Grr1-mediated Ubp3 degradation is crucial for HAC1 mRNA translation and unfolded stress response in yeast

doi:10.21203/rs.3.rs-4865151/v1

Download PDF

Article

Grr1-mediated Ubp3 degradation is crucial for HAC1 mRNA translation and unfolded stress response in yeast

https://doi.org/10.21203/rs.3.rs-4865151/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

In the process of the unfolded protein response (UPR), the Hac1p protein is induced through a complex regulation of the HAC1 mRNA. This includes the mRNA localization on the endoplasmic reticulum (ER) membrane and stress-triggered splicing. In yeast, a specific ribosome ubiquitination process, the monoubiquitination of eS7A by the E3 ligase Not4, facilitates the translation of HAC1ⁱ, which is a spliced form of the HAC1 mRNA. Upon UPR, the mono-ubiquitination of eS7A increases due to the downregulation of Ubp3, a deubiquitinating enzyme of eS7A. However, the exact mechanisms behind these regulations have remained unknown. In this study, a novel E3 ligase, Grr1, an F-box protein component of the SCF ubiquitin ligase complex, which is responsible for Ubp3 degradation, has been identified. Grr1 is crucial to maintain the level of eS7A monoubiquitination upon UPR and HAC1ⁱ mRNA translation. In addition to the crucial role of untranslated regions in HAC1ⁱ mRNA translation, eS7A monoubiquitination facilitates Hac1 expression depending on the ORF of HAC1ⁱ. In summary, the proposed model is that the Grr1-mediated degradation of Ubp3 upregulates eS7A monoubiquitination, leading to HAC1ⁱ translation. This study highlights the crucial role of ribosome ubiquitination in translational control during UPR.

Biological sciences/Biochemistry/Proteins/Ribosomal proteins

Biological sciences/Molecular biology/Translation/Ribosome

Biological sciences/Molecular biology/Post-translational modifications/Ubiquitylation

Unfolded protein response (UPR)

Ribosome ubiquitination

HAC1 translation

HAC1 splicing

E3 ligase Grr1

deubiquitinating enzyme Ubp3

Codon-optimality

Ribosome ubiquitination is a crucial modification of translation quality control pathways targeting the nascent polypeptide (RQC: Ribosome-associated Quality Control) and mRNA (NGD: No-Go Decay), as well as nonfunctional rRNA decay (18S NRD)^1–5. In RQC, collision sensors Hel2 in yeast and ZNF598 in mammals form a K63-linked polyubiquitin chain on uS10 of the stalling ribosome in collided disomes or disomes^6–9. The K63-linked polyubiquitin chain on uS10 is subsequently recognized by the RQC-trigger (RQT) complex and plays a crucial role in the dissociation of collided ribosomes into subunits to initiate the RQC pathway^6–12. In yeast, the RQT complex is composed of the RNA helicase-family protein Slh1, ubiquitin-binding protein Cue3, and Rqt4⁸. The ATPase activity of Slh1 is responsible for subunit dissociation of polyubiquitinated collided ribosomes^8,10. The two subunits of the RQT complex, Cue3, and Rqt4 simultaneously recognize the K63-linked polyubiquitin chain formed on the stalling ribosome by Hel2¹¹. Similarly, ZNF598, the human homolog of Hel2, ubiquitinates ribosomal proteins uS10 and eS10 to initiate RQC in mammals. The human RQT (hRQT) complex is composed of the RNA helicase-family protein ASCC3, the ubiquitin-binding protein ASCC2, and TRIP4^6,12, which specifically recognizes the K63-linked polyubiquitin chain on uS10 in collided ribosomes, indicating that the triggering step of RQC is conserved from yeast to humans⁶.

The ubiquitination of the small subunit protein eS7A plays a crucial role in NGD⁹. Collided ribosomes are also subjected to the NGD pathway, which can be divided into two branches, depending on their coupling with RQC. NGD coupled with RQC is referred to as NGD^RQC+, depending on the Hel2-mediated K63-linked polyubiquitination of uS10 and RQT-mediated subunit dissociation of the stalling ribosomes⁹. An endonuclease Cue2 is responsible for the cleavage at the vicinity of the collided ribosome^13,14. In the absence of the subunit dissociation, the endonucleolytic mRNA cleavages upstream of the collision site are referred to as the NGD^RQC− The cleavages in NGD^RQC− require K63-linked polyubiquitination of ribosomal protein eS7A via a two-step mechanism, the E3 ligase Not4 first monoubiquitinates eS7A which is then followed by Hel2-mediated polyubiquitination¹⁴. Polyubiquitination of eS7A is required for the recruitment of Cue2, which cleaves mRNA upstream of the collided ribosomes¹⁴.

Despite an increased understanding of the role of ribosome ubiquitination in quality control pathways, the physiological relevance of ribosome ubiquitination remains largely unknown. Despite an increased understanding of the role of ribosome ubiquitination in quality control pathways, the physiological relevance of ribosome ubiquitination remains largely unknown. The Ccr4-Not complex initiates mRNA decay through the deadenylation and activation of decapping^15,16. The Ccr4-Not complex monitors the translating ribosome for codon optimality via a specific interaction of the Not5 subunit with the ribosomal E-site¹⁷. This interaction only occurs when the ribosome lacks an accommodated A-site tRNA, indicative of low codon optimality. Ccr4-Not also interacts with the ribosome through mono-ubiquitination of eS7A by Not4 E3 ligase^9,14,18–20. Deletion of Not4 and mutation of the four lysine residues targeted by Not4 (eS7A-4KR) strongly stabilized non-optimal and semi-optimal reporters¹⁷. This suggests that eS7-ubiquitination is part of the same pathway as Not5, but occurs upstream of E-site probing, and the precise role of eS7A ubiquitination in codon optimality-dependent mRNA decay by Ccr4-Not remains elusive.

In recent studies, ribosomal ubiquitination has been linked to cellular responses to stress. K63 polyubiquitination may modulate oxidative stress responses, and ubiquitination of specific lysine residues in ribosomal proteins contributes to stress responses^19,21–28. When cellular stresses lead to the accumulation of misfolded proteins within the endoplasmic reticulum (ER), it triggers a network of intracellular signaling pathways known as the unfolded protein response (UPR)^29–31. In the UPR signaling pathway, HAC1 mRNA in budding yeast^32–34 or XBP1 mRNA in metazoans^32–34 is targeted to the ER-resident protein kinase and endonuclease Ire1^32,35,36. Subsequently, Ire1 cleaves an intervening sequence from HAC1/XBP1 mRNA, and the spliced form of HAC1/XBP1 mRNA encodes a transcription factor that stimulates the expression of numerous proteins, including ER-resident chaperones, to upregulate the protein-folding capacity of the cell. Induction of the UPR upregulates the ubiquitination of ribosomal proteins in mammals³⁷ and yeast¹⁸. In yeast, the ubiquitination of eS7A, uS10, and uS3 was upregulated and Not4-mediated monoubiquitination of eS7A is required for resistance to tunicamycin (Tm), whereas E3 ligase Hel2-mediated polyubiquitination of uS10 and uS3 is not required¹⁸. Ribosome profiling revealed that monoubiquitination of eS7A is crucial for translational regulation, including upregulation of the spliced form of HAC1 (HAC1ⁱ) mRNA¹⁸. Downregulation of the deubiquitinating enzyme complex Ubp3-Bre5 increased the levels of ubiquitinated eS7A during UPR¹⁸. These results suggest that monoubiquitination of ribosomal protein eS7A plays a crucial role in translational control during the ER stress response in yeast. However, it remains unknown how Ubp3 is downregulated and how eS7A ubiquitination facilitates HAC1ⁱ mRNA translation upon UPR.

In this study, we identified an E3 ligase, Grr1, an F-box protein component of the SCF ubiquitin ligase complex responsible for Ubp3 downregulation during the UPR. Grr1 is required for proteasomal degradation of Ubp3, thereby increasing levels of ubiquitinated eS7A. eS7 ubiquitination facilitates HAC1ⁱ translation during UPR. Collectively, we propose that upon UPR, Grr1-mediated proteasomal degradation upregulates eS7A mono-ubiquitination, thereby promoting HAC1ⁱ translation.

Grr1 is responsible for the proteasomal degradation of Ubp3.

Ribosome ubiquitination increases significantly upon induction of the UPR in mammals and yeast^18,37. In yeast, Ubp3 is the enzyme responsible for deubiquitylation of the ubiquitinated eS7A and is downregulated, which is consistent with the increased level of monoubiquitinated eS7A in response to UPR¹⁸. To understand how ribosome ubiquitination is regulated upon UPR in yeast, we performed genetic screening of E3 ubiquitin ligases that are required for Tm-resistance growth and Ubp3 degradation. Among 66 deletion mutants of the E3 ligases, we identified pep3D and grr1D mutants that conferred Tm-sensitive growth (Figs. 1A and S1A). The level of Hac1 protein (Hac1p) normalized to that of tubulin also indicated that Hac1p was significantly downregulated in the grr1D mutant, being approximately 50% of the levels in WT cells 4 h after Tm treatment (Fig. 1B, lanes 1–4). In contrast, the level of Hac1p was not decreased in the pep3D mutant cells (Fig. 1B, lanes 5–6). In the grr1D, pep3D mutant cells, induction of HAC1ⁱ mRNA by Tm treatment was intact (Fig. 1C), suggesting that Grr1 contributes to translation of HAC1ⁱ mRNA.

Grr1 is the F-box protein component of an SCF ubiquitin-ligase complex^38,39, therefore we hypothesized that Grr1 degrades Ubp3 and the in the grr1D mutant cells, the upregulated Ubp3 decreases the monoubiquitinated eS7A thereby the reduces Hac1p level. The level of Hac1p 2 h after Tm treatment was reduced in the eS7 ubiquitination-defective eS7A-4KR cells, confirming that monoubiquitination of ribosomal protein eS7A plays a crucial role in translational control during the ER stress response in yeast (Fig. S1B). Neither uS3 nor uS10 ubiquitination, which is essential for 18S NRD and RQC, affected the Hac1p level upon UPR (Fig. S1C-D), indicating that eS7 ubiquitination plays a crucial role in ER stress response. The downregulation of Ubp3 was diminished in grr1D mutant cells (Fig. 1D, lanes 9–12), indicating that Grr1 is required for Ubp3 downregulation upon UPR. To examine whether Ubp3 is subjected to Grr1-dependent proteasomal degradation, we measured Grr1 stability using cycloheximide (CHX) chase followed by western blotting (Fig. 1E). Ubp3 was degraded under normal (Fig. 1E, lanes 1–5) and more unstable under ER stress conditions (Fig. 1F, lanes 6–10; half-life, t_1/2 ~80 min, Fig. 1G) than in the absence of ER stress (Fig. 1F, lanes 1–5; half-life, t_1/2 ~120 min, Fig. 1G). Ubp3 was stabilized after treatment with the proteasome inhibitor MG132 (Fig. S2A, lanes 6–10) and in grr1D mutant cells regardless of Tm treatment (Fig. 1F, lanes 1–10; half-life, t_1/2 > 120 min, Fig. 1G). These results demonstrated that Grr1 is responsible for the efficient degradation of Ubp3, which may contribute to efficient HAC1ⁱ translation probably via an increase in eS7A ubiquitination.

Grr1 interacts with Ubp3.

Grr1 is a modular substrate specificity factor that associates with core SCF (Cdc53p, Skp1p, and Hrt1p/Rbx1p) to form the SCF^Grr1 complex^33,38–40. The F-box domain was responsible for binding to SCFGrr1, and the LRR domain interacted with the substrate for ubiquitination^38,39 (Fig. 2A). The levels of Ubp3 upon UPR were determined in the grr1D cells expressing Grr1 mutants with the deletion of the indicated domains (Fig. 2A). The downregulation of Ubp3 was diminished in the grr1D mutants expressing Grr1 mutant proteins that lack the amino-terminal 1-280 residues (N-ter), the 311–361 residues F-box (Fbox) and the 413–740 residues LRR (LRR) domains (Fig. 2B, lanes 7–10). Consistently, the grr1D mutants expressing Grr1-DF or Grr1-DLRR mutant conferred sensitivity to Tm (Fig. 2C) and the reduced Hac1 protein expression upon UPR (Fig. 2D). These indicated that the F-box and LRR domains of Grr1 are required for the downregulation of Ubp3 upon UPR. The expression level of Grr1-DF or Grr1-DLRR mutant proteins was the same as the wild-type Grr1 (Fig. 2E). The expression level of Grr1-DN was significantly lower than that of wild-type Grr1 (Fig. 2E), but Grr1-DN complemented the grr1D mutant phenotype in Tm sensitivity (Fig. 2C) and the reduced Hac1p level upon UPR (Fig. 2D), indicating that the N-terminal region is dispensable for Grr1 function. To confirm the interaction of Ubp3 with Grr1, we purified the wild-type and mutant FLAG-Grr1 proteins that lack F-box (DFbox) or LRR (DLRR) domains and examined the co-immunoprecipitation of the Ubp3-3HA (Fig. 2F). Ubp3-3HA co-immunoprecipitated with all Grr1 proteins (WT, DFbox, DLRR)(Fig. 2F, lanes 11–16), indicating that Grr1 interacts with Ubp3-HA independent of the F-box and LRR domains. Taken together, we conclude that Grr1 downregulates Ubp3 for efficient HAC1ⁱ translation.

Grr1 facilitates eS7A ubiquitination.

Not4-mediated monoubiquitination of eS7A is required to produce Hac1p during the UPR; therefore, we assessed whether the upregulation of eS7A ubiquitination is dependent on Grr1. We found that the upregulation of eS7A ubiquitination diminished in grr1D mutant cells after the addition of Tm (Fig. 3A), indicating that Grr1 is required for the upregulation of eS7A ubiquitination upon UPR. We also confirmed that defects in Ubp3 downregulation in the grr1D mutants expressing Grr1-DF or Grr1-DLRR proteins results in the reduction of eS7A mono-ubiquitination. The levels of mono- and diubiquitinated eS7 were reduced in grr1D cells (Fig. 3B, lanes 3–4) and grr1D cells expressing Grr1-DF or Grr1-DLRR mutants (Fig. 3B, lanes 9–12). The levels of mono and di-ubiquitinated eS7 did not change in grr1D cells expressing wild-type Grr1 and Grr1-DN mutant protein (Fig. 3B, lanes 5–8), in which Ubp3 downregulation was intact (Fig. 2B). Not4 monoubiquitinates eS7A at the four lysine residues (Fig. 3C), with K83 ubiquitination primarily responsible for mRNA quality control (Ref). We examined cell growth in the presence of Tm, eS7A ubiquitination, and Hac1p production upon UPR in four eS7A mutants containing a single lysine residue, susceptible to Not4-mediated monoubiquitination, eS7A-K72only, eS7A-K76only, eS7A-K83only and eS7A-K84only. K83 but no other lysine residues were responsible for resistance to Tm (Fig. 3D) and Hac1 expression upon UPR (Fig. 3E, middle panels). Consistently, K83 was found to be the major ubiquitination site of eS7A (Fig. 3E, top panels), confirming that K83 ubiquitination is primarily responsible for eS7A ubiquitination thereby Hac1 production upon UPR. The upregulation of eS7A-K83only ubiquitination was diminished in the grr1D mutant cells after the addition of Tm (Fig. 3F), indicating a crucial role of Grr1 in the upregulation of eS7A ubiquitination at K83 upon UPR.

Grr1 is required for HAC1 ⁱ translation during the UPR in yeast.

These results suggest that Grr1 plays a role in HAC1 translation by downregulating Ubp3 during the UPR in yeast. To test whether Grr1 is involved in translational control of the UPR, we performed RNA-seq and ribosome profiling. To investigate the regulation of translation in response to ER stress, we estimated translation efficiency (TE) by assessing both mRNA abundance and ribosome occupancy. eS7A ubiquitination-dependent translational regulation was monitored at 4 h. Translational responses were observed in grr1D mutant cells, with statistically significant changes in the translation of 41 mRNAs (Fig. 4A-B; Fig. 4A; q-value < 0.01). To examine the Grr1-mediated ubiquitination dependency of the involved mRNAs, TE was compared between WT and grr1D mutant cells (Fig. 4B), with 29 and 12 mRNAs categorized as up- and downregulated, respectively (Fig. 4C). These subsets were identified using the formula “log2 TE fold change (WT) - log2 TE fold change (grr1)”, with mRNAs scored as > 2 and <-2 defined being up- and down-regulated, respectively.

We identified HAC1 as the most significantly upregulated gene during the UPR (Figs. 4A-D). In comparing TE in cells 4 h after the addition of Tm based on reads of HAC1, we found that the TE of HAC1 mRNAs was approximately 4-fold lower in grr1D than in wild-type (WT) cells (Fig. 4C). Mapping of the footprints throughout HAC1ⁱ mRNA in WT and grr1D mutant cells HAC1ⁱ mRNA contains potential translation pause sites (Fig. 4D). These results suggest that Grr1 may be involved in translation initiation and/or elongation of HAC1ⁱ mRNA.

Translation of HAC1 ⁱ mRNA requires eS7A ubiquitination regardless of ER stress.

UPR induces the transcription and splicing of HAC1^u mRNA ensuring Hac1p expression upon UPR. We constructed a 5H3 clone containing the HAC1 ORF, 5′ and 3′ untranslated regions (5′ and 3′ UTRs) but lacking an intron (Fig. 5A) and examined Hac1p levels in hac1D mutant cells harboring 5H3 clones under the control of various promoters (Fig. 5B). Hac1p is induced upon Tm treatment in hac1D mutant cells harboring 5H3 under the control of the HAC1 promoter, as reported (Fig. 5B, lanes 5–6). Hac1p was expressed from 5H3 under the control of the GPD1, TEF1 and ADH1 promoters, regardless of Tm treatment (Fig. 5B, lanes 7–12). Unexpectedly, Hac1p was induced upon UPR in hac1D mutant cells expressing 5H3 under the CYC1 promoter (Fig. 5B, lanes 5–6 and 13–14), suggesting that YC1 transcription is induced upon UPR. We confirmed the expression levels of Hac1p in hac1D mutant cells harboring 5H3 clones under the control of various promoters were sufficient for Tm resistance (Fig. 5C).

We then examined whether eS7A ubiquitination is essential for the translation of HAC1ⁱ mRNA without ER stress. Hac1 was expressed regardless of UPR in eS7-WThac1D cells expressing 5H3 under the control of HAC1 and TEF1 promoters (Fig. 5D, lanes 5–6 and 9–10) but not in eS7-4KRhac1D mutant cells that lack eS7 ubiquitination (Fig. 5D, lanes 7–8 and 11–12), indicating that eS7A ubiquitination is essential for translation of HAC1ⁱ mRNA without ER stress. We then assessed the role of Grr1 in HAC1ⁱ translation by using 5H3 constructs. Hac1p was expressed regardless of UPR in grr1Dhac1D mutant cells expressing 5H3 under the control of HAC1 and TEF1 promoters (Fig. 5E, lanes 5–6 and 9–10). Importantly, Hac1p levels in grr1Dhac1D cells (Fig. 5E, lanes 7–8 and 11–12) were significantly lower than those in hac1D cells (Fig. 5E, lanes 5–6 and 9–10), indicating that Grr1 facilitates translation of HAC1ⁱ mRNA independent of ER stress.

ORF of HAC1ⁱ mRNA requires eS7A ubiquitination-mediated translation stimulation

To understand how eS7A ubiquitination facilitates HAC1ⁱ mRNA translation under ER stress, we examined the putative cis elements required for the regulation. The HAC1ⁱ mRNA 3′-UTR contains a cis-acting 3′-bipartite element (BE) at nucleotides C1134 to A1192 (adenine of the AUG codon is + 1) that promotes co-localization of the translationally repressed HAC1ⁱ mRNA under ER stress^41,42. The protein kinases Kin1 and Kin2 contribute to HAC1^u mRNA processing by phosphorylation of Pal1 and Pal2 which bind to the 3′-BE of HAC1 mRNA. HAC1^u mRNA is stored in the cytoplasm in the absence of ER stress, and its translation is tightly suppressed by a base-pairing interaction between the intron and the 5′-UTR. Excision of the intron by Ire1-dependent splicing in response to ER stress led to robust translation of HAC1ⁱ mRNA, with the resulting Hac1p (Hac1p) upregulating UPR target gene expression (Fig. S3A). We constructed HAC1 with the deletion of 3′-BE or 5′-BP, a region responsible for base-pairing with 3′ UTR or both (Fig. S3A, DBE, DBP, DBP + DBE). The Hac1p was induced 2h after Tm addition in the hac1D mutant cells harboring the 5H3 clones under the control of the HAC1 promoter (Fig. S3B, lanes 5–12), indicating that these cis elements are not essential for the induction of Hac1p upon UPR. Consistently, hac1D mutant cells expressing HAC1 conferred resistance to Tm similar to wild-type cells (Fig. S3C).

To identify the cis-elements involved in eS7A monoubiquitination-dependent translation activation of HAC1ⁱ mRNA, we constructed 5H3, 5H, H3, and H clones that contain the HAC1ⁱ ORF with or without 5′ and 3′ UTRs (Fig. 6A). The hac1D mutant cells expressing the 5H3, 5H, H3, and H mRNAs by the TEF1 promoter (TEF1p-5H3, 5H, H3, H) conferred resistance to Tm similar to wild-type cells (Fig. 6B), indicating that UTRs are dispensable for the expression of Hac1p by the TEF1 promoter at a sufficient level for Tm resistance. The Hac1p was expressed regardless of Tm addition in hac1D mutant cells harboring TEF1p-5H3, 5H, H3, and H clones (Fig. 6C, lanes 7–14). The levels of Hac1p were increased by 5′ and 3′ UTRs (Fig. 6C, lanes 7, 9, 11, 13; Fig. 6D), indicating that UTRs stimulates translation of HAC1ⁱ mRNA as previously reported. We examined the role of eS7A ubiquitination in Hac1p derived from these clones. The levels of Hac1p expressed in all HAC1ⁱ clones were significantly diminished in hac1DeS7A-4KR cells (Fig. 6C, lanes 7–14; Fig, 6D). Inhibition of proteasome activity by MG132 treatment did not rescue the reduction of Hac1p in eS7A-4KR cells (Figs. 6E-F), suggesting that the downregulation of Hac1p in the eS7A-4KR mutant cells may not be due to the facilitation of proteasomal degradation of the Hac1p. Finally, we propose that eS7A ubiquitination facilitates the translation of HAC1ⁱ mRNA depending on putative cis element(s) in the ORF.

Hac1p is expressed specifically in response to ER stress and its expression is ensured by the multi-step regulation of HAC1 mRNA^30,43. This includes localization to the ER membrane, tight repression of translation, and Ire1p-mediated splicing. During ER stress responses in yeast, ubiquitination of ribosomal protein eS7A is necessary for translational control of HAC1ⁱ mRNA. The deubiquitinating enzyme complex Ubp3-Bre5 regulates eS7A ubiquitination, and UPR leads to an increase in the level of monoubiquitinated eS7A by the downregulation of Ubp3. In this study, we identified Grr1, a subunit of the SCF^Grr1 complex, as the crucial E3 ligase responsible for the downregulation of Ubp3, which facilitates eS7A ubiquitination (Fig. 1) and HAC1ⁱ translation (Figs. 2–4). Grr1 binds and degrades Ubp3 regardless of ER stress (Figs. 1–2), and the F-box or LRR domains of Grr1 are essential for Ubp3 degradation, but not for substrate binding (Fig. 2). We propose that Grr1-mediated Ubp3 degradation is crucial for maintaining eS7 ubiquitination during UPR.

The SCF^Grr1 complex plays a crucial role in nutrient uptake and cell proliferation by interacting with various targets^33,44. The F-box Grr1 selects and discriminates substrates, in part, via its leucine-rich repeat (LRR) domain^{33,38–40,44,45}. In the Grr1-mediated downregulation of Ubp3, the LRR domain is required for regulation and interaction. Grr1 interacts with Ubp3 independent of Tm treatment (Fig. 2); however, the downregulation of Ubp3 by Grr1 only under Tm treatment conditions (Fig. 1) indicates that Grr1-mediated degradation of Ubp3 under stress conditions requires unknown regulation to induce Ubp3 degradation after interaction with E3 ligase. Ubp3 roles in quality controls, indicating that the deubiquitination is a key reaction to ensure the accuracy of gene express^{21,23–25,27,28}. The results of this study revealed the crucial role of ubiquitin-proteasomal degradation of the deubiquitinating enzyme under stress conditions in maintaining translation of transcription factor Hac1 in yeast.

The mechanisms underlying the role of eS7A ubiquitination in the translational regulation of ER stress remain unknown. Ribosome profiling revealed that HAC1ⁱ was the most significantly upregulated gene during the UPR (Fig. 4). Translation of HAC1ⁱ mRNA was significantly lower in eS7-4KR cells¹⁸ and grr1Δ cells than in wild-type cells (Fig. 4). One possibility is that eS7A ubiquitination affects the interaction between the 40S subunit and translation initiation factors in the pre-initiation complex, thereby modulating the translation initiation of HAC1ⁱ mRNA. The cycle of ubiquitination and deubiquitination of the 40S ribosomal subunit, eS7A, is important for efficient translation^19,20. The two deubiquitinating enzymes, Otu2 and Ubp3, for eS7A cause defects in protein synthesis^19,20. Otu2 specifically binds to free 40S ribosomes and promotes the dissociation of mRNAs from 40S ribosomes during recycling. Despite the crucial role of Otu2 in translation initiation, the otu2Δ mutant was resistant to Tm²⁰. Ubp3 inhibited the polyubiquitination of eS7A in polysomes to maintain eS7A in a mono-ubiquitinated form, however, otu2Δ suppressed moderate sensitivity of the ubp3Δ mutant to Tm (Fig. S4), suggesting that translation initiation may be involved but not crucial for HAC1ⁱ translation.

We observed that eS7A ubiquitination is essential for the translation of HAC1ⁱ mRNA, which lacks 5’-UTR, 3’-UTR, and introns, even under normal conditions (Fig. 5–6). This suggests that the ORF of HAC1ⁱ mRNA contains elements required for eS7A ubiquitination-mediated regulation (Fig. 6), suggesting that eS7A ubiquitination facilitates the translation elongation of HAC1ⁱ mRNA. Together with the previous footprints of eS7A-WT and eS7A-4KR also revealing putative translation pausing sites, we propose that eS7A ubiquitination facilitates the translation elongation of HAC1ⁱ mRNA depending on the cis-element in ORF. Given that Ubp3 deubiquitinates the ribosomal protein eS7A in the 80S and polysome fractions, the maintenance of eS7A ubiquitination in translating ribosomes could contribute to the efficient translation elongation of HAC1ⁱ mRNA.

The Ccr4-NOT complex monitors translating ribosomes for codon optimality via E-site binding of the N-terminal domain of the Not5 subunit¹⁷. eS7A ubiquitination contributes to the interaction of the Ccr4-Not complex with the ribosome, and thereby codon-optimality-mediated mRNA degradation. The phenotypes of Not4 deletion or the eS7A-4KR mutation were hardly aggravated by additional deletion of Not5-NTD but reduced Not5 association with polyribosomes¹⁷, suggesting that eS7A-ubiquitination by Not4 is involved in the same pathway as Not5 but occurs upstream of E-site probing, and Not5 binding to ribosomes is dependent on prior eS7A-ubiquitination. Our results suggest that Not4-mediated eS7A ubiquitination is required for the efficient translation elongation of HAC1ⁱ mRNA. Although the Ccr4-Not complex association with ribosomes is required for codon optimality-mediated mRNA decay, the stability of the 50% optimal HIS3 reporter mRNA was not changed in the eS7A-4KR or not5Δ mutant cells¹⁷. The codon optimality of HAC1ⁱ mRNA is 50%, and its mRNA level did not decrease in the eS7A-4KR mutant cells¹⁸. More importantly, GFP, with the same codon optimality as HAC1ⁱ mRNA in yeast, can suppress eS7A-mediated regulation. Taken together, we suspect that codon optimality is not solely responsible for the regulation of HAC1ⁱ translation. In mammalian cells, the secondary structure of mRNA contributes to translation and possibly mRNA stability, although its mechanism remains unknown. A more precise analysis of the cis-elements in HAC1ⁱ mRNA and the involvement of trans factors, including Ccr4-NOT, is needed to elucidate the mechanisms underlying the eS7A ubiquitination-mediated regulation of HAC1ⁱ mRNA translation elongation. Further experiments will shed light on how eS7A ubiquitination stimulates the translation of HAC1ⁱ mRNA, providing insight into the crucial role of ribosome ubiquitination in stress responses in addition to well-characterized roles in translation quality controls.

Yeast strains and genetic methods

The Saccharomyces cerevisiae strains used in this study are listed in Supplemental Table 1. Yeast Knock Out (YKO) library strains (BY4741) (Open Biosystems) used in E3 ligase screening are indicated in Supplementary Fig. 1A. Gene disruption, C-terminal tagging and N-terminal tagging were performed following previously reported methods^46–48. Yeast Saccharomyces cerevisiae W303-1a based strains were obtained by established recombination techniques using PCR-amplified cassette sequences (kanMX4, hphMX4, hphNT1, natMX4, or HISMX6). To construct strains of essential ribosomal protein genes (eS7AeS7B), the shuffle strain transformed with plasmid expressing mutant ribosomal protein products was grown on SDC plate containing 0.1%(w/v) of 5-fluoroorotic acid (5-FOA, #F9001-5, Zymo Research) and isolated URA3 absent strain.

Plasmid constructs

DNA cloning was performed with PCR amplification by using gene specific primers and KOD FX Neo (#KFX-201, TOYOBO), and by using T4 DNA ligase (#M0202S, NEB). All cloned DNAs amplified by PCR were verified by sequencing. Plasmids used in this study are listed in Supplemental Table 2. Sequences of HAC1 clones are listed in Supplemental Table 3. These plasmids contain part of an ARS, part of a CEN and CYC1 terminator.

Yeast Culture and Media

All yeast cells were cultured with YPD or synthetic complete (SC) medium with 2% glucose at 30 ºC and harvested by centrifugation and discarding medium. To induce ER stress, yeast cells were grown at 30 ºC until OD₆₀₀ = 0.2, then treated with 1 µg/ml of tunicamycin (Tm, #208–08243, Wako) for ~ 4 hr and harvested. A proteasome inhibitor MG132 (#HY-13259, MCH) was added with tunicamycin to a final concentration of 50 µM. All cell pellets were frozen in liquid nitrogen immediately after harvest and stored at -80 ºC until used.

RNA Isolation, RNA Electrophoresis and Northern Blotting

Yeast cells were harvested at indicated time points (~ 4 hr) after Tm added, as described above. Total RNA solutions were prepared by using one-step hot formamide RNA extraction method and RNA electrophoresis was performed as described⁴⁹. RNA samples containing 1.2 µg of total RNA were incubated at 70 ºC for 5 min and left to stand on ice for 10 min. Each sample was electrophoresed at 200 V for 50 min on a 1.2% HT-FA agarose gel in HT buffer, followed by transfer of RNA to Hybond-N + membrane (GE healthcare) with 20x SSC for over 18 hr using capillary system. RNA was cross-linked on the membrane by CL-1000 ultraviolet crosslinker (UVP) at 120 mJ/cm². Membrane was incubated with DIG Easy Hyb Granules (#11796895001, Roche) for 1 hr at 50°C in a hybridization oven and DIG-labelled probe prepared using PCR DIG Probe Synthesis Kit (#11636090910, Roche) was added and incubated for over 18 hr. The membrane was washed with wash buffer I for 15 min in a hybridization oven, followed by washing twice with wash buffer II for 15 min in a hybridization oven. The membrane was then washed with 1x maleic acid buffer for 10 min at room temperature and incubated with Blocking Reagent (#11096176001, Roche) for 30 min. Anti-Digoxigenin-AP, Fab fragments (#11093274910, Roche) was added to the Blocking Reagent and the membrane was further incubated for 1 hr. After that, the membrane was washed three times with wash buffer III for 10min and equilibrated by equilibration buffer. The membrane was reacted with CDP-star (#11759051001, Roche) for 10 min, and chemiluminescence was detected by LAS-4000 (GE healthcare).

・RNA sample (50% deionized Formamide, 30 mM HEPES, 30 mM Triethanolamine, 0.4 M Formaldehyde (#061–00416, Wako), 0.5 mM EDTA, 0.02% bromophenol blue)

・HT buffer (30 mM HEPES, 30 mM Triethanolamine)

・1.2% HT-FA agarose gel (Agarose LE Analytical Grade (#V3125, Promega), 30 mM HEPES, 30 mM Triethanolamine, 0.4M Formaldehyde)

・20x SSC (3 M NaCl, 300 mM Trisodium citrate dihydrate)

・Wash buffer I (2x SSC, 0.1% SDS)

・Wash buffer II (0.1x SSC, 0.1% SDS)

・1x maleic acid buffer (100 mM maleic acid, 150 mM NaCl, pH 7.0, adjusted by NaOH)

・Wash buffer III (1x maleic acid buffer, 0.3% tween 20)

・Equilibration buffer (100 mM Tris-HCl, 100 mM NaCl, pH 9.5)

Trichloroacetic acid (TCA) precipitation for protein preparation

Yeast cell pellet in 1.5 ml tube (stand on ice) was resuspended with 1 ml of ice-cold double-distilled water containing 1 mM phenylmethylsulfonyl fluoride (PMSF, #164-12181, Wako). 100 µl of yeast suspension was diluted with 900 µl of double-distilled water followed by OD₆₀₀ measurement. To the rest of yeast suspension (900 µl), 135 µl of Lysis buffer was added and incubated on ice for 15 min. After that, 135 µl of 50% TCA was added to samples and incubated on ice for 10 min. After centrifugation of lysates (14,000 rpm, 10 min, 4 ºC), the supernatant was discarded completely, and the pellet was dissolved in HU buffer (250 µl/OD₆₀₀) and heated 65 ºC for 10 min. After centrifugation at 14,000 rpm for 5 min, room temperature, the supernatant was used as a sample of SDS-PAGE.

・Lysis buffer (2 M NaOH, 1 M 2-Mercaptoethanol)

・HU buffer (8 M Urea, 0.2 M Tris-HCl pH 6.8, 5% SDS, 1 mM EDTA, 0.01% BPB, 100 mM DTT)

Protein Electrophoresis and Western Blotting

Protein samples were separated by SDS-PAGE and were transferred onto PVDF membrane (Immobilon-P, Millipore). After blocking with 5% skim milk in PBS-T, the membrane was incubated with primary antibodies overnight at 4°C. The membrane was washed with PBS-T for three times followed by incubation with horseradish peroxidase (HRP)-conjugated secondary antibodies for 1 hr at room temperature. In the case of HA-tagged protein detection, the membrane was incubated with HRP-conjugated anti-HA antibodies. After washing with PBS-T for three times, chemiluminescence was detected by LAS4000 (GE Healthcare) or Amersham ImageQuant 800 (cytiva). Primary antibodies for western blotting in this study were listed in Supplemental Table 4. Quantification of band intensities were performed using ImageQuant TL software (Cytiva) and Multi Gauge software (Fuji film).

・PBS-T (10 mM Na₂HPO₄/NaH₂PO₄ pH 7.5, 0.9% NaCl, 0.1% Tween-20)

Spot assay

Yeast cells were cultured with 3 ml YPD or SC medium with 2% glucose at 30 ºC overnight and adjusted to OD₆₀₀ = 0.3. 10-fold serial dilutions were prepared in the 1.5 ml tubes and spotted onto 1 µg/ml Tm added plates and control plates. Plates were incubated at 30 ºC for several days.

Ribosome Profiling (Ribo-seq) and RNA-seq

Library preparation was performed as described¹⁸ with following modifications. After 4 hr of tunicamycin treatment, yeast cells were harvested by filtration and frozen by liquid nitrogen. They were lysed by lysis buffer for Ribo-seq (20 mM Tris-HCl [pH 7.5], 150 mM NaCl, 5 mM MgCl2, 1 mM DTT, 1% Triton X-100, 0.1 mg/mL cycloheximide, 25 U/mL Turbo DNase (Invitrogen, AM2238)). Clear lysates were obtained by centrifugation at 20,000 xg for 10 min at 4°C. Clear lysate containing 20 µg total RNA was treated with 1.25 unit of RNase I (#E0067-10D1, LGC Biosearch Technologies) per µg RNA for 45 min at 25°C. RNase I treatment was quenched by the addition of 200 units of SUPERase•In RNase Inhibitor (Invitrogen, AM2694). RNA-digested lysate was layered on a sucrose cushion (1 M sucrose, 20 mM Tris-HCl [pH 7.5], 150 mM NaCl, 5 mM MgCl2, 1 mM DTT, 0.1 mg/mL cycloheximide, 20 U/mL SUPERase•In RNase Inhibitor), followed by centrifugation in a TLA-110 rotor (Beckman) at 100,000 rpm for 1 hr at 4°C. The ribosomal pellet was resuspended in 120 µL of splitting buffer (20 mM Tris-HCl [pH 7.5], 300 mM NaCl, 5 mM EDTA, 1% Triton X-100, 1 mM DTT, 20 U/mL of SUPERase•In RNase Inhibitor) to dissociate ribosomes from the mRNA fragments, and then passed through the 100 kDa MWCO Amicon Ultra-0.5 device (Millipore, UFC5100). The non-ribosomal flow-through (approximately 100 µL) was collected and mixed with 300 µL TRIzol reagent (Invitrogen, 15596018). RNA fragments were extracted by Direct-zol RNA MicroPrep (Zymo Research). For the ribosome profiling analysis, the whole cell lysate containing 20 µg of total RNA was treated with 1.25 units/1 µg RNA of RNase I (#E0067-10D1, LGC Biosearch Technologies) at 25 ºC for 45 min. As linker DNA, 5’-(Phos)NNNNNIIIIITGATCGGAAGAGCACACGTCTGAA(ddC)-3’ where (Phos) indicated 5’ phosphorylation and (ddC) indicates a terminal 2’, 3’-dideoxycytidine, was used. The Ns and Is indicate random barcodes for eliminating PCR duplication and multiplexing barcodes, respectively. The linkers were pre-adenylated with 5’ DNA Adenylation kit (NEB), and then used for the ligation reaction. The rRNAs were removed using a mixture of riboPOOL (siTOOLs Biotech) and homemade customized biotinylated oligos. An oligo 5’-(Phos)NNAGATCGGAAGAGCGTCGTGTAGGGAAAGAG(iSp18)GTGACTGGA GTTCAGACGTGTGCTC-3’, where (Phos) indicated 5’ phosphorylation and Ns indicate random barcode, was used for reverse transcription. PCR was performed with oligos, 5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3’ and 5’- CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3’, where Js indicate reverse complement of the index sequence discovered during Illumina sequencing. The libraries were sequenced on a HiSeq X Ten (Illumina) at Macrogen Japan corp.

For the RNA-seq analysis, total RNA was extracted from lysate using Direct-zol RNA Microprep w/ Zymo-Spin IC Columns (#R2062, funakoshi). The libraries were sequenced on a DNBSEQ-G400RS High-throughput Sequencing Kit (MGI Tech Co., Ltd.) at Bioengineering Lab, Japan. The reads were mapped to yeast transcriptome, removing duplicated reads based on random barcode sequences. The analyses for ribosome profiling were restricted to 27–29 nt reads for WT and grr1∆ data sets. The DESeq2 package was used to calculate the fold change of mRNA expression and translation efficiency (TE).

Cycloheximide Chase Assay

After 1 hr of tunicamycin treatment, then yeast cells were treated with 0.25 mg/mL cycloheximide. At the indicated time points, yeast cells were treated with 30 mM sodium azide and harvested by centrifugation and discarding medium. A proteasome inhibitor MG132 (#HY-13259, MCH) was added with tunicamycin to a final concentration of 50 µM. Protein stability was determined by western blotting.

Immunoprecipitation using FLAG beads

After 1.5 hr of tunicamycin treatment, then yeast cells were harvested by centrifugation (6,000 rpm, 5 min, room temperature) and discarding medium. All cell pellets were frozen in liquid nitrogen immediately after harvest and stored at -80 ºC until used. After grinding the cell pellets in liquid nitrogen with a mortar and a pestle, the cell pellets were lysed with Lysis buffer for IP to prepare crude lysate. Anti DYKDDDDK tag Antibody Beads (# 016-22784, Wako) were added to the crude lysate and rotated at 4°C for 1 hr. The beads were washed 7 times with Wash buffer for IP. FLAG-tagged proteins were eluted twice by Elution buffer for IP with FLAG peptide at 4°C for 1 hour. After TCA precipitation, samples were subjected to SDS-PAGE and western blotting.

・Lysis buffer for IP (50 mM Tris-HCl pH 7.5, 100 mM NaCl, 10 mM MgCl2, 2 mM 2-Mercaptoethanol, 0.01% NP-40, 1 tablet/10mL cOmplete mini EDTA-free (# 11836170001, Roche))

・Wash buffer for IP (50 mM Tris-HCl pH 7.5, 100 mM NaCl, 10 mM MgCl2, 2 mM 2-Mercaptoethanol, 0.01% NP-40)

・Elution buffer for IP with FLAG peptide (50 mM Tris-HCl pH 7.5, 100 mM NaCl, 10 mM MgCl2, 2 mM 2-Mercaptoethanol, 0.01% NP-40, 100 µg/mL FLAG® Peptide (# F3290, Sigma aldrich))

DATA AVAILABILITY

The sequencing data of RNA-seq and ribosome profiling have been deposited in the NCBI Gene Expression Omnibus and are accessible through GEO series accession number GSE260735 and GSE260736, respectively.

ACKNOWLEDGEMENTS

The authors thank Dr. Toru Yoshihisa, University of Hyogo, for providing antibody against the Hac1 protein and for critically reading the manuscript. The authors thank the members of their laboratories for discussions and critical comments on the manuscript. This work was supported by AMED (JP23gm1110010, JP223fa627001 to TI), MEXT/JSPS KAKENHI (Grant Numbers JP19H05281, 21H05277, 22H00401 to T.I., 21H00267, 23H04249 and 23K23869,18H05498 to Y.S.), Research grants from Takeda Science Foundation (T.I.), and JST PREST Grant Number JPMJPR21EE (Y.M.).

AUTHOR CONTRIBUTIONS

Genetic and biochemical experiments were performed by N.S., N.Y., Y.M. and S.T. under the supervision of T.I. N.S. performed the ribosome profiling experiments, under the supervision of S.Li, Y.M., and T.I. N.S. and T.I. wrote the manuscript. T.I. primarily conceived the idea and designed the experiments.

COMPETING INTERESTS STATEMENT

The authors declare that they have no competing interests.

Joazeiro CAP (2019) Mechanisms and functions of ribosome-associated protein quality control. Nat Rev Mol Cell Biol 20:368–383. https://doi.org:10.1038/s41580-019-0118-2
Monaghan L, Longman D, Cáceres JF (2023) Translation-coupled mRNA quality control mechanisms. Embo j 42:e114378. https://doi.org:10.15252/embj.2023114378
Brandman O, Hegde RS (2016) Ribosome-associated protein quality control. Nat Struct Mol Biol 23:7–15. https://doi.org:10.1038/nsmb.3147
Shao S, Hegde RS (2016) Target Selection during Protein Quality Control. Trends Biochem Sci 41:124–137. https://doi.org:10.1016/j.tibs.2015.10.007
Inada T (2020) Quality controls induced by aberrant translation. Nucleic Acids Res 48:1084–1096. https://doi.org:10.1093/nar/gkz1201
Narita M et al (2022) A distinct mammalian disome collision interface harbors K63-linked polyubiquitination of uS10 to trigger hRQT-mediated subunit dissociation. Nat Commun 13:6411. https://doi.org:10.1038/s41467-022-34097-9
Matsuo Y, Uchihashi T, Inada T (2023) Decoding of the ubiquitin code for clearance of colliding ribosomes by the RQT complex. Nat Commun 14:79. https://doi.org:10.1038/s41467-022-35608-4
Matsuo Y et al (2017) Ubiquitination of stalled ribosome triggers ribosome-associated quality control. Nat Commun 8:159. https://doi.org:10.1038/s41467-017-00188-1
Ikeuchi K et al (2019) Collided ribosomes form a unique structural interface to induce Hel2-driven quality control pathways. Embo j 38. https://doi.org:10.15252/embj.2018100276
Best K et al (2023) Structural basis for clearing of ribosome collisions by the RQT complex. Nat Commun 14:921. https://doi.org:10.1038/s41467-023-36230-8
Matsuo Y et al (2020) RQT complex dissociates ribosomes collided on endogenous RQC substrate SDD1. Nat Struct Mol Biol 27:323–332. https://doi.org:10.1038/s41594-020-0393-9
Hashimoto S, Sugiyama T, Yamazaki R, Nobuta R, Inada T (2020) Identification of a novel trigger complex that facilitates ribosome-associated quality control in mammalian cells. Sci Rep 10:3422. https://doi.org:10.1038/s41598-020-60241-w
D'Orazio KN et al (2019) The endonuclease Cue2 cleaves mRNAs at stalled ribosomes during No Go Decay. Elife 8. https://doi.org:10.7554/eLife.49117
Tomomatsu S et al (2023) Two modes of Cue2-mediated mRNA cleavage with distinct substrate recognition initiate no-go decay. Nucleic Acids Res 51:253–270. https://doi.org:10.1093/nar/gkac1172
Collart MA (2003) Global control of gene expression in yeast by the Ccr4-Not complex. Gene 313:1–16
Collart MA (2016) The Ccr4-Not complex is a key regulator of eukaryotic gene expression. Wiley Interdiscip Rev RNA. https://doi.org:10.1002/wrna.1332
Buschauer R et al (2020) The Ccr4-Not complex monitors the translating ribosome for codon optimality. Science 368. https://doi.org:10.1126/science.aay6912
Matsuki Y et al (2020) Ribosomal protein S7 ubiquitination during ER stress in yeast is associated with selective mRNA translation and stress outcome. Sci Rep 10:19669. https://doi.org:10.1038/s41598-020-76239-3
Takehara Y et al (2021) The ubiquitination-deubiquitination cycle on the ribosomal protein eS7A is crucial for efficient translation. iScience 24:102145. https://doi.org:10.1016/j.isci.2021.102145
Ikeuchi K et al (2023) Molecular basis for recognition and deubiquitination of 40S ribosomes by Otu2. Nat Commun 14:2730. https://doi.org:10.1038/s41467-023-38161-w
Fang NN, Zhu M, Rose A, Wu KP, Mayor T (2016) Deubiquitinase activity is required for the proteasomal degradation of misfolded cytosolic proteins upon heat-stress. Nat Commun 7:12907. https://doi.org:10.1038/ncomms12907
Jung Y et al (2017) Modulating cellular balance of Rps3 mono-ubiquitination by both Hel2 E3 ligase and Ubp3 deubiquitinase regulates protein quality control. Exp Mol Med 49:e390. https://doi.org:10.1038/emm.2017.128
Kraft C, Deplazes A, Sohrmann M, Peter M (2008) Mature ribosomes are selectively degraded upon starvation by an autophagy pathway requiring the Ubp3p/Bre5p ubiquitin protease. Nat Cell Biol 10:602–610. https://doi.org:10.1038/ncb1723
Kraft C, Peter M (2008) Is the Rsp5 ubiquitin ligase involved in the regulation of ribophagy? Autophagy 4:838–840
Kvint K et al (2008) Reversal of RNA polymerase II ubiquitylation by the ubiquitin protease Ubp3. Mol Cell 30:498–506. https://doi.org:10.1016/j.molcel.2008.04.018
Oling D, Masoom R, Kvint K (2014) Loss of Ubp3 increases silencing, decreases unequal recombination in rDNA, and shortens the replicative life span in Saccharomyces cerevisiae. Mol Biol Cell 25:1916–1924. https://doi.org:10.1091/mbc.E13-10-0591
Ossareh-Nazari B et al (2010) Cdc48 and Ufd3, new partners of the ubiquitin protease Ubp3, are required for ribophagy. EMBO Rep 11:548–554. https://doi.org:10.1038/embor.2010.74
Ossareh-Nazari B et al (2014) Ubiquitylation by the Ltn1 E3 ligase protects 60S ribosomes from starvation-induced selective autophagy. J Cell Biol 204:909–917. https://doi.org:10.1083/jcb.201308139
Ron D, Walter P (2007) Signal integration in the endoplasmic reticulum unfolded protein response. Nat Rev Mol Cell Biol 8:519–529. https://doi.org:10.1038/nrm2199
Walter P, Ron D (2011) The unfolded protein response: from stress pathway to homeostatic regulation. Science 334:1081–1086. https://doi.org:10.1126/science.1209038
Xu C, Bailly-Maitre B, Reed JC (2005) Endoplasmic reticulum stress: cell life and death decisions. J Clin Invest 115:2656–2664. https://doi.org:10.1172/jci26373
Cox JS, Walter P (1996) A novel mechanism for regulating activity of a transcription factor that controls the unfolded protein response. Cell 87:391–404. https://doi.org:10.1016/s0092-8674(00)81360-4
Willems AR et al (1999) SCF ubiquitin protein ligases and phosphorylation-dependent proteolysis. Philos Trans R Soc Lond B Biol Sci 354:1533–1550. https://doi.org:10.1098/rstb.1999.0497
Rüegsegger U, Leber JH, Walter P (2001) Block of HAC1 mRNA translation by long-range base pairing is released by cytoplasmic splicing upon induction of the unfolded protein response. Cell 107:103–114. https://doi.org:10.1016/s0092-8674(01)00505-0
Cox JS, Shamu CE, Walter P (1993) Transcriptional induction of genes encoding endoplasmic reticulum resident proteins requires a transmembrane protein kinase. Cell 73:1197–1206. https://doi.org:10.1016/0092-8674(93)90648-a
Tirasophon W, Welihinda AA, Kaufman RJ (1998) A stress response pathway from the endoplasmic reticulum to the nucleus requires a novel bifunctional protein kinase/endoribonuclease (Ire1p) in mammalian cells. Genes Dev 12:1812–1824. https://doi.org:10.1101/gad.12.12.1812
Higgins R et al (2015) The Unfolded Protein Response Triggers Site-Specific Regulatory Ubiquitylation of 40S Ribosomal Proteins. Mol Cell 59:35–49. https://doi.org:10.1016/j.molcel.2015.04.026
Flick JS, Johnston M (1991) GRR1 of Saccharomyces cerevisiae is required for glucose repression and encodes a protein with leucine-rich repeats. Mol Cell Biol 11:5101–5112. https://doi.org:10.1128/mcb.11.10.5101-5112.1991
Skowyra D et al (1999) Reconstitution of G1 cyclin ubiquitination with complexes containing SCFGrr1 and Rbx1. Science 284:662–665. https://doi.org:10.1126/science.284.5414.662
Kusama K et al (2022) Dot6/Tod6 degradation fine-tunes the repression of ribosome biogenesis under nutrient-limited conditions. iScience 25:103986. https://doi.org:10.1016/j.isci.2022.103986
Anshu A, Mannan MA, Chakraborty A, Chakrabarti S, Dey M (2015) A novel role for protein kinase Kin2 in regulating HAC1 mRNA translocation, splicing, and translation. Mol Cell Biol 35:199–210. https://doi.org:10.1128/mcb.00981-14
Ghosh C et al (2021) Phosphorylation of Pal2 by the protein kinases Kin1 and Kin2 modulates HAC1 mRNA splicing in the unfolded protein response in yeast. Sci Signal 14. https://doi.org:10.1126/scisignal.aaz4401
Karagöz GE, Acosta-Alvear D, Walter P (2019) The Unfolded Protein Response: Detecting and Responding to Fluctuations in the Protein-Folding Capacity of the Endoplasmic Reticulum. Cold Spring Harb Perspect Biol 11. https://doi.org:10.1101/cshperspect.a033886
Benanti JA, Cheung SK, Brady MC, Toczyski DP (2007) A proteomic screen reveals SCFGrr1 targets that regulate the glycolytic-gluconeogenic switch. Nat Cell Biol 9:1184–1191. https://doi.org:10.1038/ncb1639
Berset C et al (2002) Transferable domain in the G(1) cyclin Cln2 sufficient to switch degradation of Sic1 from the E3 ubiquitin ligase SCF(Cdc4) to SCF(Grr1). Mol Cell Biol 22:4463–4476. https://doi.org:10.1128/mcb.22.13.4463-4476.2002
Mathur R, Kaiser P (2014) PCR-mediated epitope tagging of genes in yeast. Methods Mol Biol 1205:37–44. https://doi.org:10.1007/978-1-4939-1363-3_4
Janke C et al (2004) A versatile toolbox for PCR-based tagging of yeast genes: new fluorescent proteins, more markers and promoter substitution cassettes. Yeast 21:947–962. https://doi.org:10.1002/yea.1142
Longtine MS et al (1998) Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast 14:953–961. https://doi.org:10.1002/(SICI)1097-0061(199807)14:10<953::AID-YEA293>3.0.CO;2-U
Inada T, Aiba H (2005) Translation of aberrant mRNAs lacking a termination codon or with a shortened 3'-UTR is repressed after initiation in yeast. EMBO J 24:1584–1595. https://doi.org:10.1038/sj.emboj.7600636

There is NO Competing Interest.

Download PDF

Version 1

posted

You are reading this latest preprint version

Grr1-mediated Ubp3 degradation is crucial for HAC1 mRNA translation and unfolded stress response in yeast

Status:

Version 1

Abstract

Figures

INTRODUCTION

RESULTS

ORF of HAC1ⁱ mRNA requires eS7A ubiquitination-mediated translation stimulation

DISCUSSION

MATERIALS AND METHODS

Yeast strains and genetic methods

Plasmid constructs

Yeast Culture and Media

RNA Isolation, RNA Electrophoresis and Northern Blotting

Trichloroacetic acid (TCA) precipitation for protein preparation

Protein Electrophoresis and Western Blotting

Spot assay

Ribosome Profiling (Ribo-seq) and RNA-seq

Cycloheximide Chase Assay

Immunoprecipitation using FLAG beads

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1

Grr1-mediated Ubp3 degradation is crucial for HAC1 mRNA translation and unfolded stress response in yeast

Status:

Version 1

Abstract

Figures

INTRODUCTION

RESULTS

ORF of HAC1i mRNA requires eS7A ubiquitination-mediated translation stimulation

DISCUSSION

MATERIALS AND METHODS

Yeast strains and genetic methods

Plasmid constructs

Yeast Culture and Media

RNA Isolation, RNA Electrophoresis and Northern Blotting

Trichloroacetic acid (TCA) precipitation for protein preparation

Protein Electrophoresis and Western Blotting

Spot assay

Ribosome Profiling (Ribo-seq) and RNA-seq

Cycloheximide Chase Assay

Immunoprecipitation using FLAG beads

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1

ORF of HAC1ⁱ mRNA requires eS7A ubiquitination-mediated translation stimulation