FOXA2 modulates the proliferation and metastasis of esophageal squamous cell carcinoma by suppressing proteasome activity

doi:10.21203/rs.3.rs-4834108/v1

Download PDF

Research Article

FOXA2 modulates the proliferation and metastasis of esophageal squamous cell carcinoma by suppressing proteasome activity

https://doi.org/10.21203/rs.3.rs-4834108/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Background

Esophageal squamous cell carcinoma (ESCC) represents a highly lethal malignancy. The FOXA2 was involved in cellular proliferation, differentiation, tumorigenesis, and metastasis. The precise regulatory mechanisms of FOXA2 in ESCC progression remain unclear.

Materials and methods

Western blotting, reverse transcription-quantitative polymerase chain reaction, and immunohistochemistry were used to detect the expression level of FOXA2, CCK-8, transwell, and wound healing assays in vitro and xenograft tumor model in vivo were applied to assess the function of FOXA2. RNA-Seq analysis and the following functional assays were used to elucidate the relationship between FOXA2 and proteasome activity.

Results

The expression level of FOXA2 was downregulated in ECSS tissues and cells. Overexpression of FOXA2 in ESCC cells inhibited epithelial-mesenchymal transition in ESCC cells with the upregulation of E-cadherin and downregulation of Vimentin. Meanwhile, overexpression of FOXA2 inhibited the proliferation, migration, and invasion of ESCC cells. Mechanically, proteasome was involved in the ESCC cells proliferation and invasion inhibition induced by FOXA2, and reduced proteasome activity inhibited ESCC cells proliferation and invasion.

Conclusion

FOXA2 inhibited the proliferation and invasion of ESCC cells by regulating proteasome activity. FOXA2 plays a critical role in ESCC progression and may act as a potential candidate target for ESCC treatment.

esophageal squamous cell carcinomas

FOXA2

EMT

proteasome

tumor invasion

tumor migration

Esophageal squamous cell carcinoma (ESCC) emerges as one of the predominant malignancies within the gastrointestinal tract, confronting worldwide healthcare systems. According to the 2020 statistics, esophageal cancer accounted for approximately 604,000 new cases, positioning it as the seventh most prevalent cancer globally, and leading to around 544,000 deaths, marking it as the sixth leading cause of cancer-related mortality [1]. Notably, in China, ESCC constitutes around 90% of all esophageal cancer cases [2]. Despite advances in therapeutic strategies, which principally rely on surgery and radiotherapy, the treatment outcomes for esophageal cancer remain largely unsatisfactory [3]. Advanced stages of ESCC are characterized by rapid progression, with a meager 5-year survival rate hovering around 25% [4].

The Forkhead box A2 (FOXA2), a pivotal member of the forkhead box (FOX) gene family, plays a critical role in regulating gene expression [[5]. FOXA family members are known to modulate target gene expression by displacing histones in chromatin and functioning as transcription factors within promoter-enhancer regions [6]. The FOXA2 gene is nestled on the short arm of chromosome 20, and its protein product encompasses evolutionarily conserved winged helical DNA binding domains, nuclear localization signals, and dual transactivation domains [7]. These structural features empower FOXA2 to bind to DNA sequences in the promoter regions of target genes, thereby regulating a spectrum of biological processes, including embryonic development, cell proliferation, differentiation, and growth [8]. Accumulating evidence has implicated the involvement of FOXA2 in various human malignancies such as hepatocellular carcinoma, endometrial carcinoma, gallbladder cancer, glioma, thyroid cancer, pancreatic cancer, and lung cancer [9–15], with its downregulation being associated with cancer development [16]. Moreover, the proteasome, which is an intricate protease complex [17], underpins protein degradation within the cytoplasm and nucleus [18]. Dysfunctions in proteasome-mediated degradation pathways have been linked to diverse pathological conditions, including cancer and neurodegenerative disorders [19].

The distinct regulatory functions of FOXA2 in tumorigenesis differ inherently across genders and cancer subtypes, acting as either oncogenes or tumor suppressor genes [20]. Despite these advancements, the specific expression patterns and functional roles of FOXA2 in the context of ESCC remain to be elucidated. Therefore, this study aims to delve into the function of FOXA2 within ESCC and unravel its mechanism influencing the pathophysiology of ESCC.

Tissue specimen collection and preservation: This study was approved by the Ethics Committee of the Naval Medical University. The esophageal cancer samples from 56 ESCC patients at the First Affiliated Hospital of Naval Medical University from June to December 2023was collected. All patients underwent radical esophageal cancer surgery without prior radiotherapy or chemotherapy. Tumor tissues and adjacent tissues were collected, one part was stored in liquid nitrogen for RNA and protein extraction, while the other was fixed in 4% paraformaldehyde for 48 hours at room temperature.

Cell culture and passaging: Two ESCC cell lines (Eca-109, TE-1) and esophageal epithelial cells (HET-1A) were obtained from the Shanghai Institute of Biochemistry and Cell Biology (Shanghai, China). ESCC cells were cultured in a medium containing 10% fetal bovine serum (Gibico, USA), 100 U/ml penicillin, and 100 µg/ml streptomycin in a 5% CO₂ incubator at 37°C. Lentiviral infection was carried out by incubating the cells with lentivirus in a medium containing 10% fetal bovine serum (Gibico, USA), 100 U/ml penicillin, and 100 µg/ml streptomycin.

Lentivirus Vector Construction and Stable Transfection: The overexpression and control lentiviral were procured from HeYuan Biotechnology Co. (Shanghai). Following stable transfection was confirmed by treatment with 2 µg/ml puromycin (Abcam, USA) and assessed by BD FACSCanto II (USA).

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR): Total RNA was extracted from either 100 mg tissue or 1×10⁶ cells using Trizol reagent (Invitrogen). Subsequently, first-strand complementary DNA (cDNA) was synthesized by the PrimeScript RT kit (TaKaRa, Japan), and the subsequent PCR procedure was under the guidance of the PCR instrument (Roche, Switzerland) by TB Green (TaKaRa, Japan). Relative expression levels of target genes were calculated by 2^−△△ct methods. The corresponding primers are listed in Table 1.

Table 1

Primer sequence
Primer	Sequence
Vimentin-Forward	CCTGCAATCTTTCAGACAGG
Vimentin-Reverse	CTCCTGGATTTCCTCTTCGT
E-cadherin- Forward	CGACAAAGGACAGCCTATTT
E-cadherin- Reverse	AGTTGGGAAATGTGAGCAAT
β-actin- Forward	GCTCGTCGTCGACAACGGCT
β-actin- Reverse	CAAACATGATCTGGGTCATCTTCTC
FOXA2- Forward	GGGAGCGGTGAAGATGGA
FOXA2- Reverse	TCATGTTGCTCACGGAGGAGTA

Western blotting: A mixture of SDS and PMSF (phenylmethylsulfonyl fluoride) was added in a 200 µl solution at a ratio of 100:1 to extract total proteins from either 100 mg of tissue or 1 × 10⁶ cells. Protein concentrations were measured and adjusted using a BCA kit (Beyotime, Shanghai). Following electrophoresis and transfer onto a PVDF membrane through electroblotting, the membrane was incubated in 5% defatted milk for 1 hour at room temperature. Subsequently, the membrane was incubated with primary antibody (anti-FOXA2, 1:1000, 22474-1-AP, Proteintech; anti-β-actin, 1:3000, AB2839420, Affinity; anti-E-cadherin, 1:1000, AB2833315, Affinity; anti-Vimentin, 1:1000, AB2835318, Affinity; anti- Proteasome beta 8, 1:500, HY-P80876, MCE; anti-GAPDH, 1:3000, AB2833041, Affinity) overnight at 4°C with gentle shaking, and then incubated with corresponding secondary antibody for 1 hour before expose. The normalized expression levels of targeted proteins were compared and subjected to grey-value analysis using Image-Pro Plus 6.0 software.

Transwell assay: ESCC cells were preprocessed with a 12-hour starvation period, followed by digestion, counting, and seeding at approximately 50,000 cells in 200 µl of fetal bovine serum-free medium in the upper chamber, and 600 µl of DMEM medium containing 15% fetal bovine serum in the lower chamber. After 24 hours of incubation, the cells were fixed with 4% formaldehyde for 30 minutes and stained with 0.1% crystal violet. Subsequently, images of migrating or invading cells were captured under a microscope.

Wound healing assay: Scratches were created using the tip of a sterilized 200 µl pipette when the cells in the 6-well plate reached 80% confluence. The area where the horizontal and vertical scratches intersected was marked to ensure observation consistency. These marked scratches were regularly monitored, and photographed, and their width measured under a microscope to validate the results.

Immunohistochemistry: Tumor tissues were fixed in 4% formaldehyde for 48 hours at room temperature, and then paraffin-embedded, followed by sectioned with a thickness of 5 µm. The antigen retrieval procedure was conducted in heated citrate buffer (Biotronik) for 30 minutes after deparaffinization and rehydration. Then, endogenous peroxidase and nonspecific antigen retrieval were conducted under the guidance. Corresponding primary antibody incubation was carried out overnight at 4°C, followed by secondary antibody incubation and diaminobenzidine (DAB) staining (Dako, Carpinteria, CA, USA) to visualize specific markers. The nucleus was counterstained with hematoxylin for 20 seconds. Images were then observed and captured under a microscope.

CCK‑8 assay: ESCC cells were seeded into 96-well plates, with each well containing approximately 2000 cells. The plates were then incubated at 37°C with 5% CO₂ for 24, 48, 72, and 96 hours. Before each measurement, ESCCs cells in each well were treated with 10 µl of CCK-8 reagent and incubated for 2 hours. The absorbance at 450 nm was subsequently measured. Five replicate wells were processed simultaneously.

Xenograft tumor model: Five-week-old nude mice were randomly assigned to experimental and control groups based on gender. The experimental group received injections of Lenti-FOXA2 ESCC cells, while the control group received injections of Lenti-GFP ESCC cells, with each injection consisting of 5×10⁶ cells in 150 µl volume into the right axilla. Tumor growth was monitored starting at 200–250 mm³ and stopping at 1000–1200 mm³. At last, the nude mice were euthanized, and tumors were harvested. Tumor volume was calculated using the formula: Volume = (longest diameter×shortest diameter²)/2.

Proteasome activity assay: Proteasome activity was assessed under the guidance of the Proteasome Activity Assay Kit (Abcam, ab107921). The change in relative fluorescence units (ΔRFU) was calculated as (RFU2-iRFU2)-(RFU1-iRFU1). By applying the ΔRFU to the AMC standard curve, the proteasome activity was determined as the proteasome activity unit = ((B/[(T₂ - T₁) × V])) × D.

RNA-Seq: The RNA-seq analysis was conducted on three replicate samples from ECA109 Lenti-FOXA2/Lenti-GFP. Total RNA was extracted using Trizol reagent and stored at -80°C for RNA-seq library construction and subsequent analysis. Differentially expressed genes (DEGs) were identified using the DESeq2 package in R language, with significance determined at a P-value < 0.05 and a fold change of ≥ 1.50-fold or ≤ 0.67-fold. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis was carried out using the cluster Profiler package in R language. The RNA sequencing data was deposited in the Gene Expression Omnibus (GEO) database for public access. Additionally, gene set enrichment analysis was performed utilizing GSEA software to further investigate the biological implications of the identified DEGs.

Statistical analysis: The statistical analysis and graphing were conducted using SPSS 28 software and Prism 9 GraphPad software. Clinical characteristics were assessed using a chi-squared test, Fisher's exact test, or a two-tailed t-test appropriately. Three independent experiments were analyzed using analysis of variance (ANOVA). A P-value of less than 0.05 was considered statistically significant.

The expression of FOXA2 in both ESCC cells and tissues was downregulated

As shown in Fig. 1, compared to non-cancerous esophageal epithelial cells (HET-1A), the expression level of FOXA2 was lower in ESCC cells (ECA109), which was identified by RT-qPCR and Western blotting (Fig. 1A-C). Furthermore, the expression level of FOXA2 in ESCC tissues and paracancerous tissues was analyzed by RT-qPCR and Western blotting. The expression level of FOXA2 was reduced in the cancerous tissues compared to the paracancerous tissues (Fig. 1D-F). The results of immunohistochemistry were similar to that of Western blotting as shown in Fig. 1G. Additionally, the low expression level of FOXA2 was associated with the tumor size (Table 2). A negative correlation was also found between the low expression of FOXA2 and the level of squamous cell carcinoma antigen (SCC-Ag).

Table 2

Clinicopathological correlation of FOXA2 expression in ESCC.
Clinicopathologic characteristics	Cases (n = 56)	FOXA2 expression		P-value
		Low (n = 26)	High (n = 30)
Age (years)				0.854
< 60	6	3	3
≥ 60	50	26	30
Gender				0.075
Male	41	22	19
Female	15	4	11
Tumor diameter				< 0.001
< 4cm	35	8	27
≥ 4cm	21	18	3
Differentiation				0.130
Low	22	13	91
Mid and high	34	13	21
Lesion location				0.190
Upper/middle	27	15	12
Lower	29	11	18
Clinical stage				0.009
I–II	30	9	21
III–IV	26	17	9
T stage				< 0.001
t1-t2	24	41	20
t3-t4	32	22	10
N stage				0.004
n0	31	9	22
n1-n3	25	17	8
CEA(ng/ml)				0.972
< 5	47	23	24
≥ 5	9	3	6
SCC-Ag(ng/ml)				0.362
< 1.5	39	15	24
≥ 1.5	17	11	6
P < 0.05, P < 0.01, **P < 0.001.
The correlation analysis between FOXA2 and the clincial pathological characteristics in 56 ESCC samples.
Statistical significance (P < 0.05) is shown in bold.

Overexpression of FOXA2 inhibited epithelial-mesenchymal transition in ESCC cells

To delve deeper into the effect of FOXA2 on cellular phenotypes in ESCC cells, lentivirus vector was constructed to ensure continuous overexpression in the ECA109 and TE1 cell lines (Fig. 2A-D). The cell morphology transformed from a spindle to a polygonal structure in the Lenti-FOXA2 group compared to those treated with Lenti-GFP (Fig. 2E), indicating a potential suppression of cellular migration and penetration abilities. Moreover, the expression level of E-cadherin in the Lenti-FOXA2 group was significantly upregulated when compared to the control group in both ECA109 and TE1 cell lines. On the contrary, the expression level of Vimentin was significantly downregulated in the Lenti-FOXA2 group, which was identified by Western blotting analyses (Fig. 2F-I). The aforementioned results suggest that the upregulation of FOXA2 expression could inhibit epithelial-mesenchymal transition (EMT) in ESCC cells.

Overexpression of FOXA2 inhibited the proliferation and invasion of ESCC cell lines

To further elucidate the functional effects of FOXA2 on ESCC cell lines, we examined its effects on cellular proliferation and invasion. Figure 3A, B revealed the result of overexpression of FOXA2 on cell growth by CCK-8 assay in the ECA109 and TE1 cell lines. Compared to the Lenti-GFP group, the cell viability was significantly suppressed in the Lenti-FOXA2 group in both ECA109 and TE1 cell lines (Fig. 3A, B). Additionally, the invasive and migratory capacities of these cells were evaluated via transwell and wound-healing assays. Figure 3C-H showed a significant reduction in both invasion and migration in ESCC cells transduced with Lenti-FOXA2 when compared to those transduced with Lenti-GFP. To validate these in vitro findings, an in vivo tumor model was established. Tumor sizes were measured by volumes recorded throughout the experimental period periodically, and tumors in the Lenti-FOXA2 group grew more slowly than those in the Lenti-GFP group (Fig. 3I). At the end of the in vivo study, mice were euthanized, and tumor tissue harvested from the Lenti-FOXA2 group was notably smaller than those from the control group (Fig. 3J, K). Immunohistochemical analyses of the tumor tissues corroborated the enhanced expression of FOXA2 in the Lenti-FOXA2 group (Fig. 3L). Collectively, these in vivo and in vitro studies confirmed that the overexpression of FOXA2 significantly hampers the proliferation and invasion of ECA109 and TE1 ESCC cell lines, underscoring its potential role as a modulatory agent in the pathobiology of ESCC.

The proteasome is involved in the ESCC cells proliferation and invasion inhibition induced by FOXA2

To elucidate the mechanisms underlying the ESCC cells proliferation and invasion inhibition induced by FOXA2, we conducted RNA-Seq analysis on ECA109 cells treated with either Lenti-FOXA2 or Lenti-GFP. A total of 2,740 DEGs were screened in the analysis set (Fig. 4A, B). The functional annotations and pathway analyses were further explored, and the proteasome pathway was proved to be involved (Fig. 4C-E). Subsequent evaluation of proteasome activity within HET-1A, Lenti-FOXA2, and Lenti-GFP groups revealed a marked decrease in proteasome activity in the Lenti-FOXA2 group compared to both the Lenti-GFP and HET-1A groups (Fig. 4F, G). The expression level of beta 8, which was a marker of proteasome, was higher in carcinoma tissues than that of para-carcinoma tissues (Fig. 4H, I). The consistent results were also demonstrated by immunohistochemical staining as shown in Fig. 4J. Furthermore, the immunohistochemical staining results showed that the beta8 expression level in the Lenti-FOXA2 group was lower than that in the Lenti-GFP group in the nude mice cancer model (Fig. 4K). Collectively, these data suggest that FOXA2 overexpression may impede ESCC progression by inhibiting the proteasome activity.

Reduced Proteasome activity inhibits ESCC cells proliferation and invasion.

To investigate the impact of diminished proteasome activity on ESCC cells behaviors, we employed MG132 (benzyloxy-L-leucyl-L-leucyl-L-leucine), a proteasome inhibitor of natural origin extracted from Chinese medicinal plants, in our studies. The optimal inhibition concentration of MG132 in ECA109 cells was achieved by treating with 20µg/ml for 12 hours, as determined by proteasome activity assays (Fig. 5A). To further validate the effect of reduced proteasome activity on ESCC cells proliferation and invasion capabilities, CCK-8 assay, wound healing, and transwell assay were conduct. As shown in Fig. 5B, the cell proliferation in the MG132 + Lenti-GFP group was significantly lower than that of the Lenti-GFP group. Additionally, both the Lenti-FOXA2 and MG132 + Lenti-GFP groups exhibited decreased invasion and migration abilities compared to the Lenti-GFP group (Fig. 5C-F). The aforementioned data were corroborated by an in vivo tumor model in nude mice (Fig. 5G-I). To sum up, reduced proteasome activity led to inhibited proliferation and invasion of ESCC cells.

In the present study, we explored the role of FOXA2 in ESCC and delineated its mechanisms by regulating proteasome activity. FOXA2 expression level was reduced in ESCC tissues, on the contrary, the proteasome activity in clinical samples was increased. This investigation reveals the novel role of FOXA2 as a suppressor of proteasome activity, thereby shedding light on a potential molecular mechanism, by which FOXA2 may restrain ESCC cells proliferation and invasion.

EMT is a process through which epithelial cells acquire mesenchymal characteristics. In cancer, EMT is associated with tumorigenesis, invasion, metastasis, and therapy resistance [21]. This process involves the loss of epithelial markers (E-cadherin) and an increase in mesenchymal markers (Vimentin) [22]. In this study, we found that FOXA2 overexpression stimulates the expression of E-cadherin and inhibits the expression of Vimentin in ESCC cells, indicating that FOXA2 overexpression inhibits EMT in ESCC cells. Furthermore, our findings also suggest that the proteasome function was regulated by FOXA2.

The dysregulation of the ubiquitin-proteasome system is implicated in numerous diseases, including cancer [23]. Cancer cells often depend on elevated proteasome levels [24], and proteasome inhibitors such as bortezomib and carfilzomib, which are FDA-approved, have been employed in treating certain cancers [25]. This study highlights the significance of FOXA2 overexpression in inhibiting proteasome activity during the development of ESCC and elucidates potential molecular mechanisms by which FOXA2 regulates ESCC cells proliferation and invasion. In summary, we revealed that FOXA2 inhibited the proliferation and invasion of ESCC cells by regulating proteasome activity. FOXA2 plays a critical role in ESCC progression and may act as a potential candidate target for ESCC treatment. However, the function and mechanism of FOXA2 and proteasome activity in ESCC remains to be fully elucidated.

Acknowledgements

Not applicable.

Funding

This work is supported by Natural Science Foundation of Shanghai(20ZR1456200), the “234 Discipline Climbing Plan” of the First Affiliated Hospital of Naval Medical University (2020YXK054).

Conflicts of interest

The authors declared no conflicts of interest.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

WX, NL and BS collected, analyzed, interpreted the data and provided the majority of statistical analysis as well as provided the figures and tables for the manuscript as well as were major contributors in writing the manuscript. XL,CG and HL collected data. HZ oversaw the analysis of the dataset, provided guidance in creating the dataset and manuscript, and were major contributors in writing the manuscript. All authors have read and approved the manuscript in its current state.

Ethics approval and consent to participate

The present study was approved by the Ethics Committee of the First Affiliated Hospital of Naval Medical University. Written informed consent was obtained from all patients.

Competing interests

The authors declare that they have no competing interests.

Sung H, Ferlay J, Siegel RL, et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin. 2021;71(3):209-249.
Smyth EC, Lagergren J, Fitzgerald RC, et al. Oesophageal cancer[J]. Nat Rev Dis Primers, 2017, 3:17048。
ZHANG Y L, CHEN P, GUO Y,et al., Clinical value of SIRT1 as a prognostic biomarker in esophageal squamous cell carcinoma, a systematic meta-analysis. Open Med. (Wars.),2022, 17(1)：527-535.
Yang H, Liu H, Chen Y, et al. Long-term Efficacy of Neoadjuvant Chemoradiotherapy Plus Surgery for the Treatment of Locally Advanced Esophageal Squamous Cell Carcinoma: The NEOCRTEC5010 Randomized Clinical Trial [published correction appears in JAMA Surg. 2022 Sep 1;157(9):859]. JAMA Surg. 2021;156(8):721-729.
Katoh M, Katoh M. Human FOX gene family (Review). Int J Oncol. 2004;25(5):1495-1500.
Weigel D, Jäckle H. The fork head domain: a novel DNA binding motif of eukaryotic transcription factors?Cell, 1990, 63 (3): 455~456
Tabassum R, Chavali S, Dwivedi OP, Tandon N, Bharadwaj D. Genetic variants of FOXA2: risk of type 2 diabetes and effect on metabolic traits in North Indians. J Hum Genet. 2008;53(11-12):957-965.
Liu N, Wang A, Xue M, Zhu X, Liu Y, Chen M. FOXA1 and FOXA2: the regulatory mechanisms and therapeutic implications in cancer. Cell Death Discov. 2024;10(1):172. Published 2024 Apr 11.
Huang H, Wang Y, Huang T, et al. FOXA2 inhibits doxorubicin-induced apoptosis via transcriptionally activating HBP rate-limiting enzyme GFPT1 in HCC cells. J Physiol Biochem. 2021;77(4):625-638.
Sahoo SS, Ramanand SG, Gao Y, et al. FOXA2 suppresses endometrial carcinogenesis and epithelial-mesenchymal transition by regulating enhancer activity. J Clin Invest. 2022;132(12):e157574.
Hong L, Chen M, Huang M, et al. FOXA2 suppresses gallbladder carcinoma cell migration, invasion,and epithelial-mesenchymal transition by targeting SERPINB5. Environ Toxicol. Published online September 4, 2023.
Ding B, Liang H, Gao M, et al. Forkhead Box A2 (FOXA2) Inhibits Invasion and Tumorigenesis in Glioma Cells. Oncol Res. 2017;25(5):701-708.
He Y, Chen W, Yu L, et al. FOXA2 suppresses PKM2 transcription and affects the Wnt/β-catenin activity to block aerobic glycolysis in thyroid carcinoma. Clin Exp Pharmacol Physiol. 2023;50(7):561-572.
Vorvis C, Hatziapostolou M, Mahurkar-Joshi S, et al. Transcriptomic and CRISPR/Cas9 technologies reveal FOXA2 as a tumor suppressor gene in pancreatic cancer. Am J Physiol Gastrointest Liver Physiol. 2016;310(11):G1124-G1137.
Tang Y, Shu G, Yuan X, Jing N, Song J. FOXA2 functions as a suppressor of tumor metastasis by inhibition of epithelial-to-mesenchymal transition in human lung cancers. Cell Res. 2011;21(2):316-326.
S.S. Myatt, E.W. Lam, The emerging roles of forkhead box (Fox) proteins in cancer, Nat. Rev. Cancer 7 (2007) 847–859.
Saeki Y, Tanaka K. Assembly and function of the proteasome. Methods Mol Biol. 2012;832:315-337.
Bard JAM, Goodall EA, Greene ER, Jonsson E, Dong KC, Martin A. Structure and Function of the 26S Proteasome. Annu Rev Biochem. 2018 Jun 20;87:697-724.
Rousseau A, Bertolotti A. Regulation of proteasome assembly and activity in health and disease. Nat Rev Mol Cell Biol. 2018;19(11):697-712.
Liu N, Wang A, Xue M, Zhu X, Liu Y, Chen M. FOXA1 and FOXA2: the regulatory mechanisms and therapeutic implications in cancer. Cell Death Discov. 2024;10(1):172.
Pastushenko I, Blanpain C. EMT Transition States during Tumor Progression and Metastasis. Trends Cell Biol. 2019;29(3):212-226.
Paolillo M, Schinelli S. Extracellular Matrix Alterations in Metastatic Processes. Int J Mol Sci. 2019;20(19):4947. Published 2019 Oct 7.
Park J, Cho J, Song EJ. Ubiquitin-proteasome system (UPS) as a target for anticancer treatment. Arch Pharm Res. 2020;43(11):1144-1161.
Rousseau A, Bertolotti A. Regulation of proteasome assembly and activity in health and disease. Nat Rev Mol Cell Biol. 2018;19(11):697-712.
Fricker LD. Proteasome Inhibitor Drugs. Annu Rev Pharmacol Toxicol. 2020;60:457-476.

No competing interests reported.

supplementaryfilefulluncroppedGelsandBlotsimages.zip

Download PDF

Reviewers invited by journal
04 Sep, 2024
Editor assigned by journal
23 Aug, 2024
Submission checks completed at journal
01 Aug, 2024
First submitted to journal
31 Jul, 2024

You are reading this latest preprint version

FOXA2 modulates the proliferation and metastasis of esophageal squamous cell carcinoma by suppressing proteasome activity

Status:

Version 1

Abstract

Background

Materials and methods

Results

Conclusion

Figures

Introduction

Materials and methods

Results

Discussion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1