Tremella fuciformis polysaccharides alleviate early brain injury in experimental subarachnoid hemorrhage by inhibiting the KDR-mediated P38 MAPK/NF-κB pathway

doi:10.21203/rs.3.rs-4854391/v1

Download PDF

Research Article

Tremella fuciformis polysaccharides alleviate early brain injury in experimental subarachnoid hemorrhage by inhibiting the KDR-mediated P38 MAPK/NF-κB pathway

https://doi.org/10.21203/rs.3.rs-4854391/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Background

Subarachnoid hemorrhage is associated with high mortality and morbidity rates. In its early stages, the substantial influx of blood into the subarachnoid space triggers excessive activation of microglial cells, which markedly contributes to early brain injury, a pivotal determinant of poor prognosis. Tremella fuciformis polysaccharides, as acidic heteropolysaccharides from the fruiting bodies of Tremella, exhibit robust anti-inflammatory characteristics and a plethora of biological properties. Nonetheless, the impact of TFPS on EBI subsequent to SAH has yet to be documented, and the elucidation of its underlying molecular mechanisms remains elusive. The objective of this study is to elucidate the effects and potential mechanisms of TFPS on EBI in SAH.

Methods

We used in vivo and in vitro models to study TFPS effects on microglia post-SAH. Network pharmacology analysis predicted TFPS targets and intervention pathways. These predictions were subsequently corroborated through flow cytometry, Western blotting, Immunofluorescent, Enzyme-Linked Immunosorbent Assay, and Quantitative real‑time polymerase chain reaction, both in vivo and in vitro.

Results

After 24 hours, TFPS-treated mice showed improved neurological function and reduced cerebral edema post-SAH. TFPS reversed microglial activation, enhanced phagocytic capability, and reduced neuronal apoptosis. Network pharmacology identified KDR as a potential target, with the P38 MAPK pathway as the downstream pathway. TFPS attenuated KDR expression, inhibited the P38 MAPK/NF-κB pathway, reduced inflammatory cytokine expression, and improved microglial phagocytic capacity post-SAH.

Conclusion

This investigation posits that TFPS may ameliorate EBI in SAH, potentially via the regulation of the KDR-mediated P38 MAPK/NF-κB pathway and phagocytic function.

Subarachnoid hemorrhage

Tremella fuciformis polysaccharides

Microglia

KDR

P38 MAPK

NF-κB

Subarachnoid hemorrhage (SAH) represents a lethal category of stroke, characterized by high mortality and high morbidity rates^1,2. Research suggests that early brain injury (EBI) initiates immediately after SAH and persists for up to 72 hours, constituting a principal factor underpinning the unfavorable prognosis. EBI is predominantly characterized by neuroinflammatory responses, cerebral edema, and microcirculatory dysfunction. Accordingly, the development of novel therapies aimed at targeting EBI emerges as a primary objective in the therapeutic management of SAH patients. It is well-established that the pathogenesis of EBI encompasses a series of intricate pathophysiological processes. Neuroinflammatory responses play a pivotal role in EBI, primarily instigated by immune imbalance, entailing the excessive release of pro-inflammatory mediators and a diminution in anti-inflammatory cytokines. Prior studies have posited that the mitigation of neuroinflammation during EBI can facilitate the restoration of neurological functions in SAH³.However, in the treatment of subarachnoid hemorrhage, there is a lack of effective drugs to alleviate the inflammatory response of microglia.

Tremella fuciformis polysaccharides (TFPS) are acidic heteropolysaccharides physically derived from the fruiting bodies, spores, or spore fermentation broth of Tremella fuciformis, acting as its principal bioactive constituent⁴. Scientific inquiries have revealed that TFPS exhibits a plethora of biological properties, encompassing anti-tumor, immunomodulatory, anti-oxidative, anti-aging, brain memory damage repair, anti-inflammatory, hypoglycemic, and cholesterol-lowering effects⁵. Hitherto, scholarly explorations of TFPS have primarily focused on its role in attenuating inflammatory responses⁶. Therefore, we think TFPS is a promising intervention in the treatment of SAH. However, the function of TFPS in EBI remains uncharted, and the molecular mechanisms underpinning its anti-inflammatory effects are still nebulous.

The present investigation employed a murine subarachnoid hemorrhage model, and endeavors to elucidate the effect of TFPS in SAH. We harnessed the network pharmacology coupled with experimental validation methodologies to scrutinize the molecular mechanisms of TFPS alleviating microglial hyperactivation. We uncovered a novel target, KDR, for TFPS during the progression of SAH, and authenticated that the p38 MAPK/NF-κB pathway is implicated in EBI. Concurrently, these discoveries augmented our comprehension of the mechanisms and therapeutic strategies for EBI after SAH, tendering fresh perspectives for the establishment of multi-target and multi-pathway treatment stratagems for this malady. The findings suggest that TFPS holds substantial promise for the treatment of EBI after SAH.

2.1 Animals preparation

The present investigation employed adult male C57 BL/6J mice, with body weights ranging from 25 to 28 grams, acquired from the Experimental Animal Center of Second Affiliated Hospital of Soochow University. All experimental protocols and procedures received the approval of the Institutional Animal Care and Use Committee (IACUC) of Second Affiliated Hospital of Soochow University and were in strict compliance with the National Institutes of Health (NIH) guidelines for the care and use of laboratory animals. The mice underwent acclimatization to a 12-hour light/dark cycle environment, enjoying unrestricted access to food and water, amidst conditions of regulated humidity and temperature (24 ± 0.5°C).

2.2 Models of SAH and experimental design

The experimental SAH model employed in this study adheres to the methodologies delineated in prior research⁷. The procedural steps were meticulously executed as follows: Initially, mice were rendered unconscious through the inhalation of 3% isoflurane for induction, followed by a maintenance dose of 1.5% isoflurane (RWD Life Science, Shenzhen), and subsequently immobilized within a stereotaxic apparatus. The scalp was then disinfected, and a 1.0 cm longitudinal incision was carefully made to reveal the skull. A precisely measured 1.0 mm diameter borehole was created at a locus 4.5 mm anterior to the bregma, situated along the midline. Concurrently, a mouse was served as an arterial blood donor via left ventricular cardiac puncture. Subsequently, 50 µl of the harvested arterial blood was delicately injected into the prechiasmatic cistern via the previously fashioned borehole, ensuring the needle remained in situ for a minimum of 2 minutes to obviate any backflow of blood or cerebrospinal fluid (CSF) leakage. For the sham-operated cohort, an analogous procedure was enacted, albeit with an injection of a saline solution mimicking the volume of blood. Post-operatively, all mice were afforded a recovery period of 45 minutes prior to being rehoused in their enclosures, where they were maintained in an environment with a controlled temperature of 24.0 ± 0.5°C.

2.3 Cell culture

To procure primary microglia cells, cortical tissues from newborn mice were meticulously collected and subjected to enzymatic digestion within a 24-hour postnatal window. This animal-based study was sanctioned by the Animal Ethics Review Committee of Nanjing Drum Tower Hospital. Under the scrutiny of a microscope, the meninges were carefully excised, followed by digestion with TrypLE in a temperature-controlled incubator set at 37°C for a duration of 10 minutes. Dulbecco's Modified Eagle Medium (DMEM, C11995500BT, Gibco, CA, USA) supplemented with 10% Fetal Bovine Serum (FBS, 10099141, Gibco, CA, USA) and 1% penicillin-streptomycin (10378016, Gibco, CA, USA) was utilized to nurture primary microglia cells in vitro for 10 days and 13 days respectively. Upon gently agitating the culture dish, the microglia cells ascended to the surface and were subsequently translocated to a fresh culture dish. BV2 (ZQ0397, Zhong Qiao Xin Zhou Biotechnology, Shanghai, China), a microglial cell line, was cultured in Modified Eagle Medium (MEM, C12571500BT, Gibco, CA, USA) enriched with 10% FBS and 1% penicillin, with media refreshed on alternate days.

2.4 Oxyhemoglobin‑induced SAH model in vitro

To emulate the conditions of SAH in vitro, primary microglia and BV2 cells were subjected to an exposure of hemoglobin (Hb), obtained from bovine erythrocytes (Sigma, St. Louis, MO, USA), at a concentration of 10 µmol/L.

2.5 Network pharmacology

2.5.1 Drug-disease target prediction.

First, search for the structural information of Tremella polysaccharides in the PubChem database (https://pubchem.ncbi.nlm.nih.gov). Once the structure of Tremella polysaccharides is obtained, import it into the Swiss Target Prediction platform (http://swisstargetprediction.ch) to predict the potential targets of Tremella polysaccharides. Next, retrieve target information related to subarachnoid hemorrhage by entering the keyword "subarachnoid hemorrhage" in the GeneCards (https://www.genecards.org/), OMIM (https://omim.org/), and DisGeNET (https://www.disgenet.org/) databases. Integrate all targets from these three databases and remove duplicate genes. Subsequently, use the UniProt database to validate these gene informations to ensure data accuracy. Map the targets of Tremella polysaccharides obtained from the Swiss Target Prediction platform to the targets obtained from the disease databases. Use a Venn diagram to visualize the intersection of these targets. Finally, use Cytoscape 3.8.2 software to construct a "drug-component-target" network to more intuitively display the relationship between Tremella polysaccharides and targets related to subarachnoid hemorrhage.

2.5.2 Construction of target protein interaction network

Upload the data of the drug and intersecting genes to the STRING database (https://string-db.org/) to construct a Protein-Protein Interaction (PPI) network. Select "Homo sapiens" as the species and set the minimum interaction score to 0.4 to ensure the reliability of the research results. Keep other parameters at their default settings, ultimately generating a protein-protein interaction network graph.

2.5.3 GO enrichment analysis and KEGG pathway analysis

Upload the data of the drug and disease intersecting genes to the DAVID database (https://david.ncifcrf.gov/summary.jsp), select the gene identifier as OFFICIAL_GENE_SYMBOL, and set the species to "Homo Sapiens". Use the GO gene function annotation tool of DAVID 6.8 to analyze in detail the specific roles of the target proteins of Tremella polysaccharide in treating subarachnoid hemorrhage from three aspects: Biological Process (BP), Cellular Component (CC), and Molecular Function (MF). To further clarify the role of the targets of Tremella polysaccharide in treating subarachnoid hemorrhage in signaling pathways, perform KEGG pathway enrichment analysis. Through this analysis, the main gene function enrichment processes and signaling pathways in the treatment of subarachinoid hemorrhage with Tremella polysaccharide can be revealed, thereby predicting the mechanism of action of the drug in treating subarachnoid hemorrhage.

2.6 Neurologic function testing

Adhering to established research protocols, the modified Garcia JH scoring system is utilized to assess the neurological function of mice at intervals of 6, 12, and 24 hours subsequent to SAH. This evaluation methodically examines six dimensions: spontaneous movement, postural symmetry, forelimb extension function, climbing ability, bilateral tactile sensation, and bilateral whisker touch response, to ascertain the degree of neurological impairment in mice. Scoring parameters extend from 3 to 18 points, where elevated scores denote less severe neurological impairments, and an optimal score of 18 signifies a normal condition. Neurological evaluations are performed by two independent observers under blinded conditions to maintain the assessments' impartiality. Furthermore, mice from the Sham group scoring ≤ 15 and those from other groups scoring ≥ 15 are systematically excluded to safeguard the accuracy of the experimental outcomes.

2.7 Water content

Following the decapitation of the mice, the intact brain is meticulously dissected and segmented into two hemispheres. Subsequently, each hemisphere is precisely weighed to document its initial wet weight. Thereafter, the hemispheres are positioned within an oven and subjected to continuous drying for 24 hours to eliminate moisture. Upon completion of the drying process, the hemispheres are again weighed to ascertain their dry weight. The formula employed to compute the water content percentage is as follows: Water Content Percentage = ((Wet Weight - Dry Weight) / Wet Weight) × 100%. This methodology guarantees the precise quantification of water content within the brain tissue.

2.8 Rotarod test

Mice aged 6–7 weeks were pre-trained on a rotarod fatigue meter (YY920-YLS-4D, Beijing, China) with two trials per day for three consecutive days (speed ranging from 10 to 40 rpm over 300 seconds). After each trial, the mice were returned to their cages for a minimum rest period of 15 minutes before the next trial. The same procedure was employed during the testing phase, with a maximum test duration set at 300 seconds; any duration exceeding 300 seconds was recorded as 300 seconds. Following pre-training, all groups of mice underwent SAH modeling, and different concentrations of TFPS were administered 6 hours post-SAH induction. The SAH and Sham groups received an equivalent volume of saline, and rotarod tests were conducted 24 hours later

2.9 Western Blotting

For the lysis of brain tissue or cells, RIPA lysis buffer (89,901, Thermo Scientific, MA, USA) is employed, supplemented with 1% protease inhibitor (GRF101, Epizyme, Shanghai, China) and 1% phosphatase inhibitor (GRF102, Epizyme, Shanghai, China). Subsequently, the protein concentration is quantified using the BCA Protein Assay Kit (P0012S, Beyotime, Nanjing, China). Protein separation is facilitated by the PAGE Gel Fast Preparation Kit (PG111 & PG113, Epizyme, Shanghai, China), followed by electrophoretic transfer of the separated proteins onto a polyvinylidene difluoride membrane (3,010,040,001, Sigma, MO, USA). Following transfer, the membrane is blocked using 5% non-fat milk at room temperature for two hours, and subsequently incubated with primary antibodies overnight at 4℃. On the subsequent day, the membrane is rinsed with TBST and then incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies at room temperature for two hours. Ultimately, protein bands are detected using the developing solution (WBKLS0500, Sigma, MO, USA) and analyzed via Image J software (National Institutes of Health). The antibodies used are listed in Table 1.

Table 1

Antibodies used in the study
Protein	Product code	Application	Dilution ratio	Company	Affiliating area
Iba-1	019-19741	WB IF	1:1000 1:200	Wako	Osaka, Japan
Hb	sc-390668	WB IF	1:500 1:100	Santa Cruz Biotechnology	Dallas, USA
Bcl-2	12789-1-AP	WB	1:1000	Proteintech	Wuhan, China
Bax	A12009	WB	1:1000	ABclonal	Wuhan, China
CC3	9664	WB	1:1000	Cell Signaling Technology	MA, USA
Trem2	AB245227	IF	1:200	abcam	London, UK
CD86	13395-1-AP	WB IF	1:1000 1:200	Proteintech	Wuhan, China
CD206	18704-1-AP	WB IF	1:1000 1:200	Proteintech	Wuhan, China
KDR	26415-1-AP	WB IF	1:1000 1:200	Proteintech	Wuhan, China
P38	8690	WB	1:1000	Cell Signaling Technology	MA, USA
p-P38	9215	WB	1:1000	Cell Signaling Technology	MA, USA
NF-κB	8242	WB	1:1000	Cell Signaling Technology	MA, USA
p-NF-κB	3033	WB	1:1000	Cell Signaling Technology	MA, USA
ERK1/2	67170-1-Ig	WB	1:1000	Proteintech	Wuhan, China
p-ERK1/2	AP0472	WB	1:1000	ABclonal	Wuhan, China
JNK	66210-1-Ig	WB	1:1000	Proteintech	Wuhan, China
p-JNK	AP0631	WB	1:1000	ABclonal	Wuhan, China
β-Actin	AC026	WB	1:5000	ABclonal	Wuhan, China
β-Tubulin	10094–1-AP	WB	1:5000	Proteintech	Wuhan, China
GADPH	60004-1-Ig	WB	1:5000	Proteintech	Wuhan, China
Anti-rabbit IgG, HRP-linked Antibody	SA00001-2	WB	1:5000	Proteintech	Wuhan, China
Anti-mouse IgG, HRP-linked Antibody	SA00001-1	WB	1:5000	Proteintech	Wuhan, China

2.10 Quantitative real‑time polymerase chain reaction

Total mRNA is isolated utilizing the Total RNA Extraction Reagent (R401-01, Vazyme, Nanjing, China). Subsequently, the mRNA is transcribed into cDNA using the reverse transcription mix (R223-01, Vazyme, Nanjing, China). Quantitative PCR (qPCR) is conducted employing the SYBR Green Master Mix (Q331, Vazyme, Nanjing, China). The results are analyzed utilizing the 2^−△△Ct method and normalized to the quantity of GADPH. The primers employed are enumerated in Table 2.

Table 2

Primers used in the study
Primer	Forward primer	Reverse primer
KDR	TTTGGCAAATACAACCCTTCAGA	GCAGAAGATACTGTCACCACC
IL-1β	GCAACTGTTCCTGAACTCAACT	ATCTTTTGGGGTCCGTCAACT
IL-6	TAGTCCTTCCTACCCCAATTTCC	TTGGTCCTTAGCCACTCCTTC
TNF-α	GACGTGGAACTGGCAGAAGAG	TTGGTGGTTTGTGAGTGTGAG
GADPH	AGGTCGGTGTGAACGGATTTG	TGTAGACCATGTAGTTGA GGTCA

2.11 Immunofluorescent staining

Frozen sections of 10µm thickness/cells are consolidated with 4% paraformaldehyde (P0099, Beyotime, Nanjing, China). Subsequently, 0.1% Triton X-100 (X100, Sigma, MO, USA) is employed for permeabilization to augment antibody penetration. Then, Immunology Staining Blocking Buffer (P0102, Beyotime, Nanjing, China) is utilized to obstruct non-specific binding. Following the blocking process, the sections/cells are incubated with primary antibodies overnight at 4°C to ascertain adequate binding to target proteins. On the subsequent day, they are incubated with the appropriate secondary antibodies. The nucleic acid dye, 4,6-diamidino-2-phenylindole (DAPI, 62,248, Thermo Fisher Scientific, MA, USA), is employed for a 10-minute staining of the cells. Upon completion of immunofluorescence staining, high-definition images are procured under a Leica Thunder microscope. Subsequently, ImageJ software (NIH, USA) is employed for counting and analyzing the intensity of the immunofluorescent cells. The exhaustive details of the antibodies utilized are enumerated in Table 1.

2.12 Terminal deoxynucleotidyl transferase–mediated dUTP nick end labelling

In accordance with the manufacturer's guidelines, TUNEL staining is conducted on frozen brain sections utilizing the TUNEL detection kit (C1089, Beyotime, Nanjing, China). The protocol entails the following steps: Initially, the slides are incubated with anti-NeuN primary antibody (1:200, 24307, Cell Signaling Technology) overnight at 4°C to ensure adequate binding to NeuN protein. On the subsequent day, they are incubated with the corresponding secondary antibody at room temperature for one hour. Subsequently, 1µl of TdT enzyme is diluted five-fold and blended with 45 µl of labeling solution, ensuring ample mixture for each section. Each section is then incubated with the mixture at room temperature for 30 minutes to facilitate the TUNEL reaction. Upon completion of TUNEL staining, the sections are imaged using a Leica Thunder microscope to acquire high-quality images. Subsequently, ImageJ software is employed to analyze the whole brain NeuN + TUNEL+/NeuN + ratio (n = 6) to evaluate the extent of apoptosis.

2.13 Flow cytometry

HT22 cells are subjected to incubation with Dil cell membrane red fluorescent staining reagent (C1991S, Beyotime, Nanjing, China) under dark conditions for 15 minutes; the cells are subsequently harvested and fragmented utilizing an ultrasonic cell disruptor. The cell fragments are solubilized in DMEM (1:100) and incubated within Bv2 for one hour, followed by digestion with trypsin and two washes with PBS. The expression of red fluorescence in the cell fragments is assessed using a Flow cytometer (BD Accuri™ C6 Plus, NJ, USA).

2.14 Enzyme-linked immunosorbent assay

ELISA kits procured from ABclonal Biotechnology Co., Ltd. were employed to quantify brain tissue levels of IL-1β, IL-6, and TNF-α, adhering to the manufacturer’s protocol.

2.15 RNA interference

BV2 cells are transfected with plasmids harboring KDR-specific shRNA to facilitate RNA interference. Preliminary experiments ascertained the optimal concentrations of the plasmid and Lipofectamine (L3000015, Thermo Fisher Scientific, MA, USA). Cells were subsequently analyzed 24 hours post-transfection. The sequences for KDR shRNA and the negative control (NC) are delineated as follows: KDR sequence, 5′-CTT GCA TCA GAA GAG CTG AAA-3′; NC sequence, 5′-TTC TCC GAA CGT GTC ACG T-3′.

2.16 Statistical analysis

All data are expressed as mean ± standard error of the mean (SEM). Statistical analyses were conducted using Prism 9.0 software (GraphPad Software, La Jolla, CA, USA). For pairwise comparisons, the t-test was utilized; for comparisons among multiple groups, one-way ANOVA was employed. A P-value < 0.05 was deemed statistically significant. Additionally, the study schematics were crafted using the BioRender platform (BioRender, GTA, CAN).

3.1 TFPS promotes blood absorption and neurological recovery after SAH, alleviating brain edema and neuroinflammatory response.

Initially, a mouse model of subarachnoid hemorrhage was established through the blood injection method, followed by the initiation of intraventricular treatment with three concentrations of TFPS (2.5mg/kg, 5mg/kg, 10mg/kg) three hours post-induction (Fig. 1a). Behavioral scoring was performed on the mice at 6, 12, and 24 hours, with brain tissue samples being collected for subsequent analysis after 24 hours.

Neurological dysfunction and brain edema are the principal components of EBI, which are pivotal in the etiology of adverse outcomes following SAH ⁸. It is evident that the mice in both the SAH group and the SAH + TFPS group exhibited varying degrees of neurological deficits and markedly reduced behavioral scores relative to the Sham group, signifying severe EBI subsequent to SAH. Despite the absence of significant differences in neurological scores between the TFPS-treated group and the SAH group at 6 and 12 hours post-SAH, the TFPS-treated group demonstrated a significantly enhanced neurological recovery by 24 hours. Higher doses of TFPS exhibited more potent neuroprotective effects. (Fig. 1b). At 24 hours post-SAH, the rotarod test was conducted on mice. Except for the Sham group, the high-dose TFPS group exhibited the longest duration on the rotarod, while the SAH group performed the worst (see Fig. 1c). Additionally, an increase in brain water content was observed in mice 24 hours post-SAH induction compared to the Sham group. Significant reduction in brain edema was noted following treatment with the three distinct doses of TFPS (Fig. 1d).

As depicted in Fig. 1g, the SAH group (n = 5) demonstrated substantial blood pooling in the cisterna magna; this was markedly diminished in the TFPS-treated group, implying that TFPS may enhance blood clearance. Subsequently, double immunofluorescence staining was utilized to label hemoglobin (Hb) and microglial cells (Iba-1). In contrast to the control Sham group, both the SAH and SAH + TFPS groups displayed a considerable number of Hb-positive cells. Post-TFPS treatment, there was a significant diminution in the number of Hb-positive cells. Additionally, the phagocytic activity of microglial cells towards Hb fragments was observed (Fig. 1g). Concurrently, the expression of Iba-1 and Hb proteins in the right temporal cortex of the SAH model was analyzed via Western blot (n = 4) (Fig. 1e-f), thereby further substantiating that TFPS treatment facilitates blood clearance and attenuates microglial activation.

Microglial activation constitutes a principal source of pro-inflammatory factors within the brain⁹. ELISA assays demonstrated that TFPS markedly reduced the levels of IL-1β, IL-6, and TNF-α in the mouse temporal cortex 24 hours post-SAH (n = 4), with the inhibition of neuroinflammation being particularly pronounced at higher doses (Fig. 1i). As depicted in Fig. 1h, a considerable amount of neuronal apoptosis was observed in the left hemisphere subsequent to SAH. However, the proportion of TUNEL + NeuN + cells was significantly diminished in the mice pre-treated with TFPS compared to the SAH group. Apoptosis-related proteins, including Bcl-2, Bax, and CC3, were detected via Western blot (n = 4) (Fig. 1j-l). The results indicate that high-dose TFPS treatment conferred neuroprotection and delayed the apoptosis process, likely attributable to the inhibition of microglial neuroinflammation by TFPS.

3.3 TFPS modulates microglial inflammatory response and phagocytic function to improve EBI following SAH

Initially, exposure to oxidized hemoglobin induces excessive inflammatory responses and impairs phagocytic function in microglia¹⁰. qPCR was employed to quantify the levels of inflammatory cytokines in microglia post-SAH, revealing that the mRNA levels of IL-1β, IL-6, and TNF-α in the SAH group were significantly elevated compared to those in the sham group (n = 4). However, TFPS was capable of significantly attenuating the expression of these pro-inflammatory cytokines (refer to Fig. 2a).

Cell debris labeled with red fluorescence was utilized to assess the phagocytic capability of microglia in an in vitro SAH model (n = 3). Accompanied by exposure to oxidized hemoglobin, the phagocytic ability of microglia was significantly diminished. Changes in microglial phagocytosis induced by TFPS were examined. TFPS facilitated the phagocytosis of more cell debris by microglia (Fig. 2b-c).

TREM2 serves as a classical marker of anti-inflammatory and pro-phagocytosis. Research has demonstrated that TREM2 is implicated in the regulation of neuroinflammation, and phagocytosis mediated by microglia, encompassing the production and release regulation of pro-inflammatory cytokines, as well as phagocytosis and clearance of debris ¹¹. Consequently, the expression of TREM2 directly mirrors the timing and extent of microglial activation. As depicted in Fig. 2d, immunofluorescence staining was conducted in the cortical region of mice. Upon activation of microglia, the number of TREM2-expressing microglia in the left frontal cortex of the SAH group was markedly reduced compared to that in the Sham group. Post-TFPS treatment, the progression of inflammation was decelerated.

Within the central nervous system, Iba-1 functions as a specific microglial marker, with its expression correlating to the state of the microglia, whereas CD86 serves as a classic marker of pro-inflammatory activation. Upon activation, microglia undergo a morphological transformation from a rod-shaped cell body with dendritic protrusions to an amoeboid shape, characterized by larger cell bodies and stubby synapses¹². To further elucidate the changes and roles of microglia in EBI, primary microglia were isolated and subjected to double immunofluorescence staining (n = 6). The results indicated that, in comparison to the SAH group, the number of CD86+/Iba-1 + microglia in the SAH + TFPS group was markedly diminished. Moreover, the average fluorescence intensity of CD206+/Iba-1 + microglia in the SAH + TFPS group was significantly elevated compared to that in the SAH group (refer to Figs. 2e-h). These observations further substantiate the regulatory effect of TFPS treatment on the inflammatory response of microglia. Western Blot analysis (n = 4) revealed that post-SAH, the expression levels of both CD86 and CD206 were elevated. However, subsequent to TFPS treatment, the pro-inflammatory CD86 expression was diminished, whereas the anti-inflammatory CD206 expression was augmented in comparison to the SAH group (refer to Fig. 2i-j).

The outcomes of qPCR, flow cytometry, and immunofluorescence staining collectively suggest that TFPS may inhibit the activation of pro-inflammatory microglia induced by SAH, attenuate the release of inflammatory factors, and enhance its phagocytic function, which is impaired by SAH. Subsequently, neuronal cells were separately stimulated with oxyhemoglobin and intervened with TFPS to investigate its protective effects on neurons. As depicted in Fig. 2k-m, there was no significant difference in the expression of apoptotic proteins between the TFPS treatment group and the SAH group, differing from the in vivo experimental results. This suggests that TFPS confers protection to neuronal function by alleviating microglial neuroinflammation.

3.4 Network pharmacology analysis indicated potential mechanisms of TFPS regulating microglial activation

Structures of various TFPS were procured from the PubChem website, and upon importation into the Swiss Target Prediction platform for target prediction, 44 non-redundant targets associated with TFPS were identified. Through the amalgamation of the GeneCards, OMIM, and DisGeNET databases, a non-redundant set of 2534 targets associated with SAH was obtained. Subsequently, the acquired genes were validated utilizing the UniProt database. Intersection analysis of the pharmacological targets of TFPS and the target genes of SAH resulted in the identification of 13 target genes related to both SAH and TFPS, constituting 29.5% and 0.51% of their respective targets. These genes represent the interactive target genes for the treatment of SAH with TFPS (Fig. 3a).

To further analyze these targets, a PPI (Protein-Protein Interaction) network was constructed using the STRING database and subsequently imported into Cytoscape 3.8.2. Thirteen potential therapeutic targets were imported into the STRING database to obtain PPI information, resulting in the export of the Protein-Protein Interaction (PPI) network diagram (Fig. 3b) and the drug target pathway network diagram (Fig. 3c). A detailed examination of candidate targets within the central protein-protein interaction (PPI) network was conducted via Gene Ontology (GO) analysis encompassing biological processes (BP), cellular components (CC), and molecular functions (MF), along with KEGG enrichment analysis utilizing the DAVID database. The biological processes associated with TFPS and SAH were identified to be linked with "vascular wound healing" and "MAPK activation" (Fig. 3d). The significant enrichment of these signaling pathways suggests a robust correlation between the core targets and the MAPK signaling pathway (Fig. 3e). The key target KDR for the treatment of SAH with TFPS was selected for molecular docking. The docking results demonstrated that TFPS exhibits favorable binding activity with the target (binding affinity < − 5.0 kcal/mol) (Fig. 3f).

3.5 TFPS regulates inflammation and phagocytosis in microglial cells through KDR

PPI network analysis indicates that KDR is one of the primary genes associated with 13 high-value targets, potentially playing a significant role in the EBI of SAH. We aim to further investigate the role of KDR in SAH. In our in vitro SAH model, we examined the expression changes of KDR induced by SAH (n = 4) and observed that the duration of oxyHb stimulation correlates positively with KDR relative protein expression (Fig. 4a). Under the intervention of TFPS, the expression of KDR under oxyHb stimulation was down-regulated (Fig. 4b). Immunofluorescence staining results demonstrated a significant upregulation in KDR fluorescence intensity in the SAH group compared to the control group (n = 5). However, TFPS treatment attenuated these changes (refer to Fig. 4c).

To further elucidate the relationship between KDR and inflammation and phagocytosis in microglial cells, we transfected a plasmid expressing KDR-specific shRNA into Bv2 microglial cell clones and assessed KDR expression. As depicted in Fig. 4d, we successfully knocked down KDR expression(n = 3). Following oxyHb stimulation, TFPS did not further reduce KDR mRNA expression in the KDR knockout group(n = 4) (Fig. 4e). In Bv2 cells with KDR knockout, the number of phagocytic particles significantly increased in the oxyHb + KDR shRNA group compared to the oxyHb group. However, the KDR shRNA + TFPS group exhibited similar results to the KDR shRNA group, failing to further restore the microglial phagocytic capacity for cell debris(n = 3) (Fig. 4f-g). These results suggest that KDR also plays a pivotal role in the phagocytic process of microglial cells.

Knocking down KDR significantly inhibited the anti-inflammatory regulatory effect of TFPS. qPCR results indicated that in the oxyHb + KDR shRNA group and the oxyHb + KDR shRNA + TFPS group, IL-1β, IL-6, and TNF-α were significantly reduced(n = 4). However, there was no significant difference in the mRNA expression of inflammatory factors between the two groups, further corroborating the role of TFPS in regulating neuroinflammation through KDR. (Fig. 4h)

3.6 The KDR-regulated MAPK signaling pathway is the principal target of TFPS.

Enrichment analysis reveals that the key targets related to TFPS are significantly enriched within the MAPK signaling pathway. Western blot analysis of the MAPK signaling pathway in primary microglial cells subjected to oxyHb stimulation revealed that signific ant augmentations in the expression levels of p-P38/P38, p-ERK/ERK, and p-JNK/JNK compared to the Sham group(n = 4). Following TFPS treatment, only the expression level of p-P38/P38 was significantly diminished compared to post-SAH stimulation, with no significant differences observed in the others (refer to Figs. 5a-c). These results suggest that the effect of TFPS in SAH may be associated with the p38 MAPK within the MAPK family.

Previous research has already demonstrated that neuroinflammation is intimately linked to the p38/NF-κB pathway¹³. We examined the expression of p-NF-κB/NF-κB (refer to Fig. 4d) and found it to be significantly elevated after SAH, but significantly reduced following TFPS treatment(n = 4). To corroborate the anti-inflammatory and phagocytic effects attributed to the P38 MAPK pathway, as evidenced in our preceding study ¹⁰, we utilized the p38 inhibitor SB203580 (10µM). Administration of SB203580 significantly ameliorated the compromised phagocytic capacity of microglial cells(n = 3) (refer to Figs. 5e-f) and attenuated the levels of inflammatory mediators following oxyHb stimulation(n = 4) (refer to Figs. 5g). The concurrent application of SB203580 and TFPS exhibited a more pronounced effect, albeit without statistically significant differences. These results suggest that the p38/NF-κB pathway is activated subsequent to SAH, modulating the inflammation and phagocytic function of microglial cells, and that TFPS can inhibit this pathway's activation.

Presently, there is no research elucidating the relationship between KDR and the p38 MAPK pathway post-SAH. To explore this relationship, we employed KDR shRNA to silence KDR in Bv2 cells in vitro. Western blot analysis revealed that subsequent to SAH, the expression levels of p-P38/P38 and p-NF-κB/NF-κB were significantly upregulated(n = 4). However, treatment with TFPS and transfection with KDR shRNA mitigated their expression levels. Notably, the combined treatment of TFPS and KDR shRNA did not exhibit a significant difference when compared to KDR shRNA alone (refer to Figs. 5h-i). These findings imply that KDR is a pivotal target within the p38 MAPK/NF-κB pathway.

This study amalgamated network pharmacology and experimental validation to explore the therapeutic effect of TFPS on SAH. Initially, we constructed a compound-target-pathway interaction network involving TFPS and posited that TFPS might exert a salutary impact on EBI induced by SAH. By simulating SAH through blood injection into the cisterna magna in mice, we experimentally demonstrated that TFPS can effectively mitigate brain edema and preserve neurological function. Further network pharmacological analysis identified the pivotal target KDR, and its role in the p38 MAPK signaling pathway was examined in vitro cell experiments. The results indicated that TFPS alleviated the inflammatory activation and impaired phagocytosis of microglia post-SAH through this pathway. In conclusion, this study, for the first time, elucidates through integrated pharmacological methods that TFPS, via the KDR-mediated p38 MAPK signaling pathway, may attenuate the inflammatory response elicited by microglia, thereby mitigating EBI (Fig. 5).

Evidence indicates that in EBI following SAH, blood infiltrates brain tissue, leading to excessive microglial activation¹⁴. Activated microglia release various pro-inflammatory cytokines, which can directly damage surrounding neurons, disrupt blood-brain barrier (BBB) permeability, exacerbate brain edema, and promote neuronal death, thereby worsening SAH-induced brain injury⁸. To address the high mortality and disability rates of SAH, current research focuses on reducing neuroinflammation to mitigate neurological damage and enhancing phagocytic function to expedite blood clearance in EBI. However, no effective drugs targeting microglial activation for SAH treatment are currently available.

Modern pharmaceutical research has elucidated that numerous traditional Chinese medicines, owing to their pronounced anti-inflammatory and antioxidant effects, have emerged as a significant research trajectory for the treatment of SAH¹⁵. Among these, TFPS, as a promising therapeutic agent, has been demonstrated to exhibit a plethora of pharmacological actions, including anti-tumor, immune regulation, antioxidant, anti-aging, anti-inflammatory, and amelioration of brain memory impairment¹⁶. Studies have ascertained that TFPS can effectively inhibit the production of pro-inflammatory cytokines, including IL-1β, IL-6, and TNF-α¹⁷, and can also mitigate oxidative stress¹⁸, thereby augmenting its anti-inflammatory effect. In cognitive impairment model studies, TFPS has been demonstrated to enhance the cognitive state of mice, attenuate the activation of astrocytes and microglia, underscoring its antioxidant and anti-inflammatory characteristics¹⁹. Consequently, these observations imply that TFPS may exert a protective role in modulating the neuroinflammatory response of EBI induced by SAH. Nonetheless, the primary pathophysiological mechanisms implicated in this process remain enigmatic. To date, experimental research on the pathogenesis and therapeutic modalities of SAH has emerged as a pivotal research domain.

In this study, we assessed the potential role of TFPS in neuroinflammation after SAH. We discovered that TFPS treatment could markedly inhibit the activation of microglia and the release of pro-inflammatory cytokines in the cerebral cortex post-SAH. Furthermore, experimental results indicated that TFPS could effectively mitigate neuronal cell death, cerebral edema, and neurological dysfunction within 24 hours post-SAH, strongly corroborating the neuroprotective effect of TFPS in SAH. We also observed that TFPS could facilitate the absorption of blood, thereby precluding the impairment of the phagocytic function of microglia.

Vascular endothelial growth factor (VEGF) is an essential cytokine that plays a pivotal role in the regulation of angiogenesis and the augmentation of vascular permeability, which are critical for the formation of new blood vessels²⁰. Recent studies have corroborated that VEGF not only contributes to pre-neuronal survival, neurogenesis, and the proliferation and differentiation of stem cells but can also counteract excitotoxicity induced by glutamate, underscoring its significance in maintaining cerebral dynamic equilibrium²¹. VEGF primarily mediates the enhancement of vascular permeability via its receptor KDR (VEGFR-2), whereas another receptor, VEGFR-1, despite exhibiting a higher affinity for VEGF, possesses lower kinase activity and may exert its role by negatively modulating the KDR signaling pathway²². Studies have indicated that KDR can augment the permeability of the blood-brain barrier, thereby affecting its integrity^23–25. The study by Davis et al.²⁶ was the first to demonstrate that directly inhibiting the VEGF pathway with antibodies targeting KDR can effectively preclude EBI subsequent to a SAH, underscoring KDR as a key receptor mediating EBI post-SAH. Furthermore, our experimental results reveal that the role of KDR in neuroprotection may involve the activation of P38 MAPK signaling, a pivotal regulatory factor for cell survival, although its specific role in EBI post-SAH has yet to be reported.

Our research has unveiled alterations in the KDR-mediated P38 MAPK/NF-κB signaling axis subsequent to TFPS treatment. Experimental results demonstrate that upon treatment with TFPS, the expression of P38 MAPK and NF-κB mediated by KDR is markedly inhibited. Additionally, in our in vitro experiments, we successfully inhibited the phosphorylation of P38 MAPK and the subsequent augmentation of NF-κB by knocking out KDR, thereby validating the interaction between KDR and P38 MAPK. Consequently, our experimental results indicate that TFPS can mitigate neuroinflammation subsequent to SAH by inhibiting the KDR-mediated P38 MAPK/NF-κB signaling pathway.

Based on our research, we hypothesize that TFPS might modulate the complex inflammatory response and microglial phagocytic function in EBI after SAH by inhibiting the KDR-mediated P38 MAPK/NF-κB signaling pathway. Nonetheless, our research is not without limitations. Firstly, there is currently no reliable method for administering TFPS, particularly in the presence of the blood-brain barrier, thus precluding the determination of whether TFPS can achieve an effective concentration in brain tissue; intraventricular administration is unsuitable for multiple doses. Secondly, our study primarily validates the NF-κB regulatory mechanism downstream of P38 MAPK, but further exploration of other downstream targets of P38 MAPK is warranted. Moreover, the optimal treatment window for employing TFPS post-SAH remains unclear. In summary, the significant effect of TFPS in promoting blood absorption and anti-inflammation confers potential for its clinical application in SAH. We anticipate conducting further animal and clinical studies on the activation of microglia by TFPS in the future.

In conjunction with our experimental results, our study constitutes the inaugural report elucidating the protective role of TFPS in EBI subsequent to SAH. The underlying mechanism entails modulation of the P38 MAPK/NF-κB signaling pathway to mitigate neuroinflammation in microglia and sustain their phagocytic function. TFPS holds potential as a novel therapeutic avenue for SAH.

Competing Interests

The authors have no relevant financial or non-financial interests to disclose.

Ethics approval

The study was approved by the Ethics Review Committee of Second Affiliated Hospital of Soochow University.

Consent for publication

Not applicable.

Funding

This work was supported by Science and Technology Development Plan Project of Suzhou, China (SYS2019067, SKJYD2021088, SKY2023054) and Higher Education Teaching Reform Research Project of Soochow University, Suzhou, China (5731500722).

Author Contribution

The drafting of the article manuscript was performed by YHW; conception and design were undertaken by XXC and QZ; the behavioral experiments were conducted by ZJC; the Western blot, ELISA, and qPCR assays were conducted by YHW and DHY; primary cell culture ,flow cytometry and immunofluorescent staining were executed by BLC; the network pharmacology was performed by YHW and XXC; data collection and analysis were carried out by LXF; the schematic diagram was produced by BLC; critical revisions of the manuscript were performed by QZ. All authors provided comments on previous versions. All authors read and approved the final manuscript.

Acknowledgements

Not applicable.

Availability of data and materials

All data generated or analyzed in the study are included in this published article

Claassen J, Park S (2022) Spontaneous subarachnoid haemorrhage. Lancet. Sep 10. ;400(10355):846–862. 10.1016/s0140-6736(22)00938-2
Neifert SN, Chapman EK, Martini ML et al (2021) Aneurysmal Subarachnoid Hemorrhage: the Last Decade. Transl Stroke Res Jun 12(3):428–446. 10.1007/s12975-020-00867-0
Lu Y, Zhang XS, Zhang ZH et al (2018) Peroxiredoxin 2 activates microglia by interacting with Toll-like receptor 4 after subarachnoid hemorrhage. J Neuroinflammation Mar 19(1):87. 10.1186/s12974-018-1118-4
Zhang L, Wang M (2016) Polyethylene glycol-based ultrasound-assisted extraction and ultrafiltration separation of polysaccharides from Tremella fuciformis (snow fungus). Food and Bioproducts Processing.
/10/01/
2016;100:464–468. doi:https://doi.org/10.1016/j.fbp.2016.09.007
Yang D, Liu Y, Zhang L (2019) Tremella polysaccharide: The molecular mechanisms of its drug action. Prog Mol Biol Transl Sci 163:383–421. 10.1016/bs.pmbts.2019.03.002
Lee J, Ha SJ, Lee HJ et al (2016) Protective effect of Tremella fuciformis Berk extract on LPS-induced acute inflammation via inhibition of the NF-κB and MAPK pathways. Food Funct Jul 13(7):3263–3272. 10.1039/c6fo00540c
Attia MS, Loch Macdonald R (2015) Anterior circulation model of subarachnoid hemorrhage in mice. Acta Neurochir Suppl 120:311–314. 10.1007/978-3-319-04981-6_53
Pan J, Jin JL, Ge HM et al (2015) Malibatol A regulates microglia M1/M2 polarization in experimental stroke in a PPARγ-dependent manner. J Neuroinflammation Mar 14:12:51. 10.1186/s12974-015-0270-3
Kwon HS, Koh SH (2020) Neuroinflammation in neurodegenerative disorders: the roles of microglia and astrocytes. Transl Neurodegener Nov 26(1):42. 10.1186/s40035-020-00221-2
Chen XX, Tao T, Liu XZ et al (2023) P38-DAPK1 axis regulated LC3-associated phagocytosis (LAP) of microglia in an in vitro subarachnoid hemorrhage model. Cell Commun Signal Jul 21(1):175. 10.1186/s12964-023-01173-6
Ma WY, Wang SS, Wu QL, Zhou X, Chu SF, Chen NH (2022) The versatile role of TREM2 in regulating of microglia fate in the ischemic stroke. Int Immunopharmacol Aug 109:108733. 10.1016/j.intimp.2022.108733
Orihuela R, McPherson CA, Harry GJ (2016) Microglial M1/M2 polarization and metabolic states. Br J Pharmacol Feb 173(4):649–665. 10.1111/bph.13139
Xia M, Zhang Y, Wu H et al (2022) Forsythoside B attenuates neuro-inflammation and neuronal apoptosis by inhibition of NF-κB and p38-MAPK signaling pathways through activating Nrf2 post spinal cord injury. Int Immunopharmacol Oct 111:109120. 10.1016/j.intimp.2022.109120
Sun Q, Wu W, Hu YC et al (2014) Early release of high-mobility group box 1 (HMGB1) from neurons in experimental subarachnoid hemorrhage in vivo and in vitro. J Neuroinflammation Jun 12 11:106. 10.1186/1742-2094-11-106
Tan J, Zhu H, Zeng Y, Li J, Zhao Y, Li M (2024) Therapeutic Potential of Natural Compounds in Subarachnoid Haemorrhage. Neurosci May 14:546:118–142. 10.1016/j.neuroscience.2024.03.032
Wu YJ, Wei ZX, Zhang FM, Linhardt RJ, Sun PL, Zhang AQ (2019) Structure, bioactivities and applications of the polysaccharides from Tremella fuciformis mushroom: A review. Int J Biol Macromol Jan 121:1005–1010. 10.1016/j.ijbiomac.2018.10.117
Xiao H, Li H, Wen Y et al (2021) Tremella fuciformis polysaccharides ameliorated ulcerative colitis via inhibiting inflammation and enhancing intestinal epithelial barrier function. Int J Biol Macromol Jun 1:180:633–642. 10.1016/j.ijbiomac.2021.03.083
Zhang Z, Wang X, Zhao M, Qi H (2014) Free-radical degradation by Fe2+/Vc/H2O2 and antioxidant activity of polysaccharide from Tremella fuciformis. Carbohydr Polym Nov 4 112:578–582. 10.1016/j.carbpol.2014.06.030
Park HJ, Shim HS, Ahn YH et al (2012) Tremella fuciformis enhances the neurite outgrowth of PC12 cells and restores trimethyltin-induced impairment of memory in rats via activation of CREB transcription and cholinergic systems. Behav Brain Res Apr 1(1):82–90. 10.1016/j.bbr.2011.11.017
Takahashi H, Shibuya M (2005) The vascular endothelial growth factor (VEGF)/VEGF receptor system and its role under physiological and pathological conditions. Clin Sci (Lond) Sep 109(3):227–241. 10.1042/cs20040370
Pérez-Gutiérrez L, Ferrara N (2023) Biology and therapeutic targeting of vascular endothelial growth factor A. Nat Rev Mol Cell Biol Nov 24(11):816–834. 10.1038/s41580-023-00631-w
Shibuya M (2013) Vascular endothelial growth factor and its receptor system: physiological functions in angiogenesis and pathological roles in various diseases. J Biochem Jan 153(1):13–19. 10.1093/jb/mvs136
Ostrowski RP, Colohan AR, Zhang JH (2005) Mechanisms of hyperbaric oxygen-induced neuroprotection in a rat model of subarachnoid hemorrhage. J Cereb Blood Flow Metab May 25(5):554–571. 10.1038/sj.jcbfm.9600048
Suzuki H, Hasegawa Y, Kanamaru K, Zhang JH (2010) Mechanisms of osteopontin-induced stabilization of blood-brain barrier disruption after subarachnoid hemorrhage in rats. Stroke Aug 41(8):1783–1790. 10.1161/strokeaha.110.586537
Kusaka G, Ishikawa M, Nanda A, Granger DN, Zhang JH (2004) Signaling pathways for early brain injury after subarachnoid hemorrhage. J Cereb Blood Flow Metab Aug 24(8):916–925. 10.1097/01.Wcb.0000125886.48838.7e
Davis B, Tang J, Zhang L et al (2010) Role of vasodilator stimulated phosphoprotein in VEGF induced blood-brain barrier permeability in endothelial cell monolayers. Int J Dev Neurosci Oct 28(6):423–428. 10.1016/j.ijdevneu.2010.06.010

No competing interests reported.

Download PDF

Reviewers agreed at journal
28 Aug, 2024
Reviewers agreed at journal
27 Aug, 2024
Reviewers invited by journal
27 Aug, 2024
Editor assigned by journal
06 Aug, 2024
Submission checks completed at journal
06 Aug, 2024
First submitted to journal
03 Aug, 2024

You are reading this latest preprint version

Tremella fuciformis polysaccharides alleviate early brain injury in experimental subarachnoid hemorrhage by inhibiting the KDR-mediated P38 MAPK/NF-κB pathway

Status:

Version 1

Abstract

Background

Methods

Results

Conclusion

Figures

1 Introduction

2 Methods

2.1 Animals preparation

2.2 Models of SAH and experimental design

2.3 Cell culture

2.4 Oxyhemoglobin‑induced SAH model in vitro

2.5 Network pharmacology

2.5.1 Drug-disease target prediction.

2.5.2 Construction of target protein interaction network

2.5.3 GO enrichment analysis and KEGG pathway analysis

2.6 Neurologic function testing

2.7 Water content

2.8 Rotarod test

2.9 Western Blotting

2.10 Quantitative real‑time polymerase chain reaction

2.11 Immunofluorescent staining

2.12 Terminal deoxynucleotidyl transferase–mediated dUTP nick end labelling

2.13 Flow cytometry

2.14 Enzyme-linked immunosorbent assay

2.15 RNA interference

2.16 Statistical analysis

3 Result

3.1 TFPS promotes blood absorption and neurological recovery after SAH, alleviating brain edema and neuroinflammatory response.

3.3 TFPS modulates microglial inflammatory response and phagocytic function to improve EBI following SAH

3.4 Network pharmacology analysis indicated potential mechanisms of TFPS regulating microglial activation

3.5 TFPS regulates inflammation and phagocytosis in microglial cells through KDR

3.6 The KDR-regulated MAPK signaling pathway is the principal target of TFPS.

4 Discussion

5 Conclusion

Declarations

Competing Interests

Ethics approval

Funding

Author Contribution

Acknowledgements

Availability of data and materials

References

Additional Declarations

Status:

Version 1