's Republic of China, ensuring humane handling throughout all procedures.

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Publisher's note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Laposova K, Pastorekova S, Tomaskova J: Lymphocytic choriomeningitis virus: invisible but not innocent. Acta Virol 2013, 57(2):160-170.
Bonthius DJ: Lymphocytic choriomeningitis virus: an underrecognized cause of neurologic disease in the fetus, child, and adult. Semin Pediatr Neurol 2012, 19(3):89-95.
Pencole L, Sibiude J, Weingertner AS, Mandelbrot L, Vauloup-Fellous C, Picone O: Congenital lymphocytic choriomeningitis virus: A review. Prenat Diagn 2022, 42(8):1059-1069.
Ferenc T, Vujica M, Mrzljak A, Vilibic-Cavlek T: Lymphocytic choriomeningitis virus: An under-recognized congenital teratogen. World J Clin Cases 2022, 10(25):8922-8931.
Delaine M, Weingertner AS, Nougairede A, Lepiller Q, Fafi-Kremer S, Favre R, Charrel R: Microcephaly Caused by Lymphocytic Choriomeningitis Virus. Emerg Infect Dis 2017, 23(9):1548-1550.
Ansari N, Demmler-Harrison G, Coats DK, Paysse EA: Severe congenital chorioretinitis caused by congenital lymphocytic choriomeningitis virus infection. Am J Ophthalmol Case Rep 2021, 22:101094.
Vilibic-Cavlek T, Savic V, Ferenc T, Mrzljak A, Barbic L, Bogdanic M, Stevanovic V, Tabain I, Ferencak I, Zidovec-Lepej S: Lymphocytic Choriomeningitis-Emerging Trends of a Neglected Virus: A Narrative Review. Trop Med Infect Dis 2021, 6(2).
Liu Z, Li L, Wang D, Zhang L, Liang X, Wang Z, Wei F: Molecular detection and phylogenetic analysis of lymphocytic choriomeningitis virus in ticks in Jilin Province, northeastern China. J Vet Med Sci 2023, 85(3):393-398.
Zhang L, Li S, Huang SJ, Wang ZD, Wei F, Feng XM, Jiang DX, Liu Q: Isolation and genomic characterization of lymphocytic choriomeningitis virus in ticks from northeastern China. Transbound Emerg Dis 2018, 65(6):1733-1739.
Hladkii AP: [Study of the strain of lymphocytic choriomeningitis virus isolated from IX. ricinus ticks gathered in the western regions of the Ukrainian SSR]. Mikrobiol Zh 1965, 27(1):10-15.
Rivers TM, McNair Scott TF: Meningitis in Man Caused by a Filterable Virus. Science 1935, 81(2105):439-440.
Armstrong AR, King EJ, Harris RI: Phosphatase in Obstructive Jaundice. Can Med Assoc J 1934, 31(1):14-20.
Blackburn SD, Crawford A, Shin H, Polley A, Freeman GJ, Wherry EJ: Tissue-specific differences in PD-1 and PD-L1 expression during chronic viral infection: implications for CD8 T-cell exhaustion. J Virol 2010, 84(4):2078-2089.
Oldstone MBA, Ware BC, Horton LE, Welch MJ, Aiolfi R, Zarpellon A, Ruggeri ZM, Sullivan BM: Lymphocytic choriomeningitis virus Clone 13 infection causes either persistence or acute death dependent on IFN-1, cytotoxic T lymphocytes (CTLs), and host genetics. Proc Natl Acad Sci U S A 2018, 115(33):E7814-E7823.
Takagi T, Ohsawa M, Yamanaka H, Matsuda N, Sato H, Ohsawa K: Difference of two new LCMV strains in lethality and viral genome load in tissues. Exp Anim 2017, 66(3):199-208.
Albeituni S, Oak N, Tillman HS, Stroh A, Keenan C, Bloom M, Nichols KE: Cellular and transcriptional impacts of Janus kinase and/or IFN-gamma inhibition in a mouse model of primary hemophagocytic lymphohistiocytosis. Front Immunol 2023, 14:1137037.
Binder D, van den Broek MF, Kagi D, Bluethmann H, Fehr J, Hengartner H, Zinkernagel RM: Aplastic anemia rescued by exhaustion of cytokine-secreting CD8+ T cells in persistent infection with lymphocytic choriomeningitis virus. J Exp Med 1998, 187(11):1903-1920.
Jordan MB, Hildeman D, Kappler J, Marrack P: An animal model of hemophagocytic lymphohistiocytosis (HLH): CD8+ T cells and interferon gamma are essential for the disorder. Blood 2004, 104(3):735-743.
Zhou X, Ramachandran S, Mann M, Popkin DL: Role of lymphocytic choriomeningitis virus (LCMV) in understanding viral immunology: past, present and future. Viruses 2012, 4(11):2650-2669.
Abdel-Hakeem MS: Viruses Teaching Immunology: Role of LCMV Model and Human Viral Infections in Immunological Discoveries. Viruses 2019, 11(2).
Barber DL, Wherry EJ, Masopust D, Zhu B, Allison JP, Sharpe AH, Freeman GJ, Ahmed R: Restoring function in exhausted CD8 T cells during chronic viral infection. Nature 2006, 439(7077):682-687.
Tipih T, Meade-White K, Rao D, Bushmaker T, Lewis M, Shaia C, Feldmann H, Hawman DW: Favipiravir and Ribavirin protect immunocompetent mice from lethal CCHFV infection. Antiviral Res 2023, 218:105703.

No competing interests reported.

Supplementarymaterial.docx

Download PDF

Editorial decision: Revision requested
02 Sep, 2024
Reviews received at journal
31 Aug, 2024
Reviewers agreed at journal
14 Aug, 2024
Reviews received at journal
14 Aug, 2024
Reviewers agreed at journal
02 Aug, 2024
Reviewers invited by journal
01 Aug, 2024
Editor invited by journal
01 Aug, 2024
Editor assigned by journal
01 Aug, 2024
Submission checks completed at journal
01 Aug, 2024
First submitted to journal
31 Jul, 2024

You are reading this latest preprint version

Pathogenicity of tick-derived lymphocytic choriomeningitis virus in BALB/c mice

Status:

Version 1

Abstract

Figures

Introduction

Materials and methods

Virus and animals

Animal infection and sample collection

Virus isolation

RNA extraction and RT-qPCR detection

Pathological examinations and fluorescence in situ hybridization

Measurement of cytokine and chemokine

Statistical analysis

Results

Clinical signs of LCMV infection

LCMV viral RNA detection in mice excreta

LCMV RNA load in mice tissues

Pathological lesions in LCMV-infected mice

Cytokine and chemokine induced by LCMV infection

Discussion

Declarations

Acknowledgements

Author contributions

Funding

Data availability statement

Conflict of interest

References

Additional Declarations

Supplementary Files

Status:

Version 1