Impact of Asymptomatic Bacterial Genital Tract Infections on the Implantation Success in Women Undergoing Intracytoplasmic Sperm Injection (ICSI)

doi:10.21203/rs.3.rs-4848209/v1

Download PDF

Research Article

Impact of Asymptomatic Bacterial Genital Tract Infections on the Implantation Success in Women Undergoing Intracytoplasmic Sperm Injection (ICSI)

https://doi.org/10.21203/rs.3.rs-4848209/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Background

Assisted reproduction techniques (ART), such as intracytoplasmic sperm injection (ICSI), have gained widespread use globally. Given the expenses associated with these procedures, physicians are continuously working to enhance pregnancy rates and increase the chances of successful outcomes for patients. However, genital infections pose a significant challenge in this field. Infections can disrupt the reproductive process and negatively impact the success of ART. The aim of the present study was to evaluate the impact of bacterial genital tract infections on the implantation success in asymptomatic women undergoing ICSI through identifying the bacterial genital microorganisms at the time of the embryo transfer and investigating whether the presence of these genital microorganisms alters the outcome of ICSI.

Methods

A total of 220 infertile women aged from 23 to 38 years at the time of the embryo transfer during IVF- ICSI were enrolled in the study. They had no clinical symptoms suggestive of vaginitis or cervicitis. Both vaginal and endocervical swabs were collected from each participant. Standard bacteriological culture methods were employed to detect and identify potential genital pathogens. Real-time PCR was used to specifically detect and identify Ureaplasma urealyticum and Mycoplasma hominis in the collected samples. Two weeks after the embryo transfer, a pregnancy test was conducted to identify the ICSI outcome.

Results

The infection rate was lower in the ICSI positive group (82.1%) compared to the ICSI negative group (90.7%), but this difference was not statistically significant. The Lactobacilli spp. was more prevalent in the ICSI positive group (43.3%) than the ICSI negative group (37.2%). The most prevalent pathogenic bacterial organisms were M. hominis, U. urealyticum, Klebsiella, Enterococci spp and E coli. Three organisms were associated with the least ICSI success rates (Enterococci spp. and/or M. hominis and/or U. urealyticum). Infection with Enterococci spp. and/or U. urealyticum was significantly associated with 2.79 times the likelihood of ICSI failure in non-infected participants, also combined infection with Enterococci spp. and/or M. hominis and/or U. urealyticum showed 2.6 times higher risk of ICSI failure.

Conclusion

The results demonstrated the association of definite bacterial pathogens with reduced levels of vaginal lactobacilli. The presence of E. faecalis and/or U. urealyticum and/or M. hominis in genital samples of infertile women was predictive for a negative outcome of ICSI.

Infertility is a global issue that impacts a significant number of individuals, both men and women. Roughly 186 million couples, which accounts for approximately 8–12% of all couples, experience the challenges of infertility on a global scale. (1) The clinical definition of infertility, widely adopted by the World Health Organization and the International Classification of Diseases, describes it as a reproductive system disorder characterized by the inability to achieve a clinical pregnancy despite engaging in regular unprotected sexual intercourse for a duration of 12 months or longer. (2) Recognizing the extent of infertility is crucial for the development of suitable interventions, monitoring the availability of high-quality fertility care, and addressing the risk factors and consequences associated with infertility.

Assisted reproductive techniques (ARTs) have become the cornerstone of modern infertility management. They have been proven to be useful in overcoming challenges such as blocked or damaged fallopian tubes, endometriosis, repeated failures of intrauterine insemination, unexplained infertility, poor ovarian reserve, as well as poor or absent sperm count. Intracytoplasmic sperm injection (ICSI) is a widely utilized ART technique. It involves the direct injection of a single sperm into the egg, then transferring the resulting embryo into the uterus bypassing any limitations posed by the quality or quantity of sperm. (3) This technique has revolutionized the management of male factor infertility, offering hope to couples facing challenges related to sperm abnormalities and increasing the chances of successful fertilization and subsequent embryo development. (4)

Implantation failure (IF) can have various underlying causes, including factors related to the embryo, the endometrium, or both. Embryo-related factors may include chromosomal abnormalities, genetic defects, or poor embryo quality. Endometrial factors can involve issues with receptivity, hormonal imbalances, or uterine abnormalities. (5) Understanding the role of bacteria in implantation and pregnancy outcomes may have implications for diagnostic and therapeutic approaches in ARTs. (6) Interestingly, decreased implantation rates may not be solely attributed to chronic infection but rather to the specific constituents of the bacterial flora present in the endometrium. These findings highlight the potential impact of the specific microbial composition in the endometrium on reproductive outcomes. (7)

The overall condition of the female reproductive system is closely associated with the existence of a healthy microbial community within the vagina. (8) Disruptions in the vaginal microbiota can result in various pathological conditions. One such condition is bacterial vaginosis, which is characterized by an overgrowth of anaerobic bacteria at the expense of beneficial Lactobacillus spp. (9) Reproductive tract infections (RTIs) can have severe consequences on reproductive health. These infections can lead to various serious outcomes, such as spontaneous abortion, ectopic pregnancy, infertility, chronic pelvic pain, an increased risk of HIV infection, and even mortality. (10) M. hominis and U. urealyticum are commonly found on the genital mucosal surfaces, including the vagina and cervical parts, in females. These microorganisms are classified as mycoplasmas are considered to be part of the normal genital microbiota in some individuals. However, they can also cause infections and are associated with various reproductive health issues, including pelvic inflammatory disease (PID), infertility, and adverse pregnancy outcomes. Therefore, their presence and potential pathogenicity should be taken into consideration when assessing and managing reproductive health conditions in females. (11, 12)

Although the established link between infections in the reproductive system and their impact on human fertility is acknowledged, there is a lack of agreement concerning the suitable microbiological approach for managing infertile couples who are undergoing ICSI treatment. The aim of the current study is to evaluate the impact of bacterial genital tract infections on the implantation success in asymptomatic women undergoing ICSI through identifying the bacterial genital microorganisms at the time of the embryo transfer and investigating whether the presence of these microorganisms alters the outcome of ICSI.

Patients

A total of 220 infertile women, consecutively attending REPRO IVF center in Alexandria, were enrolled in the study. They aged 23–38 years; with morphologically normal uteruses confirmed by hysteroscopy and ultrasound. Additionally, they had at least two high-quality embryos available for transfer. The samples were collected at the time of embryo transfer during ICSI procedure. None of the participants had signs or symptoms of genital infection. Written informed consent was obtained from each participant. The study was approved by The Ethics Committee of the High Institute of Public Health (HIPH).

Samples

The standard technique was used to collect vaginal and endocervical swabs using sterilized cotton swabs. During the embryo transfer procedure, a speculum was used to assist in obtaining the swabs from the upper vaginal area and the endocervix by the specialized gynecologist. To collect the vaginal samples, swabs were inserted into the vaginal canal and rotated for a minimum of 10 seconds along the walls of the vagina before being withdrawn. For the endocervical samples, swabs were inserted into the endocervix and rotated for a minimum of 10 seconds along the walls of the endocervix before being withdrawn. Afterward, the swabs were placed in 0.5 ml of phosphate buffer saline, kept on ice, then stored at -20⁰C until DNA extraction. (13) All samples were analyzed at Microbiological Laboratory of the HIPH and the Microbiological Laboratory of Medical Research Institute.

Detection and identification of pathogens

Vaginal swabs were collected from the participants and subjected to routine culturing on blood agar (BA) and MacConkey's agar. The cultures were then incubated at 37°C in aerobic conditions for a period of 24 hours. (14) Biochemical reactions were performed for identification of the obtained bacterial colonies. Gram stain technique was used to presumptively identify bacterial colonies based on gram staining characteristics. Gram-positive colonies with specific characteristics were suspected as staphylococci. Coagulation in coagulase test and growth confirmation on mannitol salt agar differentiate S. aureus and coagulase-negative staphylococci. Streptococci were identified based on colony appearance, microscopic features, and negative catalase reaction. Colonies that lacked hemolysis, exhibited esculin hydrolysis, and demonstrated the ability to grow in the presence of a high salt concentration (6.5% NaCl) were identified as enterococci.

Gram-negative isolates were subjected to additional biochemical tests for identification, including lactose fermenter differentiation, indole production, methyl red, Voges-Proskauer, citrate utilization, and urease activity tests. E. coli and Klebsiella species were identified based on specific combinations of test results. These identification procedures assisted in categorizing bacterial isolates and confirming their identities for further analysis. Colonies that were abundant whether single or more than one type of colony were considered as infective organisms. Colonies growing on the Rogosa agar were identified as Lactobacillus spp., based on colonial morphology and Gram's stain appearance.

U. urealyticum, M. hominis, were detected in the endocervical swabs by real-time PCR. DNA extraction was performed using the QIAamp DNA Mini Kit following the manufacturer instructions. In formulating the PCR reaction mix, Invitrogen (Thermo Fisher Scientific) lyophilized primers were reconstituted to 100 picomoles/µL, aliquoted, and stored at -20°C. The SYBR Green component, sourced from Enzynomics, featured specific primers for target genes: CAATCTGCTCGTGAAGTATTAC (U5) and ACGACGTCCATAAGCAACT (U4) for U. urealyticum within the urease gene; CAATGGCTAATGCCGGATACGC (RNAH1 primer) and GGTACCGTCAGTCTGCAAT (RNAH2 primer) for M. hominis targeting the 16S rRNA gene. (15) For each sample, the PCR reaction mix, totaling 20 µL, included 10 µL SYBR Green, 1 µL each for forward and reverse primers, 5 µL template DNA, and 3 µL nuclease-free water. This meticulous pipetting process adhered to the PCR protocol, ensuring accuracy for optimal performance in subsequent analyses. PCR amplification was performed using the Agilent Stratagene Mx3000P Multiplex Quantitative PCR (QPCR) System and programmed for 40 cycles of amplification (denaturation at 95˚C for 15 sec, annealing at 60˚C for 15 sec and extension at 72 ˚C for 30 sec).

ICSI procedure

In the ICSI cycle, controlled ovarian stimulation initiates the process by promoting follicle growth through ultrasound monitoring and hormone measurements. Ovulation was triggered by injecting human chorionic gonadotropin (hCG). (16) Oocyte retrieval was scheduled 34–36 hours after the hCG injection, which is performed under ultrasound guidance, collecting mature eggs for laboratory processing. Oocyte fertilization involves preparing sperm, then a single sperm is carefully injected directly into a woman's oocyte, with the goal of achieving fertilization and creating an embryo. embryo transfer (ET) was performed 3–5 days after ICSI. ET places developed embryos into the uterus, with timing based on embryo stage and quality. A pregnancy test was conducted two weeks following the embryo transfer to determine whether the transfer was successful and if pregnancy has been achieved.

Statistical analysis

The study utilized various statistical methods to explore factors influencing ICSI outcomes. The normality of age distribution was confirmed using the Shapiro-Wilk test, allowing for a t-test to compare ages between ICSI success and failure groups. Categorical variables were analyzed with Chi-square or Fisher exact tests, and logistic regression models estimated odds ratios (ORs) for infection, age, and embryo grade's impact on ICSI failure. The relationships between isolated genital bacterial organisms and ICSI outcomes were assessed through Chi-square tests and logistic regression models. Aggregations of bacterial organisms were systematically investigated for associations with ICSI outcomes. The analysis, conducted in R software, offered insights into potential determinants of ICSI success and provided both crude and adjusted odds ratios.

In this study, 220 infertile women were tested for the presence of genital tract pathogens at the time of embryo transfer during ICSI procedure. Microbiological analysis was conducted on a total of 440 genital samples (220 vaginal swabs and 220 endocervical swabs).

Distribution of ICSI success among the studied women.

The overall ICSI success rate was 61% resulted in 134 women achieving pregnancy after successful implantations. Out of the 220 females included in the study, there were 188 women (85%) infected with at least one bacterial organism, excluding lactobacilli. The infection rate was lower in the ICSI positive group (82.1%) compared to the ICSI negative group (90.7%), but this difference was not statistically significant. In addition, embryo grade A represented 98.5% and 93.0% among the ICSI positive and negative groups, respectively. However, this difference was not statistically significant. Regarding the participant demographics, the mean age in the ICSI positive group was 28.2 years, while it was 30.8 years in the ICSI negative group. This age difference was statistically significant (p = 0.001). (Table 1)

Table (1): Distribution of infection, age, and type of embryo grade in ICSI positive and negative groups.

Characteristic	ICSI negative (n = 86)	ICSI positive (n = 134)	Test of Significance
Infection
n (%)	78 (90.7)	110 (82.1)	χ² (df = 1) = 2.47 p = 0.116
Age
Mean ± SD in years	30.8 ± 5.6	28.2 ± 5.7	t (df = 183.5) = 3.29 p = 0.001*
Embryo grade A
n (%)	80 (93.0)	132 (98.5)	p_(FE) = 0.059

χ^2:: Pearson Chi square test t: t test statistic df: degree of freedom. p_(FE): p value of Fisher exact test

*: Statistically Significant (p < 0.05).

Prevalence and etiology of genital tract infections in infertile women

Microbiological results showed that 85% (188/220) of females were found positive to at least one genital pathogen.The most prevalent microbial pathogens found in infected women were M. hominis spp., U. urealyticum spp., Klebsiella spp., and Enterococci spp., with prevalence rates of 44.5%, 41.2%, 25.0%, and 21.4%, respectively. (Table 2).

Table (2): Distribution of isolated genital bacterial organisms among the studied women at the time of embryo transfer
Bacterial isolate	Number n = 220	Percentage (%)
E. coli spp.	18	8.2
Enterococci spp.	47	21.4
Klebsiella spp.	55	25.0
Lactobacilli spp.	90	40.9
M. hominis spp.	98	44.5
Coagulase-negative staphylococcus spp.	39	17.7
Staphylococcus aureus spp.	32	14.5
Streptococcus spp.	18	8.2
U. urealyticum spp.	91	41.4

Impact of genital tract pathogens on ICSI outcome

Five identified organisms, namely M. hominis spp., U. urealyticum spp., Enterococci spp., Klebsiella spp., and E. coli spp., were more prevalent in the ICSI negative group compared to the ICSI positive group. On the other hand, Lactobacilli spp. was more prevalent in the ICSI positive group (43.3%) compared to the ICSI negative group (37.2%). However, these differences were not statistically significant. (Table 3).

Table (3): Distribution of the isolated genital bacterial organisms among the studied women according to the ICSI outcome
Bacterial isolates	ICSI Positive (n = 134)		ICSI Negative (n = 86)		χ² (df = 1)	p value
Bacterial isolates	n	%	n	%	χ² (df = 1)	p value
E. coli	9.0	6.7	9.0	10.5	0.54	0.461
Enterococci spp.	26	19.4	21	24.4	0.51	0.473
Klebsiella spp.	31	23.1	24	27.9	0.41	0.523
Lactobacilli spp.	58	43.3	32	37.2	0.57	0.451
M. hominis spp.	57	42.5	41	47.7	0.37	0.543
Coagulase-negative staphylococcus spp.	25	18.7	14	16.3	0.07	0.787
Staphylococcus aureus	21	15.7	11	12.8	0.16	0.693
Streptococcus spp.	12	9.0	6.0	7.0	0.07	0.787
U. urealyticum spp.	49	36.6	42	48.8	2.77	0.096

χ² : Pearson Chi square test p: probability value df: degree of freedom. *: Statistically Significant (p < 0.05).

The comparison of ICSI success rates in participants infected with individual bacterial pathogens and non-infected participants.

Fisher exact tests were conducted for all comparisons. The results showed that, except for the presence of Enterococci spp. alone, which demonstrated a significantly lower ICSI success rate (20%), p = 0.030 all other comparisons were not statistically significant. The crude and adjusted odds ratios of sole infection with each bacterial species on ICSI failure were determined. In the adjusted models, no significant effects for each bacterial species alone were detected. It is worth noting that the models did not include the embryo grade due to the limited number of cases with embryo grade B. Also, no logistic regression models were performed for Staphylococcus aureus nor for Coagulase-negative Staphylococcus spp. due to the very low frequencies where the organisms were solely isolated. (Table 3)

	Table (3): Age and sole infection with a particular organism as predictors for ICSI failure among the studied women
Predictors		OR	95% CI		p value	AOR	95% CI		p value
Predictors		OR	lower	upper	p value	AOR	lower	upper	p value
	Model for sole infection with Enterococci spp.
Infection vs no infection		12.0	1.51	254.16	0.037*	9.12	0.80	254.51	0.108
Age		1.26	1.08	1.53	0.007*	1.24	1.06	1.52	0.016*
	Model for sole infection with U. urealyticum spp.
Infection vs no infection		4.50	1.03	21.84	0.049*	4.72	0.87	31.87	0.083
Age		1.26	1.09	1.52	0.006*	1.25	1.08	1.51	0.008*
	Model for sole infection with M. hominis spp.
Infection vs no infection		2.25	0.38	12.52	0.349	2.35	0.37	14.44	0.345
Age		1.13	0.98	1.32	0.101	1.13	0.98	1.33	0.101
	Model for sole infection with E. coli
Infection vs no infection		1.50	0.18	9.35	0.672	1.36	0.15	9.52	0.759
Age		1.12	0.98	1.31	0.113	1.12	0.98	1.31	0.119
	Model for sole infection with Streptococci spp.
Infection vs no infection		1.29	0.23	5.95	0.754	1.19	0.21	5.72	0.834
Age		1.09	0.96	1.25	0.211	1.08	0.96	1.25	0.219
	Model for sole infection with Klebsiella spp.
Infection vs no infection		1.00	0.19	4.39	1.000	0.95	0.17	4.32	0.945
Age		1.11	0.97	1.30	0.139	1.11	0.97	1.30	0.139
*: Statistically Significant (p < 0.05). p: probability value OR: crude odds ratio. CI: confidence interval. AOR: adjusted odds ratio

A comparison of ICSI success rates in participants infected with various combinations of the three identified organisms associated with the lowest ICSI success rates (Enterococci spp. and/or M. hominis, and/or U.urealyticum) was done. The group infected with Enterococci spp. and/or U.urealyticum alone had a significantly lower ICSI success rate (52.1%) compared to non-infected participants (75%). Crude and adjusted odds ratios of sole infection with combinations of any of the three previously identified organisms associated with the least ICSI success rates (Enterococci spp., M. hominis, and U. urealyticum.) were estimated. The adjusted odds ratios for ICSI failure were estimated by including the corresponding infection together with age and type of embryo grade in multiple logistic regression models. After controlling for age and embryo grade, infection with Enterococci spp. and/or U. urealyticum spp. was significantly associated with 2.79 times the likelihood of ICSI failure in non-infected participants. In addition, after controlling for age and embryo grade, participants with combined infection with Enterococci spp. and/or M. hominis and/or U. urealyticum had 2.6 times higher likelihood of ICSI failure compared to non-infected participants. Age was a significant predictor of failure in the four models; each additional year of age was associated with 1.1 to 1.16 times higher risk of failure- after controlling for infections and embryo grade. (Table 4).

	Table (4): Sole infection with combinations of any of Enterococci spp. and/or M. hominis and/or U. urealyticum. as predictors for ICSI failure among the studied women
Predictors		OR	95% CI		p value	AOR	95% CI		p value
Predictors		OR	lower	upper	p value	AOR	lower	upper	p value
	Model for sole infection with M. hominis and/or U. urealyticum
Infection vs no infection		2.31	0.99	5.92	0.064	2.46	1.02	6.48	0.055
Age		1.09	1.02	1.17	0.009*	1.10	1.03	1.18	0.004*
Embryo grade A vs B		0.32	0.01	3.37	0.351	0.23	0.01	2.57	0.245
	Model for sole infection with Enterococci spp. and/or U. urealyticum
Infection vs no infection		2.76	1.17	7.12	0.026*	2.79	1.11	7.64	0.036*
Age		1.15	1.07	1.23	< 0.001*	1.16	1.08	1.25	< 0.001
Embryo grade A vs B		0.23	0.01	1.88	0.213	0.17	0.01	1.65	0.157
	Model for sole infection with Enterococci spp. and/or M. hominis
Infection vs no infection		2.33	0.99	5.98	0.063	2.45	1.01	6.47	0.057
Age		1.09	1.02	1.16	0.012*	1.10	1.03	1.18	0.006*
Embryo grade A vs B		0.31	0.01	3.37	0.350	0.24	0.01	2.62	0.251
	Model for sole infection with Enterococci spp. and/or M. hominis and/or U. urealyticum.
Infection vs no infection		2.49	1.08	6.26	0.039*	2.60	1.09	6.77	0.038*
Age		1.11	1.05	1.18	< 0.001*	1.12	1.05	1.19	< 0.001
Embryo grade A vs B		0.23	0.01	1.83	0.206	0.20	0.01	1.74	0.178
*: Statistically Significant (p < 0.05). p: probability value OR: crude odds ratio. CI: confidence interval. AOR: adjusted odds ratio

Effect of replacing of one organism of the combination ( Enterococci spp. and/or M. hominis and/or U. urealyticum ) by other isolated pathogen on ICSI success rate

A comparison of ICSI success rates in patients with different groups of isolated organisms to the success rate in non-infected patients was estimated. These groups were formed by sequentially replacing one organism from the group consisting of Enterococci spp. and/or M. hominis and/or U. urealyticum with one of the remaining organisms (Klebsiella spp., E. coli, Streptococcus spp., Staphylococcus spp., and coagulase-negative staphylococcus spp.). However, these results were not statistically significant. The AOR was estimated by multiple logistic regression models of the previous combinations, while controlling for age and embryo grade. The results did not indicate significant effects for those combinations, except for the group composed of Enterococci spp. and/or M. hominis and/or U. urealyticum (Table 5)


Bacterial combination	OR	95% CI		p value	AOR	95% CI		p value
Bacterial combination	OR	lower	upper	p value	AOR	lower	upper	p value
Enterococci spp. and/or M. hominis and/or U. urealyticum	2.49	1.08	6.26	0.039*	2.60	1.09	6.77	0.038*
M. hominis and/or U. urealyticum and/or Klebsiella spp.	2.21	0.97	5.56	0.072	2.29	0.98	5.87	0.068
M. hominis and/or U. urealyticum and/or E. coli	2.32	1.01	5.83	0.058	2.34	0.99	6.04	0.063
M. hominis and/or U. urealyticum. and/or Streptococcus spp.	2.27	0.99	5.70	0.064	2.27	0.97	5.82	0.071
M. hominis and/or U. urealyticum and/or S. aureus spp.	2.24	0.97	5.65	0.069	2.30	0.97	5.93	0.069
M. hominis and/or U. urealyticum and/or coagulase-negative staphylococcus spp.	2.24	0.97	5.65	0.069	2.39	1.00	6.21	0.059
Enterococci spp. and/or U. urealyticum. and/or Klebsiella spp.	2.37	1.02	5.99	0.053	2.40	0.98	6.35	0.063
Enterococci spp. and/or U. urealyticum. and/or E. coli	2.50	1.08	6.35	0.040	2.45	0.99	6.56	0.061
Enterococci spp. and/or U. urealyticum. and/or Streptococcus spp.	2.43	1.05	6.17	0.046	2.36	0.97	6.26	0.068
Enterococci spp. and/or U. urealyticum. and/or S. aureus spp.	2.41	1.04	6.12	0.050	2.41	0.98	6.46	0.066
Enterococci spp. and/or U. urealyticum. and/or Coagulase-negative Staphylococcus spp.	2.41	1.04	6.12	0.050	2.55	1.02	6.92	0.053
Enterococci spp. and/or M. hominis and/or Klebsiella spp.	2.25	0.98	5.68	0.068	2.29	0.97	5.94	0.071
Enterococci spp. and/or M. hominis and/or E. coli	2.37	1.02	5.99	0.053	2.34	0.98	6.13	0.066
Enterococci spp. and/or M. hominis and/or Streptococcus spp.	2.31	1.00	5.84	0.060	2.26	0.95	5.87	0.075
Enterococci spp. and/or M. hominis and/or S. aureus spp.	2.28	0.99	5.78	0.065	2.30	0.96	6.02	0.072
Enterococci spp. and/or M. hominis and/or coagulase-negative staphylococcus spp.	2.28	0.99	5.78	0.065	2.41	1.00	6.37	0.060
*: Statistically Significant (p < 0.05). p: probability value OR: crude odds ratio. CI: confidence interval. AOR: adjusted odds ratio

The Effect of addition of other organisms to the combination of Enterococci spp. and/or M. hominis and/or U. urealyticum on ICSI success rates.

New combinations were formed by sequentially adding one of the following organisms: E. coli, Klebsiella spp., coagulase-negative staphylococcus spp., S. aureus spp., and Streptococcus spp. to the group made up of Enterococci spp. and/or M. hominis and/or U. urealyticum. The ICSI success rate of these combination revealed no statistically significant differences. The AOR was estimated by multiple logistic regression models of the previous five combinations, while controlling for age and embryo grade. The results showed significant effects in four of them. However, the AOR of the four significant combinations was not higher than that of the group made up of Enterococci spp. and/or M. hominis and/or U. urealyticum. (Table 6). Data are available upon request.


	OR	95% CI		p value	AOR	95% CI		p value
	OR	lower	upper	p value	AOR	lower	upper	p value
Enterococci spp. and/or M. hominis and/or U. urealyticum	2.49	1.08	6.26	0.039*	2.60	1.09	6.77	0.038*
Enterococci spp. and/or M. hominis and/or U. urealyticum spp. and/or Klebsiella spp.	2.37	1.04	5.91	0.049*	2.44	1.04	6.26	0.049*
Enterococci spp. and/or M. hominis and/or U. urealyticum and/or E. coli	2.47	1.08	6.18	0.039*	2.49	1.05	6.43	0.046*
Enterococci spp. and/or M. hominis and/or U. urealyticum and/or Streptococcus spp.	2.42	1.06	6.05	0.044*	2.41	1.03	6.20	0.052
Enterococci spp. and/or M. hominis and/or U. urealyticum and/or S. aureus spp.	2.40	1.05	6.01	0.046*	2.45	1.04	6.34	0.049*
Enterococci spp. and/or M. hominis and/or U. urealyticum and/or Coagulase-negative Staphylococcus spp.	2.40	1.05	6.01	0.046*	2.55	1.07	6.64	0.042*

^a The six combinations included the group made up of Enterococci spp. and/or M. hominis and/or U. urealyticum. in addition to five groups made by sequentially adding one of the remaining organisms to the that group.

*: Statistically Significant (p < 0.05). p: probability value OR: crude odds ratio. CI: confidence interval. AOR: adjusted odds ratio

Infertility is a complex medical condition that profoundly affects couples, both emotionally and financially. It also imposing a considerable burden on the healthcare system. (17) It arises from a combination of factors that contribute to disruptions in reproductive function in both men and women. These factors can negatively affect the function of the reproductive organs, the production of reproductive cells, semen quality, transportation of sperm cells to the oocyte, process of fertilization and successful implantation of embryos. (18) Despite the improvements in ART, the success rates of conceiving remain relatively low. Various factors contribute to the success rates of assisted reproductive procedures, such as age, duration and underlying cause of infertility, number of previous IVF attempts, embryo quality, quantity of available oocytes, and the number of viable embryos produced during the procedure. (19)

The main factor that hinders the success of IVF-ET is the failure of embryo implantation. Even when satisfactory analysis of embryo morphology and appropriate evaluation of endometrial characteristics are conducted, the overall pregnancy rates in IVF-ET remain low. This suggests that there are additional factors that can disrupt the normal process of embryo implantation.ICSI implantation failure can be influenced by numerous factors, including genital tract infections. (20)

The primary focus of this work was to study the impact of asymptomatic genital tract infections on the outcome of ICSI. The results of this work revealed an overall ICSI success rate of 60.9%, with 134 women achieving pregnancy following successful implantation. The mean age of women in the ICSI-positive group was significantly lower than that in the ICSI-negative group. A previous studies reported that older women had lower rates of oocyte retrieval, as well as decreased pregnancy and live birth rates. (21) This suggests that age plays a significant role in the success of IVF treatments, with younger women having more favorable outcomes compared to older age groups. The potential negative impact of the aging process on the effectiveness of IVF/ICSI can be attributed to various factors including diminished ovarian reserve, diminished quality of oocytes, increased likelihood of embryo implantation failure, hormonal imbalances resulting in ovulatory dysfunction, and uterine issues. (22)

The findings of the current study provide important perspectives on the correlation between infection rates and the outcome of ICSI. The infection rate was lower in the ICSI positive group compared to the ICSI negative group. It is proposed that high concentration of cervical microorganisms may induce chronic subclinical inflammation in the endometrium. This inflammation causes the uterus to become less receptive to the implanted embryo and consequently associated with decreased implantation or pregnancy rates. (23)

The microbiological analysis of the current study revealed that 85% of the cases were tested positive for at least one genital pathogen, excluding lactobacilli. However, other studies reported lower rates of genital microorganism positivity among their respective study populations. These variations highlight the importance of conducting further research and analysis to identify the potential factors contributing to the disparate outcomes observed in these studies.

In the present work, several pathogenic bacterial organisms have been identified. The predominant organisms were Mycoplasma hominis (44.5%), Ureaplasma urealyticum (41.4%), Klebsiella (25%) and Enterococci (21.4%). Less prevalent organisms included coagulase-negative staphylococcus species (17.7%), Staphylococcus aureus (14.5%), Escherichia coli (8.2%), and Streptococcus species (8.2%).

The study investigated the impact of bacterial infections on intracytoplasmic sperm injection (ICSI) failure. While individual bacterial species showed no significant effect, combinations involving Enterococci spp., M. hominis, and U. urealyticum were studied further. Patients infected with Enterococci spp. and/or U. urealyticum had a significantly lower ICSI success rate (52.1% vs. 75% in non-infected patients). Those solely infected with Enterococci spp. and/or U. urealyticum had a 2.79 times higher risk of failure. Furthermore, patients infected solely with any of the three organisms had a 2.6 times higher likelihood of failure compared to non-infected participants.

Sequential replacement or addition of other bacterial species from the found remaining organisms (Klebsiella spp., E. coli, Streptococcus spp., Staphylococcus spp., and coagulase-negative staphylococcus spp.) showed no significant difference in success rates, highlighting the specific impact of Enterococci spp. and/or U. urealyticum on ICSI outcomes. A previous study was conducted investigating the association between specific genital tract pathogens and IVF failure aligns with the findings of the present study. It revealed a microbial group (E. faecalis, U. urealyticum, M. hominis, G. vaginalis, T. vaginalis) more prevalent in unsuccessful IVF, but not significant. Excluding T. vaginalis and G. vaginalis, the prevalence became significantly higher. They concluded that while individual pathogens did not directly correlate with IVF outcomes, a specific microbial group involving E. faecalis, U. urealyticum, and M. hominis was significantly associated with unsuccessful IVF. (24)

In the present study, a highly sensitive technique RT- PCR was employed to detect the presence of M. hominis and U. urealyticum. This advanced molecular method offers several advantages over traditional culture-based techniques, which could potentially explain the higher rate of microorganism positivity observed in this study compared to other studies. RT-PCR is known for its ability to detect and quantify target DNA or RNA sequences with high sensitivity and specificity. It allows for the detection of low levels of microorganisms that may not be readily cultivable with the traditional culture methods. (25) RT-PCR identified U. urealyticum and M. hominis in 41.2% and 44.5% of participants, respectively.

Similar findings were reported by another study using PCR to detect U. urealyticum and M. hominis in endocervical samples from infertile women. Their results showed that among their enrolled participants, 51.7% were positive for U. urealyticum alone, 26.7% were positive for M. hominis alone, and 21.5% had dual infection with both. The study emphasizes the importance of rapid detection of Mycoplasmas using PCR in infertile women due to the potential adverse effects of these microorganisms on the success rate of specialized infertility treatments. (26)

In the current study, the prevalence of Lactobacilli spp. was higher in the ICSI positive group (43.3%) compared to the ICSI negative group (37.2%), lactobacilli colonization was also significantly higher in cases without infection (78%) compared to infected cases (35%). This discrepancy in lactobacilli colonization suggests a potential protective role of lactobacilli in preventing infection. Lactobacilli are known for their beneficial effects on vaginal health, as they help to maintain a balanced vaginal microbiota and to create an acidic environment that inhibits the growth of pathogenic bacteria. (27) The higher prevalence of lactobacilli colonization in non-infected cases implies that the presence of lactobacilli may serve as a defense mechanism against pathogenic bacterial organisms.

In conclusion, the present work shed light on three specific genital tract pathogens that can serve as predictive indicators of unfavorable ICSI results. It underscores the significance of conducting microbiological assessments for E. faecalis, U. urealyticum, and M. hominis in infertile women before undergoing ICSI procedures. This research has pinpointed a group of infections that are notably linked as an independent risk factor for infertility and negative outcomes in ICSI. However, the reasons behind ICSI failures often remain undisclosed. Collaborative efforts among clinical microbiologists, infectious disease experts, and specialists in reproductive medicine are needed to establish unified guidelines for testing pathogens related to infertility. Both the microbiological and clinical outcomes should be evaluated before starting ART treatments. Enhancing the management of infections in the reproductive tract of infertile couples could potentially raise pregnancy rates, lower the number of treatment cycles, and improve initial fertility interventions, which would positively impact the well-being of couples and healthcare expenses.

Author Contributions

N.E., M.F., A.E., and A.H. were responsible for the conception and design of the study.

N.E., E.E., M.F., A.E., and Y.O. conducted data acquisition.

N.E., E.E., M.F., and A.E. performed data analysis and interpretation.

E.E. conducted the Statistical analysis.

N.E. provided funding.

N.E. and M.F. wrote the main manuscript.

N.E., M.F., and E.E. prepared tables and figures

All authors reviewed the manuscript.

Ethics approval and consent to participate

The study was approved by The Ethics Committee of the High Institute of Public Health (HIPH).

Written informed consent was obtained from each participant.

Consent for publication

All authors approve to publish in the Journal of BMC Infectious Disease

Availability of data and materials

Data and materials are available upon request.

Competing interests

Authors have no competing interests as defined by BMC, or other interests that might be perceived to influence the results and/or discussion reported in this paper.

Funding

No funding was received

Acknowledgement

Not applicable

Dourou P, Gourounti K, Lykeridou A, Gaitanou K, Petrogiannis N, Sarantaki A. Quality of Life among Couples with a Fertility Related Diagnosis. Clin Pract. 2023 Feb 9;13(1):251-263. doi: 10.3390/clinpract13010023. PMID: 36826165; PMCID: PMC9955447.
World Health Organization. Infertility Prevalence Estimates, 1990–2021 [Internet]. www.who.int; 2023. Retrived from: https://www.who.int/publications/i/item/978920068315
Dyer S, Chambers GM, de Mouzon J, Nygren KG, Zegers-Hochschild F, Mansour R, et al. International Committee for Monitoring Assisted Reproductive Technologies world report: Assisted Reproductive Technology 2008, 2009 and 2010. Hum Reprod. 2016;31(7):1588-609. https://doi.org/10.1093/humrep/dew082
Mustafa M, Hadi J, Iiizam E, Sani A. Male and Female Infertility: Causes, And Management. 2019:27-32. http://dx.doi.org/10.9790/0853-1809132732
Shaulov T, Sierra S, Sylvestre C. Recurrent implantation failure in IVF: A Canadian Fertility and Andrology Society Clinical Practice Guideline. Reproductive BioMedicine Online. 2020;41(5):819-33.https://doi.org/10.1016/j.rbmo.2020.08.007
Lozano FM, Lledó B, Morales R, Cascales A, Hortal M, Bernabeu A, Bernabeu R. Characterization of the Endometrial Microbiome in Patients with Recurrent Implantation Failure. Microorganisms. 2023 Mar 14;11(3):741. doi: 10.3390/microorganisms11030741. PMID: 36985314; PMCID: PMC10054712.
Marilen Benner, Gerben Ferwerda, Irma Joosten, Renate G van der Molen, How uterine microbiota might be responsible for a receptive, fertile endometrium, Human Reproduction Update, Volume 24, Issue 4, July-August 2018, Pages 393 –415. https://doi.org/10.1093/humupd/dmy012
Mao X, Chen H, Peng X, Zhao X, Yu Z, Xu D. Dysbiosis of vaginal and cervical microbiome is associated with uterine fibroids. Front Cell Infect Microbiol. 2023 Sep 6;13:1196823. doi: 10.3389/fcimb.2023.1196823. PMID: 37743857; PMCID: PMC10513091.
Buzzaccarini G, Vitagliano A, Andrisani A, Santarsiero CM, Cicinelli R, Nardelli C, et al. Chronic endometritis and altered embryo implantation: a unified pathophysiological theory from a literature systematic review. J Assist Reprod Genet. 2020;37(12):2897-911. https://doi.org/10.1007/s10815-020-01955-8
Aly Ibrahim, A., Ahmed Attia, A., Fatthy Mohammed, A. Self-Care Practices Regarding Prevention of Reproductive Tract Infection among Female Adolescent. Egyptian Journal of Health Care, 2022; 13(2): 137-157. doi: 10.21608/ejhc.2022.228541
Chellani M, Chellani M, Rahangdale S. Association of the microbial culture of follicular fluid, vaginal swab and catheter tip with β–hCG IVF positive and negative. Asian Pacific Journal of Reproduction. 2022;11(5). DOI: 10.4103/2305-0500.356840
Von Wolff M, Schwartz AK, Bitterlich N, Stute P, Fäh M. Only women's age and the duration of infertility are the prognostic factors for the success rate of natural cycle IVF. Arch Gynecol Obstet. 2019;299(3):883-9. https://doi.org/10.1007/s00404-018-5034-8
Ahabwe, O.M., Kabanda, T., Abesiga, L. et al. Bacterial isolates and antibiotic susceptibility among women with abnormal vaginal discharge attending the gynecology clinic at a tertiary hospital in southwestern Uganda: a cross-sectional study. BMC Women's Health 23, 572 (2023).https://doi.org/10.1186/s12905-023-02746-w
Bitew A, Mengist A, Belew H, Aschale Y, Reta A. The Prevalence, Antibiotic Resistance Pattern, and Associated Factors of Bacterial Vaginosis Among Women of the Reproductive Age Group from Felege Hiwot Referral Hospital, Ethiopia. Infect Drug Resist. 2021 Jul 13;14:2685-2696. doi: 10.2147/IDR.S305329. PMID: 34285521; PMCID: PMC8286113.
Stellrecht, Kathleen & Woron, Amy & Mishrik, Nada & Venezia, Richard. (2004). Comparison of Multiplex PCR Assay with Culture for Detection of Genital Mycoplasmas. Journal of clinical microbiology. 42. 1528-33. 10.1128/JCM.42.4.1528-1533.2004.
Yan MH, Cao JX, Hou JW, Jiang WJ, Wang DD, Sun ZG, Song JY. GnRH Agonist and hCG (Dual Trigger) Versus hCG Trigger for Final Oocyte Maturation in Expected Normal Responders With a High Immature Oocyte Rate: Study Protocol for a Randomized, Superiority, Parallel Group, Controlled Trial. Front Endocrinol (Lausanne). 2022 Mar 28;13:831859. doi: 10.3389/fendo.2022.831859. PMID: 35418945; PMCID: PMC8996168.
Hocaoglu C. The Psychosocial Aspect of Infertility [Internet]. Infertility, Assisted Reproductive Technologies and Hormone Assays. IntechOpen; 2019. http://dx.doi.org/10.5772/intechopen.80713
Abrao M, Muzii L, Marana R. Anatomical causes of female infertility and their management. International journal of Chao HH, Zhang Y, Dong PY, Gurunathan S, Zhang XF. Comprehensive review on the positive and negative effects of various important regulators on male spermatogenesis and fertility. Front Nutr. 2023 Jan 16;9:1063510. doi: 10.3389/fnut.2022.1063510. PMID: 36726821; PMCID: PMC9884832.
Dabbagh Rezaeiyeh R, Mehrara A, Mohammad Ali Pour A, Fallahi J, Forouhari S. Impact of Various Parameters as Predictors of The Success Rate of In Vitro Fertilization. Int J Fertil Steril. 2022 Apr;16(2):76-84. doi: 10.22074/IJFS.2021.531672.1134. Epub 2022 May 8. PMID: 35639653; PMCID: PMC9108295.
Ma J, Gao W, Li D. Recurrent implantation failure: A comprehensive summary from etiology to treatment. Front Endocrinol (Lausanne). 2023 Jan 5;13:1061766. doi: 10.3389/fendo.2022.1061766. PMID: 36686483; PMCID: PMC9849692.
Wang P, Zhao C, Xu W, Jin X, Zhang S, Zhu H. The association between the number of oocytes retrieved and cumulative live birth rate in different female age strata. Sci Rep. 2023 Sep 4;13(1):14516. doi: 10.1038/s41598-023-41842-7. PMID: 37667038; PMCID: PMC10477298.
Law YJ, Zhang N, Venetis CA, Chambers GM, Harris K. The number of oocytes associated with maximum cumulative live birth rates per aspiration depends on female age: a population study of 221 221 treatment cycles. Hum Reprod. 2019 Sep 29;34(9):1778-1787. doi: 10.1093/humrep/dez100. PMID: 31398253.
Cela V, Daniele S, Obino MER, Ruggiero M, Zappelli E, Ceccarelli L, Papini F, Marzi I, Scarfò G, Tosi F, Franzoni F, Martini C, Artini PG. Endometrial Dysbiosis Is Related to Inflammatory Factors in Women with Repeated Implantation Failure: A Pilot Study. J Clin Med. 2022 Apr 28;11(9):2481. doi: 10.3390/jcm11092481. PMID: 35566605; PMCID: PMC9101226.
Ricci S, De Giorgi S, Lazzeri E, Luddi A, Rossi S, Piomboni P, et al. Impact of asymptomatic genital tract infections on in vitro Fertilization (IVF) outcome. PLoS One. 2018;13(11):e0207684. https://doi.org/10.1371/journal.pone.0207684
Chan JL, Cerón S, Horiuchi SM, Tsan AT, Kamau E, Yang S. Development of a Rapid and High-Throughput Multiplex Real-Time PCR Assay for Mycoplasma hominis and Ureaplasma Species. J Mol Diagn. 2023;25(11):838-848. doi:10.1016/j.jmoldx.2023.07.004
Peerayeh S, Sattari M. Detection of Ureaplasma urealyticum and Mycoplasma hominis in endocervical specimens from infertile women by polymerase chain reaction. Middle East Fertility Society Journal. 2006; 11:104-8.
Mei Z, Li D. The role of probiotics in vaginal health. Front Cell Infect Microbiol. 2022; 12:963868. https://doi.org/10.3389/fcimb.2022.963868

No competing interests reported.

Download PDF

Editorial decision: Revision requested
05 Aug, 2024
Editor assigned by journal
04 Aug, 2024
Submission checks completed at journal
04 Aug, 2024
First submitted to journal
02 Aug, 2024

You are reading this latest preprint version

Impact of Asymptomatic Bacterial Genital Tract Infections on the Implantation Success in Women Undergoing Intracytoplasmic Sperm Injection (ICSI)

Status:

Version 1

Abstract

Background

Methods

Results

Conclusion

Introduction

Materials and methods

Patients

Samples

Detection and identification of pathogens

ICSI procedure

Statistical analysis

Results

Prevalence and etiology of genital tract infections in infertile women

Impact of genital tract pathogens on ICSI outcome

Discussion

Declarations

References

Additional Declarations

Status:

Version 1