Taurine Alleviated Acrylamide-Induced Ovarian Toxicity via Suppression of Stress and Apoptosis in Mice

doi:10.21203/rs.3.rs-4853287/v1

Download PDF

Research Article

Taurine Alleviated Acrylamide-Induced Ovarian Toxicity via Suppression of Stress and Apoptosis in Mice

https://doi.org/10.21203/rs.3.rs-4853287/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Acrylamide (Acr) poses reproductive toxicity risks to humans due to its ability to penetrate cell membranes and disrupt cellular balance. Taurine (Tau), a sulfur-containing amino acid with cell membrane stabilization and antioxidant properties, may mitigate these effects. This study examines how Tau can protect against oxidative stress and apoptosis induced by Acr in mouse ovarian tissue. Forty adult healthy mice, aged 6-8 weeks, were randomly assigned to four including Con (received normal saline orally), Acr (50 mg/Kg/day Acr orally), Acr+Tau75 (Acr and 75 mg/Kg/day Tau), and Acr+Tau150 (Acr and 150 mg/Kg/day Tau). Treatments were administered for 35 days, followed by assessments of stress markers and apoptosis via immunofluorescence and TUNEL assays. Both doses of Tau significantly enhanced the gene and protein expression levels of stress response enzymes, including GPx, SOD, and CAT (p <0.05). Moreover, Tau significantly decreased the gene expression levels of apoptotic markers Caspase3 and BAX, while upregulating the anti-apoptotic gene BCL2L1 (p < 0.01). The TUNEL assay revealed the ameliorative properties of Tau against Acr-induced apoptosis in the ovaries. The current findings suggest the promising properties of Tau in the amelioration of Acr-induced oxidative stress and apoptosis in mouse ovarian tissue. Therefore, Tau presents a potential therapeutic approach for protecting against Acr-induced reproductive toxicity in females, warranting further investigation.

Reproductive toxicity

oxidative stress

apoptosis

ovary

female

Taurine.

The hypothesis tested in this study is that taurine (Tau) can mitigate the reproductive toxicity induced by acrylamide (Acr) in female mice by reducing oxidative stress and apoptosis in ovarian tissue. Specifically, the study investigates whether the administration of Tau at two different doses can counteract the deleterious effects of Acr on oxidative balance and apoptotic cell death within the ovaries, thereby preserving ovarian function and female fertility. This hypothesis is based on the known antioxidant and cell-protective properties of Tau, which have shown efficacy in preventing reproductive toxicity caused by other environmental toxins.

Endocrine-disrupting chemicals (EDCs) have the potential to impair female fertility by causing disruptions in various reproductive processes. These chemicals can alter oocyte meiosis, steroidogenesis, blastocyst formation, and implantation by modifying intracellular signaling pathways involved in stress response and apoptosis, among others (Machtinger 2018, Samare-Najaf, Samareh et al. 2023). EDCs include highly heterogeneous synthetic compounds such as industrial solvents/lubricants and byproducts, plasticizers, plastics, and pesticides (Martínez, Marquès et al. 2023, Samare-Najaf, Samareh et al. 2023). A plethora of evidence has shown that EDCs disrupt the production and secretion of sex hormones and treat female fecundity by impairing the oxidative balance and inducing cell death in ovarian follicles (Guarnotta, Amodei et al. 2022, Hassan, Thacharodi et al. 2024).

Acr is an abundantly used chemical in industries and in the production of laboratory materials. However, exposure to Acr, primarily through dietary intake, has been shown to disrupt the human endocrine system (Saberi, Ahmadi et al. 2022); consequently, Acr is classified as EDC (Ivanski, de Oliveira et al. 2020). Acr, which is formed through a non-enzymatic reaction between carbohydrates and amino acids known as the Maillard reaction (Bachir, Akkoum et al. 2024), possesses a low molecular weight and high solubility. These properties enable Acr to readily penetrate cellular membranes. (Yilmaz, Yildizbayrak et al. 2017). facilitate its cellular uptake, leading to a range of intracellular pathological changes. These changes include altered redox status, increased production of reactive oxygen species (ROS), induction of oxidative stress, as well as genotoxic and cytotoxic effects, all of which contribute to the initiation of apoptosis. (Duan, Wang et al. 2015, Ibrahim, Hafez et al. 2020, Gao, Xue et al. 2023). Continuing evidence identifies Acr as a reproductive toxin in both genders and describes this chemical as a public concern all over the world. Nevertheless, recent efforts to use compounds with antioxidant properties suggest a novel strategy to confront the toxicity caused by exposure to Acr (ALKarim, ElAssouli et al. 2015, Alaee, Khodabandeh et al. 2024).

Research has shown that certain plants encompass bioactive elements that exhibit the potential to counteract apoptosis (Yaghutian Nezhad, Mohseni Kouchesfahani et al. 2021, Alaee, Mirani et al. 2023).

Taurine (Tau, 2-aminoethanesulfonic acid) is a non-proteinogenic amino acid obtained from dietary sources and synthesized endogenously. It contributes to a variety of cellular processes such as cell development, cell signaling, receptor regulation, cation homeostasis, osmotic pressure, and enzyme activity (Oliveira, Minotto et al. 2010, Surai, Earle-Payne et al. 2021). Moreover, Tau is considered a natural antioxidant with protective properties against environmental toxins. In this regard, different studies have revealed that Tau could prevent reproductive toxicity caused by chemicals (e.g. metals) (Adedara, Ileola-Gold et al. 2024) and pharmaceutics (e.g. nandrolone decanoate) (Megahed, Abdel Moawed et al. 2024). Nevertheless, the ability of Tau to prevent Acr-induced female reproductive toxicity is not elucidated.

It is widely documented that exposure to Acr causes female reproductive toxicity by disturbing the oxidative balance and inducing apoptotic cell death in the ovaries. Although Tau is considered a natural antioxidant with fertility-protecting properties, its efficacy in mitigating Acr-induced ovarian toxicity has not been evaluated. Therefore, the present study aimed to administer two different doses of Tau to Acr-exposed mice and measure the oxidative stress levels (glutathione peroxidase [GPx], superoxide dismutase [SOD], and catalase [CAT]) and apoptosis markers (Bcl-2-like protein 2 [BCL2L2], Bcl-2-like protein 2 [BAX] and caspase3] using TUNEL assay and RT-qPCR and immunostaining techniques.

Ethical Approvement

All procedures regarding animal care and treatment were reviewed and authorized by the Ethical Committee of Shiraz University of Medical Sciences (IR.SUMS.REC.1399.1361) and performed according to the Institutional and National Guide for the Care and Use of Laboratory Animals. Moreover, the experimental procedures and animal use were designed based on the NIH and ARRIVE guidelines.

Animal Care and Experimental Design

Forty adult female Balb/c mice, 20-25 g weight and 6-8 weeks old, were provided by Animal House, Shiraz University of Medical Sciences, Shiraz, Iran. All animals were housed in a standard condition including 22-24 °C with 12 h light/12 h dark cycles and access to standard chow and water ad libitum. The mice were kept for two weeks before experiments began to adapt to the laboratory conditions. Subsequently, animals were randomly assigned to four groups each containing 10 mice, and treated as follows: controls (Con, received normal saline), Acr (received 50 mg/Kg/day acrylamide), Acr+Tau75 (received 50 mg/Kg/day acrylamide and 75 mg/Kg/day taurine), and Acr+Tau150 (received 50 mg/Kg/day acrylamide and 150 mg/Kg/day taurine). Normal saline, acrylamide, and taurine were administrated for 35 days orally by gavage directly into the stomach via a precise dosing approach to ensure accurate dose control. Finally, animals were sacrificed by cervical dislocation technique, and ovaries were removed. The right ovary removed from each animal was stored at -80 °C for further gene expression analysis while the left ovary was preserved in formalin for immunofluorescence experiments (Alaee, Khodabandeh et al. 2024).

RNA Extraction and Gene Expression Analysis

RNX-Plus Solution (SinaClon, Iran; Cat. No. EX6101) was used to extract total RNA and RevertAid First Strand cDNA synthesis kit (Fermentas, Thermo Fisher Scientific, Waltham, MA, USA; Cat. No. K1622) was used for first-strand cDNA synthesis. All procedures were performed according to the manufacturer's protocols. The current study benefited from real-time quantified polymerase chain reaction (RT-qPCR) for gene expression analysis. In this regard, 1 μL of each forward/reverse primer (specified primers for β-actin, GPx, SOD, CAT, BAX, BCL2L1, and Caspase3), 1 μL of synthesized cDNA template, and 12.5 μL of RealQ Plus 2× Master Mix Green low ROX (Amplicon, Odense, Denmark; Cat. No.: A324406) were mixed in a final volume of 25 μL. RT-qPCR was approached using ABI PRISM® 7500 Sequence Detection System (Applied Biosystems, Foster City, USA). Obtained data were normalized using β-actin as the housekeeping gene and the 2^−ΔΔCT technique was used to assess the levels of studied gene expressions (Alaee, Khodabandeh et al. 2024). Table 1 describes the sequences of primers and the obtained product size.

Table 1. The sequences of primers used for RT-qPCR.

Genes	Primer Sequences		Product Size
*GPx1*	F (5′–3′)	CAGGAGAATGGCAAGAATGAAGAG	136 bp
	R (5′–3′)	GGAAGGTAAAGAGCGGGTGA
*Sod1*	F (5′–3′)	GGGTTCCACGTCCATCAGTAT	121 bp
	R (5′–3′)	GGTCTCCAACATGCCTCTCTT
*Cat*	F (5′–3′) R (5′–3′)	CTCAGGTGCGGACATTCTACA AATTGCGTTCTTAGGCTTCTCAG	206 bp
*Bcl2l1*	F (5′–3′)	GCAGGTATTGGTGAGTCGGA	130 bp
	R (5′–3′)	CTCGGCTGCTGCATTGTTC
*Bax*	F (5′–3′)	TGGAGATGAACTGGACAGCAAT	155 bp
	R (5′–3′)	TAGCAAAGTAGAAGAGGGCAACC
*Caspase3*	F (5′–3′)	TGACTGGAAAGCCGAAACTC	122 bp
	R (5′–3′)	AGCCTCCACCGGTATCTTCT
*β-actin*	F (5′–3′)	AGTGTGACGTTGACATCCGT	120 bp
	R (5′–3′)	TGCTAGGAGCCAGAGCAGTA

Immunofluorescence Staining of Stress-Related Proteins

The removed ovarian tissue from each animal was fixed and embedded in paraffin and then 5 μm thickness serial sections were provided. The paraffinization of obtained slices was done for 30 min at 60°C, hydrated, and then rinsed in PBS following microwave in antigen unmasking solution. Finally, samples were incubated at 24 °C for 30 min with Triton 100× (Sigma, UK), rinsed in PBS, and to block nonspecific sites tissues were submerged at 24 °C for 30 min in goat serum (Biowest, S2000-100).

In the next step, the prepared sections were adjacented with specific primary antibodies against GPx: SC133160 (ORB688926), SOD: ORB67357 (ORB688926), and CAT: (1:100 dilution) ORB538719 (ORB688925). After overnight incubation at 4°C in a wet chamber, the signals in the dark were observed with goat anti-mouse (ab6785, IgG, 1:200 dilution) secondary antibody. DAPI was used for nucleus staining (Sigma, UK, 5 g/mL) followed by rinsing with PBS and the examination using a fluorescence microscope (Olympus, BX51, Japan). Ultimately, the Nis-Elements BR 3.0 system (Nikon) and the study benefited from color segmentation analysis to calculate the total number of pixels for the total area and to measure immunofluorescence. Moreover, Image J software was used to measure the intensity of the fluorescence. The obtained data regarding the fluorescence emission was normalized according to Cons' fluorescence emission. In addition, background fluorescence values were omitted before the statistical analysis (Alaee, Khodabandeh et al. 2024).

TUNEL Assay

The prepared sections were dewaxed and rehydrated by decreasing ethanol concentrations and rinsed with PBS. Next, sections were adjacent for 10 min to proteinase K solution (50 μL apoptosis-grade water and 1 μL proteinase K) and ultimately rinsed with PBS and exposed to a labeling reaction mixture for 2 h at 37°C in a humid chamber and darkness (1:10 ratio of TUNEL enzyme solution and labeling solution)(Khodabandeh, Dolati et al. 2021).

Statistical analysis

The statistical package for the social sciences (SPSS version 24.0. SPSS Inc., Chicago, IL, USA) and GraphPad Prism 8 were used for the statistical analysis of data and preparing graphs. All obtained data are represented as mean ± standard deviation (SD). One-way analysis of variance (ANOVA) test followed by a post hoc Tukey test was used to compare studied groups. A p-value<0.05 was considered significant.

Tau Improved the Expression of Genes Involved in Response to Stress

The current study benefited from the RT-qPCR technique to analyze the levels of expression of the genes encoding GPx, SOD, and CAT (Figure 1). The obtained results revealed that Acr caused a significant decrease of 77.7%, 78.1%, and 75.1% in the expression of GPx, SOD, and CAT, respectively when compared to controls (p <0.001). Administering Tau at a dose of 75 mg/Kg/day to the Acr-treated mice increased the expression of all three genes involved in response to oxidative stress, however, no significant difference was achieved (p >0.05). On the contrary, compared to the Acr group, Acr+Tau150 mice showed a significant increase of 2.8 times, 3.7 times, and 3.1 times in the ovarian expression of genes encoding GPx, SOD, and CAT, respectively (p <0.01).

Tau Restored the Expression of Proteins Involved in the Response to Stress

Immunofluorescence staining was performed to detect the expression of antioxidative enzymes in ovarian tissue (Figure 2). Comparing Acr-treated animals with controls in terms of the level of GPx, SOD, and CAT proteins in ovarian tissue showed a significant decrease of 75.6%, 69.8%, and 71.4%, respectively (p <0.001, Figure 3). Interestingly, the administration of Tau in both doses of 75 and 150 mg/Kg/day was able to significantly increase the ovarian level of GPx, SOD, and CAT proteins compared to the Acr group (p <0.01). Nevertheless, a significant difference (p <0.05) with the control group was obtained in terms of the level of all three proteins in both the Acr+Tau75 and Acr+Tau150 groups (Figure 4).

Tau Restored Acr-Induced Alteration in the Ovarian Expression of Apoptosis-Related Genes

Ovarian expression of three genes BCL2L2, BAX, and Caspase3 was measured to assess the level of apoptosis (Figure 5). The results demonstrated that Acr caused a significant increase of 4.6 times and 3.7 times in the expression of BAX and Caspase3 genes compared to the controls (p <0.001), while the expression of the BCL2L2 gene showed a significant decrease of 82.7% when the Acr-treated animals were compared with the controls (p <0.001). Importantly, administration of both doses of 75 and 150 mg/Kg/day of Tau to mice treated with Acr significantly increased the expression of BCL2L2 in the ovary (p <0.01), although a significant difference was found with the controls (p <0.05). Meanwhile, the two selected doses of Tau caused the ovarian expression of BAX and Caspase3 genes to decrease significantly compared to the Acr group (p <0.05).

Tau Inhibited Acr-Induced Apoptosis in Ovarian Tissue

The findings showed that Acr caused a significant increase of 3.9 times in apoptosis levels in ovarian tissue (Figure 6, p <0.001). However, Tau in both studied doses caused the inhibition of Acr-induced apoptosis in the ovarian tissue of mice (p <0.01). Nonetheless, a significant difference was found in terms of the level of apoptosis in groups Acr+Tau75 and Acr+Tau150 with the controls (p <0.05).

The present findings demonstrated that in the ovaries of mice treated with Acr, the expression of three genes involved in response to oxidative stress, including GPx, SOD, and CAT, was significantly reduced. Similarly, the results of immunostaining revealed that the levels of these three proteins in the ovaries of mice exposed to Acr were remarkably decreased. Toxicity caused by exposure to Acr has been described as a global concern as it may cause tissue damage by changing the intracellular redox state and initiating apoptosis (Tepe and Çebi 2019). Numerous studies in animals and humans have shown that exposure to Acr is accompanied by damage to the ovaries and testes, resulting in impaired fertility in both genders (ALKarim, ElAssouli et al. 2015, Katen and Roman 2015, Katen, Chambers et al. 2016). Therefore, recent investigations have suggested natural chemicals with antioxidant properties as a novel strategy to prevent reproductive toxicity caused by Acr. The present study aimed to investigate the palliative effects of two different doses of Tau on ovarian toxicity caused by Acr by measuring the status of enzymes involved in stress response and the state of apoptosis.

These three enzymes are among the main enzymes involved in converting ROS into non-reactive products and maintaining intracellular redox homeostasis (He, He et al. 2017). A Plethora of evidence has demonstrated that the passage of Acr through the cell membrane is accompanied by overproduction of ROS, changes in the signaling pathways that regulate the stress response, and a decrease in the activity of enzymes involved in ROS Scavenging (Seydi, Rajabi et al. 2015, Yilmaz, Yildizbayrak et al. 2017, Pan, Wu et al. 2018, Zhao, Zhang et al. 2022). Interestingly, both studied doses of Tau significantly increased the expression level of genes encoding GPx, SOD, and CAT, as well as the protein level of these enzymes. Strengthening antioxidant defense systems is one of the most important mechanisms by which natural compounds provide their antioxidant properties (Samare-Najaf, Zal et al. 2022). Previously, the antioxidant properties of Tau have been assumed to be involved in the ability of this natural antioxidant to protect against reproductive toxicity (MA El-Agousa, E El-Nashar et al. 2008, Aly and Khafagy 2014, Kalender, Apaydin et al. 2019). Scavenging excessive intraovarian ROS levels may improve the steroidogenic activity of ovaries and thus preserve female reproductive ability (Luderer 2014, Barberino, Silva et al. 2023).

In addition, ROS threatens cell life since interacts with macromolecules such as membrane lipids and intranuclear DNA and triggers apoptosis, a process known as oxidative damage (Lin, Peng et al. 2021, Rose, Moraes et al. 2021). Therefore, Upregulating enzymes involved in the antioxidant defense system may prevent the induction of cell death in the tissues by eliminating ROS (Liang, Gao et al. 2023, Dara, Nazari et al. 2024). For further clarification, the present study investigated the expression of anti-apoptotic and pro-apoptotic genes along with the level of apoptosis in ovarian tissue. The findings revealed that Acr exposure caused a significant reduction in BCL2L2 expression while remarkably increasing BAX and Caspase3 expressions. In humans, the BCL2L2 gene on chromosome 14 encodes a 193-amino acid protein that functions as an antiapoptotic factor (Hartman and Czyz 2020), whereas both BAX and Caspase3 are considered mediators of apoptosis-related cell death (Cregan, MacLaurin et al. 1999, Asadi, Taghizadeh et al. 2022). Concordantly, the findings obtained from the TUNEL assay showed that the level of apoptosis in the ovarian tissue of mice exposed to Acr significantly increased. The ovary contains a permanent number of primordial follicles, which are described as the ovarian pool, and their development during each sexual cycle determines the fertility ability of females (Dolmans, Hossay et al. 2021). Several studies have shown that female reproductive toxicity after exposure to chemotherapeutics (e.g. doxorubicin and cyclophosphamide) (Samare-Najaf, Zal et al. 2020, Kim and You 2021) or environmental toxins (e.g. pesticides) (Sharma, Singh et al. 2020) is accompanied by induction of apoptosis, damage to ovarian reserve, loss of steroidogenesis, altogether lead to infertility. The application of natural antioxidants such as quercetin (Chen, Zhao et al. 2022), resveratrol (Mohammadi, Alaee et al. 2023), and curcumin (Yan, Dai et al. 2018) as well as different endogenously synthesized compounds and vitamins such as L-carnitine (Madkour, Ahmed et al. 2022), L-arginine (Abdel-Rhman, Morsy et al. 2023), N‐acetylcysteine, and vitamin E (Raeeszadeh, Saleh Hosseini et al. 2022) have been widely suggested to prevent reproductive toxicity.

The present findings showed that the administration of both doses of Tau was accompanied by the overexpression of the antiapoptotic gene BCL2L2, the suppression of the expression of the proapoptotic genes BAX and Caspase3, and the inhibition of apoptosis caused by exposure to Acr in the ovaries of mice. Accordingly, Elsawi et al (Elsawi, Abo Kresha et al. 2023) have revealed that Tau was able to protect against Acr-induced ovarian toxicity via modification of the AKT1siganlling pathway. In addition, previous studies have documented that Tau administration prevented reproductive toxicity by improving oxidative stress status, modulating intracellular signaling pathways, and preventing cell death (Kalender, Apaydin et al. 2019, Baliou, Adamaki et al. 2021, Busi, Yigitaslan et al. 2023).

The present findings showed that exposure to Acr induced of oxidative stress and apoptosis-mediated cell death in ovarian tissue. However, the coadministration of Tau with Acr resulted in an improved oxidative status and inhibition of apoptosis in the ovarian tissue. Therefore, this study suggests that taurine possesses promising properties for the prevention of acrylamide-induced ovarian toxicity. Further research is recommended to substantiate these findings.

Ethics approval and consent to participate

The experimental protocol was approved by the ethical committee of Shiraz University of Medical Sciences (IR.SUMS.REC.1399.1361) and performed according to the Institutional and National Guide for the Care and Use of Laboratory Animals.

Consent for publication: Not applicable

Availability of data and materials

All data generated or analyzed during this study are included in this published article

Competing interests: the authors declare that they have no competing interests

Acknowledge: The study has been supported by the Shiraz University of Medical Sciences, Shiraz, Iran; (Project number: 22879)

Authors' contributions

Z.Kh. and S.A.; Conceptualisation, Methodology, Performing experiment, Sample preparation and Supervision. M.S.N and E.H., Analysis, and drafted the manuscript. M.D., S.Sh., R.Sh.; Formal analysis and Investigation. All authors read and approved the final manuscript.

Abdel-Rhman, A., W. Morsy, N. Selim and E. A. Abdel-Hady (2023). "L-arginine supplementation attenuates ovarian oxidative stress in female rats subjected to chronic intermittent hypoxia." Physiol Int 110(4): 326-341.
Adedara, I. A., A. V. Ileola-Gold, U. A. Adelaja, C. A. Njoku, C. N. Ikeji, O. Owoeye and E. O. Farombi (2024). "Exogenous taurine administration abates reproductive dysfunction in male rats exposed to silver nanoparticles." Environ Toxicol 39(1): 61-74.
Alaee, S., Z. Khodabandeh, M. Dara, E. Hosseini and M. Sharma (2024). "Curcumin mitigates acrylamide-induced ovarian antioxidant disruption and apoptosis in female Balb/c mice: A comprehensive study on gene and protein expressions." Food Sci Nutr 12(6): 4160-4172.
Alaee, S., M. Mirani, Z. Derakhshan, F. Koohpeyma and A. Bakhtari (2023). "Thymoquinone improves folliculogenesis, sexual hormones, gene expression of apoptotic markers and antioxidant enzymes in polycystic ovary syndrome rat model." Vet Med Sci 9(1): 290-300.
ALKarim, S., S. ElAssouli, S. Ali, N. Ayuob and Z. ElAssouli (2015). "Effects of low dose acrylamide on the rat reproductive organs structure, fertility and gene integrity." Asian Pacific Journal of Reproduction 4(3): 179-187.
Aly, H. A. and R. M. Khafagy (2014). "Taurine reverses endosulfan-induced oxidative stress and apoptosis in adult rat testis." Food Chem Toxicol 64: 1-9.
Asadi, M., S. Taghizadeh, E. Kaviani, O. Vakili, M. Taheri-Anganeh, M. Tahamtan and A. Savardashtaki (2022). "Caspase-3: Structure, function, and biotechnological aspects." Biotechnol Appl Biochem 69(4): 1633-1645.
Bachir, N., H. Akkoum, M. Pujola, F. Sepulcre and A. Haddarah (2024). "Impact of amino acids and sugars after thermal processing on acrylamide formation in synthetic potato models and real potatoes." Food Sci Nutr 12(2): 1046-1055.
Baliou, S., M. Adamaki, P. Ioannou, A. Pappa, M. I. Panayiotidis, D. A. Spandidos, I. Christodoulou, A. M. Kyriakopoulos and V. Zoumpourlis (2021). "Protective role of taurine against oxidative stress (Review)." Mol Med Rep 24(2): 1-19.
Barberino, R. S., R. L. S. Silva, R. C. Palheta Junior, J. E. J. Smitz and M. H. T. Matos (2023). "Protective Effects of Antioxidants on Cyclophosphamide-Induced Ovarian Toxicity." Biopreserv Biobank 21(2): 121-141.
Busi, M. C., S. Yigitaslan, Z. Kaltus, N. Harmanci, E. Eroglu, O. Ozatik and C. Kaya (2023). "The protective effect of taurine on cyclophosphamide-induced testicular toxicity in rats." Pak J Pharm Sci 36(5(Special)): 1671-1676.
Chen, Y., Y. Zhao, C. Miao, L. Yang, R. Wang, B. Chen and Q. Zhang (2022). "Quercetin alleviates cyclophosphamide-induced premature ovarian insufficiency in mice by reducing mitochondrial oxidative stress and pyroptosis in granulosa cells." J Ovarian Res 15(1): 138.
Cregan, S. P., J. G. MacLaurin, C. G. Craig, G. S. Robertson, D. W. Nicholson, D. S. Park and R. S. Slack (1999). "Bax-dependent caspase-3 activation is a key determinant in p53-induced apoptosis in neurons." Journal of Neuroscience 19(18): 7860-7869.
Dara, M., F. Nazari, M. Dianatpour, F. Karimi, S. Alaee, R. J. C. B. Shirazi and Biophysics (2024). "Effect of Sunset Yellow on Testis: Molecular Evaluation, and Protective Role of Coenzyme Q10 in Male Sprague-Dawley Rats." 1-9.
Dolmans, M.-M., C. Hossay, T. Y. T. Nguyen and C. Poirot (2021). "Fertility preservation: how to preserve ovarian function in children, adolescents and adults." Journal of clinical medicine 10(22): 5247.
Duan, X., Q.-C. Wang, K.-L. Chen, C.-C. Zhu, J. Liu and S.-C. Sun (2015). "Acrylamide toxic effects on mouse oocyte quality and fertility in vivo." Scientific reports 5(1): 11562.
Elsawi, N. M., S. A. T. Abo Kresha, M. A. Mohamed, A. Khorshed, W. A. Aldajani, E. Hawuit and S. Ali (2023). "Taurine Ameliorates Toxicity Induced by Acrylamide in Wistar Albino." Egyptian Journal of Chemistry 66(4): 25-34.
Gao, Q., Y. Xue, X. Yuan, H. Gao and C. Wu (2023). "Dietary exposure to acrylamide of university students in Ningxia of Northwest China and the effect on their neurobehavioral performance and oxidative stress in serum." Food Science & Nutrition 11(2): 661-667.
Guarnotta, V., R. Amodei, F. Frasca, A. Aversa and C. Giordano (2022). "Impact of Chemical Endocrine Disruptors and Hormone Modulators on the Endocrine System." Int J Mol Sci 23(10): 5710.
Hartman, M. L. and M. Czyz (2020). "BCL-w: apoptotic and non-apoptotic role in health and disease." Cell Death Dis 11(4): 260.
Hassan, S., A. Thacharodi, A. Priya, R. Meenatchi, T. A. Hegde, R. Thangamani, H. Nguyen and A. Pugazhendhi (2024). "Endocrine disruptors: Unravelling the link between chemical exposure and Women's reproductive health." Environmental Research 241: 117385.
He, L., T. He, S. Farrar, L. Ji, T. Liu and X. Ma (2017). "Antioxidants Maintain Cellular Redox Homeostasis by Elimination of Reactive Oxygen Species." Cell Physiol Biochem 44(2): 532-553.
Ibrahim, A. F., L. M. Hafez and A. B. Yousif (2020). "Protective role of polyphenols (anthocyanin, gallic acid) and blackberry juice against acrylamide reproductive toxicity in male rats." International Journal of Progressive Sciences and Technologies 23(2): 292-300.
Ivanski, F., V. M. de Oliveira, I. M. de Oliveira, A. T. de Araujo Ramos, S. T. de Oliveira Tonete, G. de Oliveira Hykavei, P. Bargi-Souza, D. L. Schiessel, A. J. Martino-Andrade, M. A. Romano and R. Marino Romano (2020). "Prepubertal acrylamide exposure causes dose-response decreases in spermatic production and functionality with modulation of genes involved in the spermatogenesis in rats." Toxicology 436: 152428.
Kalender, S., F. G. Apaydin and Y. Kalender (2019). "Testicular toxicity of orally administrated bisphenol A in rats and protective role of taurine and curcumin." Pak J Pharm Sci 32(3): 1043-1047.
Katen, A. L., C. G. Chambers, B. Nixon and S. D. Roman (2016). "Chronic Acrylamide Exposure in Male Mice Results in Elevated DNA Damage in the Germline and Heritable Induction of CYP2E1 in the Testes." Biol Reprod 95(4): 86.
Katen, A. L. and S. D. Roman (2015). "The genetic consequences of paternal acrylamide exposure and potential for amelioration." Mutat Res 777: 91-100.
Khodabandeh, Z., P. Dolati, M. J. Zamiri, D. Mehrabani, H. Bordbar, S. Alaee, I. Jamhiri and N. Azarpira (2021). "Protective Effect of Quercetin on Testis Structure and Apoptosis Against Lead Acetate Toxicity: an Stereological Study." Biol Trace Elem Res 199(9): 3371-3381.
Kim, J. and S. You (2021). "Extended adverse effects of cyclophosphamide on mouse ovarian function." BMC Pharmacol Toxicol 22(1): 3.
Liang, J., Y. Gao, Z. Feng, B. Zhang, Z. Na and D. Li (2023). "Reactive oxygen species and ovarian diseases: Antioxidant strategies." Redox Biol 62: 102659.
Lin, H., Y. Peng, J. Li, Z. Wang, S. Chen, X. Qing, F. Pu, M. Lei and Z. Shao (2021). "Reactive Oxygen Species Regulate Endoplasmic Reticulum Stress and ER-Mitochondrial Ca(2+) Crosstalk to Promote Programmed Necrosis of Rat Nucleus Pulposus Cells under Compression." Oxid Med Cell Longev 2021(1): 8810698.
Luderer, U. (2014). "Ovarian toxicity from reactive oxygen species." Vitam Horm 94: 99-127.
MA El-Agousa, I., D. E El-Nashar, S. S Eissa and M. N Sharoud (2008). "Possible ameliorative effect of antioxidant (Taurine) in pregnant toxemic female Rats." The Open Hypertension Journal 2(1).
Machtinger, R. (2018). "Endocrine-Disrupting Chemicals and Female Fertility." Emerging Topics in Reproduction: Volume 5: 133-142.
Madkour, H., S. Ahmed and W. I. Mohammed (2022). "L-carnitine ameliorates methotrexate-induced ovarian dysfunction in female rats." Records of Pharmaceutical and Biomedical Sciences 6(3): 14-27.
Martínez, M. Á., M. Marquès, A. Salas-Huetos, N. Babio, J. L. Domingo and J. Salas-Salvadó (2023). "Lack of association between endocrine disrupting chemicals and male fertility: a systematic review and meta-analysis." Environmental Research 217: 114942.
Megahed, E., D. Abdel Moawed, S. M. Abdel Aal, S. R. Mohamed, A. Talaat and G. M. Abdelaal (2024). "Ameliorative Effect of Taurine on Nandrolone Decanoate Induced Toxicity on Brain, Heart and Testis in Adult Male Albino Rats." Zagazig Journal of Forensic Medicine 22(1): 55-84.
Mohammadi, Z., S. Alaee, M. R. Namavar, Z. Khodabandeh, N. Ahmadi, N. Rashidipour, S. J. H. Karami-Mohajeri and E. Toxicology (2023). "The antioxidant properties of resveratrol on sperm parameters, testicular tissue, antioxidant capacity, and lipid peroxidation in isoflurane-induced toxicity in mice." 42: 09603271231215036.
Oliveira, M. W., J. B. Minotto, M. R. de Oliveira, A. Zanotto-Filho, G. A. Behr, R. F. Rocha, J. C. Moreira and F. Klamt (2010). "Scavenging and antioxidant potential of physiological taurine concentrations against different reactive oxygen/nitrogen species." Pharmacol Rep 62(1): 185-193.
Pan, X., X. Wu, D. Yan, C. Peng, C. Rao and H. Yan (2018). "Acrylamide-induced oxidative stress and inflammatory response are alleviated by N-acetylcysteine in PC12 cells: Involvement of the crosstalk between Nrf2 and NF-κB pathways regulated by MAPKs." Toxicology letters 288: 55-64.
Raeeszadeh, M., S. M. Saleh Hosseini and A. A. Amiri (2022). "Impact of Co-Administration of N-Acetylcysteine and Vitamin E on Cyclophosphamide-Induced Ovarian Toxicity in Female Rats." J Toxicol 2022(1): 9073405.
Rose, E., A. Moraes, T. Shiroma, N. Nitz, A. de Cássia Rosa, R. Pratesi, L. Hagström, J. L. de Carvalho and M. Hecht (2021). "Host DNA repair response to oxidative damage is modulated by Trypanosoma cruzi in a strain-dependent manner." Acta Tropica 224: 106127.
Saberi, R., A. Ahmadi, Z. Khodabandeh and S. Alaee (2022). "Effect of Taurine and Curcumin on In-Vitro Fertilization in NMRI Mice Treated with Acrylamide." Journal of Shahid Sadoughi University of Medical Sciences.
Samare-Najaf, M., A. Samareh, B. Namavar Jahromi, N. Jamali, S. Vakili, M. Mohsenizadeh, C. C. Clark, A. Abbasi and N. Khajehyar (2023). "Female infertility caused by organophosphates: an insight into the latest biochemical and histomorphological findings." Toxin Reviews 42(1): 419-446.
Samare-Najaf, M., F. Zal, N. Jamali, S. Vakili and Z. Khodabandeh (2022). "Do Quercetin and Vitamin E Properties Preclude Doxorubicin-induced Stress and Inflammation in Reproductive Tissues?" Current Cancer Therapy Reviews 18(4): 292-302.
Samare-Najaf, M., F. Zal and S. Safari (2020). "Primary and Secondary Markers of Doxorubicin-Induced Female Infertility and the Alleviative Properties of Quercetin and Vitamin E in a Rat Model." Reprod Toxicol 96: 316-326.
Seydi, E., M. Rajabi, A. Salimi and J. Pourahmad (2015). "Involvement of mitochondrial-mediated caspase-3 activation and lysosomal labilization in acrylamide-induced liver toxicity." Toxicological & Environmental Chemistry 97(5): 563-575.
Sharma, R. K., P. Singh, A. Setia and A. K. Sharma (2020). "Insecticides and ovarian functions." Environ Mol Mutagen 61(3): 369-392.
Surai, P. F., K. Earle-Payne and M. T. Kidd (2021). "Taurine as a natural antioxidant: From direct antioxidant effects to protective action in various toxicological models." Antioxidants 10(12): 1876.
Tepe, Y. and A. Çebi (2019). "Acrylamide in environmental water: a review on sources, exposure, and public health risks." Exposure and Health 11: 3-12.
Yaghutian Nezhad, L., H. Mohseni Kouchesfahani, S. Alaee and A. Bakhtari (2021). "Thymoquinone ameliorates bleomycin-induced reproductive toxicity in male Balb/c mice." Hum Exp Toxicol 40(12_suppl): S611-S621.
Yan, Z., Y. Dai, H. Fu, Y. Zheng, D. Bao, Y. Yin, Q. Chen, X. Nie, Q. Hao, D. Hou and Y. Cui (2018). "Curcumin exerts a protective effect against premature ovarian failure in mice." J Mol Endocrinol 60(3): 261-271.
Yilmaz, B. O., N. Yildizbayrak, Y. Aydin and M. Erkan (2017). "Evidence of acrylamide-and glycidamide-induced oxidative stress and apoptosis in Leydig and Sertoli cells." Human & experimental toxicology 36(12): 1225-1235.
Zhao, M., B. Zhang and L. Deng (2022). "The Mechanism of Acrylamide-Induced Neurotoxicity: Current Status and Future Perspectives." Front Nutr 9: 859189.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Taurine Alleviated Acrylamide-Induced Ovarian Toxicity via Suppression of Stress and Apoptosis in Mice

Status:

Version 1

Abstract

Figures

Introduction

Material and Methods

Results

Discussion

Conclusion

Declarations

References

Additional Declarations

Status:

Version 1