High-Intensity Interval Training Protectively Modulates Doxorubicin- Induced Changes in Cardiac Mitochondrial Dynamics and Autophagy Process

doi:10.21203/rs.3.rs-4866536/v1

Download PDF

Research Article

High-Intensity Interval Training Protectively Modulates Doxorubicin- Induced Changes in Cardiac Mitochondrial Dynamics and Autophagy Process

https://doi.org/10.21203/rs.3.rs-4866536/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Purpose

Clinical use of doxorubicin (DOX) in cancer treatment is limited due to the most serious cardiotoxicity side effects. Limited studies have been conducted on the protective effects of high-intensity interval training (HIIT) on DOX-induced cardiotoxicity (DCT). The study aimed to explore the protective impact of HIIT on DCT by analyzing genes associated with the autophagy process and mitochondrial dynamics (such as Beclin1, LC3II, DRP1, FIS1, OPA1, and MFN2).

Methods

Wistar rats (N = 24) were randomly divided into Control, DOX (20 mg/kg body weight), HIIT (8 weeks, 7 sets of 4 minutes 80–90% VO2max isolated with 3-minute periods of 65–75% VO2max) and 4), and HIIT + DOX groups. DOX treatment was completed after the last session of HIIT, and the left ventricular tissue was harvested 72 hours after it. Gene expression assessment was done using the RT-PCR test. The data were analyzed by one-way analysis of variance with Tukey's post hoc test (α < 0.05).

Results

DOX induction non-significantly increased Drp1 and Fis1 mRNA levels (p < 0.05). It also significantly decreases LC3II, Beclin1, and MNF2 mRNA levels and increases OPA1 mRNA levels (p < 0.05). Also, HIIT per se and before DOX induction not only significantly decreased Drp1, Fis1, and OPA1 mRNA levels but also led to an increase in LC3II and Beclin1 mRNA levels. HIIT per se and before DOX induction also non-significantly increased MNF2 mRNA level (p < 0.05).

Conclusion

Therefore, HIIT appears to be an appropriate protective strategy against DCT by attenuating the DOX-induced disturbances in the mitochondrial dynamics and autophagy process.

Autophagy

Cardiotoxicity

Doxorubicin

High-intensity interval training

Mitochondrial dynamics

Doxorubicin (DOX) has been the most widely used potent anthracycline antibiotic in treating various solid malignant tumors since 1969 [1, 2]. But its effectiveness is limited especially by cardiotoxicity (inability of the heart to pump blood in the body effectively) which depends on the drug dose as a late effect [3]. So, DOX treatment could lead to heart failure (HF) and cardiomyopathy within months and even years after treatment discontinuation, especially in younger subjects [1]. while the molecular mechanisms underlying DOX-induced cardiotoxicity (DCT) have not been fully elucidated, mitochondrial dysfunction [4, 5] and the subsequent accumulation of dysfunctional and fragmented mitochondria through disruption of the dynamic processes of mitochondrial fission and fusion (under the title "Mitochondrial dynamics") is considered as the first main step of DCT [2, 3]. DOX could lead to a decrease in the expression of fusion-related proteins (MNF1, MNF2, and OPA1) [6] and an increase in the expression of fission-related protein (DRP1), along with fragmentation of mitochondria [6, 7]. However, it was stated that DOX could increase the RNA expression of fusion-related proteins (MNF2 and OPA1) while increasing mitochondrial fragmentation [8]. Therefore, there are contradictory results regarding proteins related to mitochondrial fusion.

On the other hand, damaged and fragmented mitochondria could be destroyed via the autophagy process [9], but previous studies show conflicting results about the effect of DOX on the autophagy process [6, 10]. It has been reported that DOX could lead to the enhancement of autophagy [7] by increasing the gene expression of autophagy-related proteins (LC3, Beclin1, Pink1, Parkin, and p62) [6]. Despite this, Pizarro et al. showed that DOX could inhibit the autophagy process by reducing the expression of Beclin1 levels and stimulating the Akt/mTOR signaling pathway [10]. Therefore, more research is needed in this area.

Due to the utility of DOX in cancer treatment, physical activity, especially moderate-intensity endurance training (MCT), has been considered an important non-pharmacological strategy to deal with DCT [4, 5, 11, 12]. On the other hand, high-intensity interval training (HIIT), which includes repeated periods of high-intensity exercise with moderate-to-low-intensity active recovery periods, was first introduced by the American Heart Association (AHA) in the field of cardiac rehabilitation (CR) in 2007 [13]. Studies have shown that HIIT induces greater cardiovascular adaptations than MCT [14]. In addition, HIIT could be more effective in improving exercise tolerance in patients with low body mass index [15]. Recent research has also shown that HIIT could reduce DCT by reducing serum biomarkers of heart damage (LDH and CK-MB levels) [16], and increasing the amount of antioxidant enzymes in the heart tissues [17]. Also, HIIT could reduce DCT by increasing the expression of mitophagy genes (Parkin and Mfn2) [18]. To our knowledge, limited studies have investigated the preventive role of HIIT against DCT, so the effective mechanisms of this type of training have not been well elucidated. Therefore, this research aimed to investigate the preventive effect of HIIT on DCT by examining the expression levels of genes related to the autophagy process (Beclin1 and LC3II) and mitochondrial dynamics (FIS1, DRP1, OPA1, and MFN2) in the left ventricle of the rat heart.

Animals

24 Wistar male rats, 3 weeks old, weighing between 250 gr and 270 gr were purchased from the Laboratory Animal Research Center of Tabriz University of Medical Sciences. To adapt to the new environment, the rats were kept in a room with a controlled temperature (21 ± 2°C) and 12 hours of light and 12 hours of darkness with free access to food and water for one week. Then, to get familiar with the exercise training, all rats were trained on the rodent treadmill for at least 3 sessions a week, 15 minutes at a speed of 10 m/min for one week (Table 1). After getting acquainted with the exercise training, the animals were randomly divided into 4 groups: control (Control); treatment with DOX (DOX); high-intensity interval training (HIIT); and DOX treatment after 8 weeks of HIIT (HIIT + DOX).

Table 1

Timeline for applying variables.
Variable	Maintenance in the laboratory environment	Getting familiar with the rodent treadmill	HIIT	DOX injection	Blood sampling
Timeline	One week	One week	Eight weeks	Immediately after the last HIIT training session	72 hours after DOX-injection

The HIIT protocol

The HIIT protocol on the treadmill, which was developed based on Jiang et al.'s research [19], included three stages: (1) ten minutes of warm-up with an intensity of 50–55% maximal oxygen uptake (VO2max), (2) seven consecutive sets of 4 minutes with 80–90% VO2max separated by 3-minute periods with intensity of 65–75% VO2max, and (3) one minute of cooldown period with an approximate intensity of 50 to 55% of VO2max. The animals trained on the rodent treadmill for 60 minutes, 5 days a week, and 8 weeks.

Despite the lack of access to the direct means of estimating VO2max, the intensity of the training was precisely and indirectly estimated based on the speed of movement at the beginning of every two weeks, according to recent research (Høydal et al., 2007) that there is a strong relationship between the speed of running and VO2max [20]. In this way, after 10–20 minutes of warm-up, the treadmill rate sped up every two minutes by 0.03 m/s (1.8-2 m/min) until the rats couldn't continue running. The speed at which the rats reached their maximum oxygen consumption (VO2 max) was when they could no longer keep up with the increasing treadmill speed.

DOX injection and tissue removal

Immediately after the last session of HIIT exercise, animals received a cumulative dose of DOX hydrochloride (20 mg/kg body weight, intraperitoneally (IP)) [21]. 72 hours after DOX injection and overnight fasting, the animals were anesthetized by intraperitoneal injection of ketamine (90 mg/kg) and xylazine (10 mg/kg) and then killed, and the heart was quickly removed. Immediately, all left ventricular tissue samples were transferred to an RNase inhibitor solution (manufactured by Qiagen) and stored at -80°C until RNA extraction [22]. The groups without DOX treatment also received the same amount of saline.

RNA isolation and cDNA synthesis

The Real-time PCR technique was used to evaluate the expression level of OPA1, DRP1, FIS1, Mfn2, LC3II, and Beclin1. In this way, total RNA was carefully isolated from the tissue samples of the left ventricle using TriPure isolation reagent solution (manufactured by Roche) according to the instructions. To determine the quality and quantity of extracted RNAs, the optical density (OD) of all samples was measured with a Thermo Scientific NanoDrop 2000c spectrophotometer device. Then, complementary DNA (cDNA) was synthesized as template DNA using a cDNA synthesis kit (manufactured by TAKARA company) according to the manufacturer's instructions [22].

Real-time quantitative polymerase chain reaction (qPCR) technique

Quantitative analysis was performed by the StepOnePlus Real-time PCR system. The relative expression of OPA1, DRP1, FIS1, Mfn2, LC3II and Beclin1 in the heart tissue samples was measured using gene-specific primers and Cybergreen Master Mix (manufactured by TAKARA) on Light Cycler 96 Instrument (Bio-Rad). In order to normalize the expression levels of all target genes, the parallel measurement of the expression level of GAPDH (housekeeping gene) was used. The sequences of the primers used in this study are shown in Table 2. Also, according to reference gene expression and Pfaffl et al.'s (2001) method, target gene expression was measured [23].

Table 2

Primer sequences in qPCR
Genes	melting temperature (Tm)	Forward	Reverse	Product length (bp)
DRP1	61	GGAGAAAAGGAAGCAAGCGGG	CAATCTGAGGCAGCTGGATGA	123
OPA1	59	GCTCTATGCCCTTGTTGCTGA	TTGGCAGACTTCACAGGCCAG	168
Mfn2	59	TGGACCTGAATCGGCACAGAG	ATCGAGAAAAGAGCAGGGACA	129
FIS1	61	GGGACCCAAGCGTGCTTTCTG	TCTGACAAAGGACAGTCCCAA	82
Beclin1	59	GTCAGCTCTCGTCAAGGCGTC	CGAGACCTCCAGAGTTCCCAT	103
LC3II	61	GTCCAGGCTAGCGGGGAGATA	AGTAACCTTTAGGGCGGCAG	83

statistical analysis

All data are expressed as mean ± standard deviation. Statistical analysis was performed with IBM SPSS version 23 software. Shapiro-Wilk test was used to check the normality of the data. Also, one-way ANOVA ("analysis of variance") was used to analyze the data with Tukey's post hoc test for any comparison between groups (α < 0.05).

Proteins related to mitochondrial dynamics (Fig. 2)

Results showed that DOX induction led to not only a non-significant increase in the mRNA levels of proteins related to mitochondrial fission (FIS1 and DRP1) but also a significant decrease in Mfn2 mRNA level (an important protein mitochondrial fusion controller) (p = 0.000) compared to the control group. Surprisingly, DOX induction in rats led to a significant increase in OPA1 mRNA level compared to the control group (p = 0.000). HIIT per se and before DOX induction not only significantly decreased FIS1 and DRP1 mRNA levels (P = 0.000) but also led to a decrease in OPA1 mRNA levels (p = 0.000) and a nonsignificant increase in MNF2 mRNA levels. Therefore, preconditioning HIIT could mitigate effectively DOX-induced changes in the mitochondrial dynamic process.

Figure 2. A: OPA1, B: Mfn2, C: FIS1, and D: DRP1 mRNA levels in the left ventricle of rats in the four experimental groups. (*) p < 0.05; (**) p < 0.01: statistically significant difference from the Control group. (#) p < 0.05; (##) p < 0.01: statistically significant difference from the DOX group.

Proteins related to autophagy process (Fig. 3)

The results showed that the gene expression levels of LC3II (P = 0.002) and Beclin1 (P = 0.005) decreased significantly after DOX induction in rats. This means that DOX led to the inactivation of the autophagy process. Also, HIIT per se led to a significant increase in the expression levels of LC3II (P = 0.01) and Beclin1 (P = 0.0001) (activation of the autophagy process). HIIT before DOX induction also significantly increased the expression levels of LC3II (P = 0.000) and Beclin1 (P = 0.008). Therefore, HIIT could be an effective strategy in inhibiting the changes made in the autophagy process caused by DOX injection. In other words, performing HIIT before DOX injection could be an effective protective strategy against DCT by alleviating the changes made in the autophagy process.

Figure 3. A: Beclin1, and D: LC3II mRNA levels in the left ventricle of rats in the four experimental groups. (*) p < 0.05; (**) p < 0.01: statistically significant difference from the Control group. (#) p < 0.05; (##) p < 0.01: statistically significant difference from the DOX group.

DOX induction leads to cardiotoxicity [16] by dysfunctional and fragmented mitochondria accumulation mediated by an imbalance in the mitochondrial fission and fusion processes [2]. Studies have shown that DOX treatment increases the levels of DRP1 protein and expression [6, 7], but blocking DRP1 reduces DOX-induced mitochondrial fragmentation and cell death in the heart [7]. Surprisingly, the present study observed that the increased expression of DRP1 and FIS1 proteins (key factors in mitochondrial fission) did not yield statistically significant results. This suggests that the proteins responsible for mitochondrial fission may not be the primary cause of mitochondrial fragmentation and damage. Furthermore, other research has uncovered that the inhibition of MFN2-mediated mitochondrial fusion caused by DOX is closely associated with elevated mitochondrial fission and cell death [8]. This study observed that DOX resulted in a notable reduction in MFN2 protein expression levels. This indicates a potential promotion of mitochondrial fission by DOX. These findings underscore the crucial role of MFN2 in maintaining mitochondrial dynamic balance. It should be noted that the current study found that doing HIIT per se and before DOX induction increased MFN2 expression and decreased mitochondrial fission. Also, contrary to several studies showing that DOX could decrease the expression of fusion-related proteins (MNF1, MNF2, and OPA1) along with mitochondrial fragmentation [6, 24], another study indicates that DOX could increase the expression of OPA1, leading to an increase in defective and fragmented mitochondria [25]. In line with the previous study, DOX induction increased OPA1 expression in the present study. Consequently, conflicting results are evident concerning mitochondrial fusion-related proteins, especially in the case of OPA1.

It has been demonstrated that damaged and fragmented mitochondria could be eliminated through a selective process known as autophagy [7, 10]. Recent research has indicated that DOX has the potential to enhance autophagy by upregulating the gene expression of autophagy-related proteins (LC3, Beclin1, Pink1, Parkin, and p62) [6]. However, conflicting evidence suggests that DOX could hinder the autophagy process in cardiac cells by activating the JNK [26] and Akt/mTOR signaling pathways, reducing levels of Beclin1 [10], and causing subsequent cardiac damage [21]. Also, this study reveals that DOX could deactivate the autophagy process by decreasing the expression of LC3II and Beclin1.

Examining the evidence from various research on the effects of DOX on the process of autophagy and mitochondrial dynamics reveals conflicting results in this field, likely stemming from two primary reasons. First, the increase in defective and damaged mitochondria caused by DOX could trigger a rapid initial surge in the autophagy process [6] by enhancing the expression of key autophagy-related proteins such as Beclin1, LC3II, Pink1, Parkin, p62, S6K1, Atg5, and Atg12 [6, 27]. Consequently, researchers performing tissue removal shortly after DOX induction often observed an acceleration in the autophagy process. Furthermore, a comprehensive analysis of multiple research studies reveals that despite an initial increase in the autophagy process, the autophagic flux was blocked in the cardiomyocytes by DOX-made lysosomal dysfunction [28] which was linked to a low formation of autophagolysosomes and a reduction in ULK1/AMPK activity, as well as the accumulation of non-degraded autolysosome [27–29]. Consequently, researchers examining tissue samples weeks after DOX induction frequently observed a decline in the autophagy flux.

It was found that the accumulation of damaged and fragmented mitochondria induced by DOX, along with blockage of the autophagic flux [29] could result in a modulatory increasing response in mitochondrial fusion (joining damaged fragmented mitochondria with the healthy ones) by upregulating the expression of OPA1, which in turn increases apoptosis activity and cardiomyocyte death [30]. This phenomenon requires further investigation in future research. Under pathological conditions, when the removal rate of DOX-induced depolarized defective mitochondria through autophagy is lower than the mitochondrial fission rate, the fusion of damaged mitochondria with healthy ones is amplified [30]. It's worth noting that the overexpression of OPA1 not only hampers the autophagy process, leading to cell death [31] but also the reduction of fusion resulting from OPA1 knockout speeds up the removal of dysfunctional mitochondria [32]. Hence, OPA1 in determining whether mitochondria are preserved or lead to cell death plays a critical role [33]. Conversely, knockout of Mfn2 in cardiomyocytes increases dysfunctional mitochondria and pathological cardiac hypertrophy due to impaired mitochondrial autophagy [32]. So, the proper interaction between the mitochondrial dynamic and the autophagy process is essential for preserving mitochondrial balance and, consequently, optimal cardiomyocyte function [33]. In the current study, it has been demonstrated that DOX induction significantly increases the expression of OPA1 and decreases the expression of Mfn2 and the autophagy process. In contrast, HIIT per se and before DOX induction significantly reduces the expression of proteins related to mitochondrial fission (FIS1 and DRP1) and OPA1 and also triggers the autophagy process by increasing the expression levels of LC3II and Beclin1. Therefore, HIIT before DOX induction could effectively inhibit the changes in mitochondrial dynamics and autophagy processes caused by DOX.

Physical activity is one of the most important non-pharmacological preventive strategies to protect against DCT. Research has demonstrated the protective effect of moderate-intensity endurance training (MCT) against DCT [11]. This form of training achieves its effectiveness by up-regulating the AMPK/PGC1α signaling pathway, inhibiting changes in mitochondrial fission and fusion [6], and modulating the lysosomal/autophagy signaling process [21, 34]. For example, in the study by Marques-Aleixo et al. (2018), it was found that DOX induction led to a significant increase in the levels of Beclin1, LC3II, Beclin1/Bcl2 ratio, P62, and PINK1 (indicating an increase the autophagy process), but physical activity before DOX induction could modify these changes and protect the heart against DCT [6]. While strong evidence supports the effect of HIIT on cardiac rehabilitation few studies investigate HIIT's cardioprotective role and its mechanisms against DCT. Recent studies have demonstrated that HIIT before DOX induction could mitigate the adverse side effects of DOX by reducing serum biomarkers of heart damage (LDH and CK-MB levels) [16, 35], increasing antioxidant defense levels (such as Nrf2 and Foxo1 antioxidant genes [18] as well as SOD1, SOD2, and Catalase antioxidant enzymes) in cardiomyocytes [17]. Recent research has indicated that DCT might be partially due to the malfunction of SIRT-1/PGC-1α/Nrf2 genes, which play a crucial role in regulating mitochondrial biogenesis [36]. However, HIIT before DOX administration has been shown to protect the heart against DCT by altering the expression profiles of these genes [36]. In line with previous research, it has been demonstrated that HIIT alone and before DOX administration in rats could elevate the expression level of PGC-1α [37]. Nguyen and colleagues recently demonstrated that HIIT could not only prevent the heart from DOX-induced decrease in cardiovascular capacity but could also increase the exercise capacity, and consequently reducing the negative cardiovascular side-effects of DOX-chemotherapy [37]. Additionally, It has also been observed that following DOX treatment, the expression levels of miR-499 (a negative regulator of AMPK and PGC-1α) [38] increase in cardiomyocytes [39]. Nevertheless, HIIT before DOX induction could reduce DCT by preventing the pathological increase of miR-499 expression[39]. It has also been confirmed that HIIT could reduce DCT by increasing the expression of mitochondrial autophagy genes (Parkin and Mfn2) [18]. It is worth noting that the heart muscle is a tissue with a high demand for metabolic oxidative energy compared to other tissues, so maintaining mitochondrial homeostasis is essential in maintaining the optimal function of heart cells [32]. AMPK and CaMK are compounds that could regulate autophagy and directly activate PGC-1α, the master regulator of mitochondrial biogenesis, to improve energy metabolism and mitochondrial dynamics [40]. Recent studies have shown that DOX-induced mitochondrial damage could reduce ATP reserves due to inhibited PGC-1α, CaMK, and AMPK signaling activity in cardiomyocytes, ultimately disrupting optimal cardiac function [27, 37]. Also, inhibition of PGC-1α activity increases the expression of DRP1 in the myocardium [40]. In the current study, HIIT before DOX induction led to a decrease in DRP1 expression. Previous studies have also indicated the positive impact of HIIT before DOX induction on PGC-1α expression [37]. There is strong evidence the more cellular stress in HIIT, the more pronounced AMPK and CaMKII signaling pathways activation, resulting in greater PGC-1α expression, consequently leading to greater mitochondrial adaptation compared to MCT [41]. In the current study, it is important to note that a significant decrease in OPA1 expression due to HIIT per se could be advantageous in quickly mobilizing the mitochondrial network to areas with high ATP demand [42].

In summary, it could be concluded that antioxidant enzymes and genes, the AMPK/PGC-1α signaling pathway, autophagy, and mitochondrial dynamic processes play crucial roles in the protective effects of HIIT against DCT. To fully investigate these mechanisms further research is necessary. This research, in line with previous articles, has shown that both HIIT alone and before DOX induction could effectively regulate the DOX-induced changes in the mitochondrial dynamics and the autophagy process. Therefore, HIIT could be a suitable non-pharmacological protective strategy to prevent cardiomyocytes from DOX-induced cardiotoxicity by modifying the alterations in mitochondrial quality control processes, such as mitochondrial dynamics and autophagy.

Research results showed that DOX treatment (20 mg/kg body weight of rats, IP) could result in changes in mitochondrial dynamics (fission and fusion) and autophagy process, however, 8 weeks of HIIT before DOX treatment could modulate those. Therefore, HIIT as a suitable non-pharmacological strategy could protect the heart against DOX-induced cardiotoxicity.

Conflict of interest: The authors declare that they have no conflict of interest.

Ethical approval: The current study was approved by the Research Ethics Committee of the Sport Sciences Research Institute (IR.SSRC.REC.2022.155/ Iran).

Human and animal rights: All animal procedures performed were based on the ethical standards of the Ministry of Science, Research, and Technology.

Informed consent: Not applicable

Sources of Funding: This research received no grant from any funding agency in the public, commercial or not-for-profit sectors.

Disclosures: The authors have nothing to disclose.

Bhagat A, Kleinerman ES (2020) Anthracycline-induced cardiotoxicity: causes, mechanisms, and prevention. Current Advances in Osteosarcoma: Clinical Perspectives: Past, Present and Future 1257:181 – 92. https://doi.org/10.1007/978-3-030-43032-0_15
Maneechote C, Chattipakorn SC, Chattipakorn N (2023) Recent Advances in Mitochondrial Fission/Fusion-Targeted Therapy in Doxorubicin-Induced Cardiotoxicity. Pharmaceutics. 15(4):1182. https://doi.org/10.3390/pharmaceutics15041182
Wu BB, Leung KT, Poon EN (2022) Mitochondrial-targeted therapy for doxorubicin-induced cardiotoxicity. Int J Mol Sci 23(3): p. 1912. https://doi.org/10.3390/ijms23031912
Wang L, Qiao Y, Yu J, Wang Q, et al (2024) Endurance exercise preconditioning alleviates ferroptosis induced by doxorubicin-induced cardiotoxicity through mitochondrial superoxide-dependent AMPKα2 activation. Redox Biol 70: p. 103079. https://doi.org/10.1016/j.redox.2024.103079
Montalvo RN, Boeno FP, Dowllah IM, et al (2023) Exercise and doxorubicin modify markers of iron overload and cardiolipin deficiency in cardiac mitochondria. Int J Mol Sci 24(9): p. 7689. https://doi.org/10.3390/ijms24097689
Marques-Aleixo I, Santos-Alves E, Torrella J, et al (2018) Exercise and Doxorubicin Treatment Modulate Cardiac Mitochondrial Quality Control Signaling. Cardiovascular toxicology 2018;18(1):43–55. https://doi.org/10.1007/s12012-017-9412-4
Catanzaro MP, Weiner A, Kaminaris A, et al (2019) Doxorubicin-induced cardiomyocyte death is mediated by unchecked mitochondrial fission and mitophagy. The FASEB Journal 33(10):11096. https://doi.org/10.1096/fj.201802663R
Marechal X, Montaigne D, Marciniak C, et al (2011) Doxorubicin-induced cardiac dysfunction is attenuated by ciclosporin treatment in mice through improvements in mitochondrial bioenergetics. Clinical science. 121(9):405–13. https://doi.org/10.1042/CS20110069
Kang R, Zeh H, Lotze M, Tang D (2011) The Beclin 1 network regulates autophagy and apoptosis. Cell Death Differ 18(4):571–80. https://doi.org/10.1038/cdd.2010.191
Pizarro M, Troncoso R, Martínez GJ, et al (2016) Basal autophagy protects cardiomyocytes from doxorubicin-induced toxicity. Toxicology 370:41 – 8. https://doi.org/10.1016/j.tox.2016.09.011
Gaytan SL, Lawan A, Chang J, et al (2023) The beneficial role of exercise in preventing doxorubicin-induced cardiotoxicity. Front Physiol 14: p. 1133423. https://doi.org/10.3389/fphys.2023.1133423
Pereira TC, Fidale TM, Guimarães LC, et al (2023) Cardioprotective effects of the 4-week aerobic running exercises before treatment with doxorubicin in rats. Cardiovasc Toxicol 23(7): p. 265–277. https://doi.org/10.1007/s12012-023-09798-2
Edwards JJ, Griffiths M, Deenmamode AH, O’Driscoll JM (2023) High-Intensity Interval Training and Cardiometabolic Health in the General Population: A Systematic Review and Meta-Analysis of Randomised Controlled Trials. Sports Med 53(9):1753–1763. https://doi.org/10.1136/bjsports-2015-095841
Yu H, Zhao X, Wu X, et al (2023) High-intensity interval training versus moderate-intensity continuous training on patient quality of life in cardiovascular disease: A systematic review and meta-analysis. Sci Rep 13(1):13915. https://doi.org/10.3389/fcvm.2022.845225
Yang C, Zhang L Cheng Y, et al (2024) High intensity interval training vs. moderate intensity continuous training on aerobic capacity and functional capacity in patients with heart failure: a systematic review and meta-analysis. Front Cardiovasc Med 11, 1302109. https://doi.org/10.3389/fcvm.2024.1302109
Ebrahimi K, Choobineh S, Soori R, Badalzadeh R (2019) Cardioprotective Effect of High-Intensity Aerobic Interval Training against Adriamycin-Induced Cardiac Toxicity in Rats. J Clin Res Paramed Sci 8(1):e83850. https://doi.org/10.5812/jcrps.83850
Jarrett CL, D’Lugos AC, Mahmood TN, et al (2016) Effect of high intensity exercise preconditioning and training on antioxidant enzymes in cardiomyocytes during doxorubicin treatment. The FASEB J 30, lb601-lb601. https://doi.org/10.1096/fasebj.30.1_supplement.lb601
Taghavi Holagh A, Abed Natanzi H, Badalzadeh R, Ghazalian F (2022) Investigate the combination effect of Troxerotin and high-intensity interval training on expression of mitophagy genes Mfn2 and Parkin and Doxorubicin-induced cardiotoxicity in rat cardiac cells. KAUMS Journal (FEYZ) 26(6):676–82. https://doi.org/10.48307/FMSJ.2022.26.6.676
Jiang H-K, Wang Y-H, Sun L, et al (2014) Aerobic interval training attenuates mitochondrial dysfunction in rats post-myocardial infarction: roles of mitochondrial network dynamics. Int J Mol Sci 15(4), 5304–5322. https://doi.org/10.3390/ijms15045304
Høydal MA, Wisløff U, Kemi OJ, Ellingsen Ø (2007) Running speed and maximal oxygen uptake in rats and mice: practical implications for exercise training. Eur J Cardiovasc Prev Rehabil 14(6):753–60. https://doi.org/10.1097/HJR.0b013e3281eacef1
Smuder AJ, Kavazis AN, Min K, Powers SK (2013) Doxorubicin-induced markers of myocardial autophagic signaling in sedentary and exercise trained animals. J Appl Physiol 115: 176–185. https://doi.org/10.1152/japplphysiol.00924.2012
Asadi M, Shanehbandi D, Mohammadpour H, et al (2019) Expression Level of miR-34a in Tumor Tissue from Patients with Esophageal Squamous Cell Carcinoma. J Gastrointest Cancer 50(2):304–307. https://doi.org/10.1007/s12029-018-0060-0
Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Res 29(9):e45-e. https://doi.org/10.1093/nar/29.9.e45
Kavazis A, Smuder A, Powers S (2014) Endurance exercise protects cardiac muscle against doxorubicin-induced damage via mitochondrial adaptations (706.1). The FASEB Journal 28:706.1. https://doi.org/10.1096/fasebj.28.1_supplement.706.1
Li J, Li Y, Jiao J, et al (2014) Mitofusin 1 is negatively regulated by microRNA 140 in cardiomyocyte apoptosis. Mol cell biol 34(10): p. 1788–1799. https://doi.org/10.1128/MCB.00774-13
Lai L, Chen J, Wang N, et al (2017) MiRNA-30e mediated cardioprotection of ACE2 in rats with Doxorubicin-induced heart failure through inhibiting cardiomyocytes autophagy. Life sci 169: p. 69–75. https://doi.org/10.1016/j.lfs.2016.09.006
Kawaguchi T, Takemura G, Kanamori H, et al (2012) Prior starvation mitigates acute doxorubicin cardiotoxicity through restoration of autophagy in affected cardiomyocytes. Cardiovasc Res 96(3): p. 456–465. https://doi.org/10.1093/cvr/cvs282
Bartlett JJ, Trivedi PC, Yeung P, et al (2016) Doxorubicin impairs cardiomyocyte viability by suppressing transcription factor EB expression and disrupting autophagy. Biochem J 473(21): p. 3769–3789. https://doi.org/10.1042/BCJ20160385
Li DL, Wang ZV, Ding G, et al (2016) Doxorubicin blocks cardiomyocyte autophagic flux by inhibiting lysosome acidification. Circulation 133(17): p. 1668–1687. https://doi.org/10.1161/CIRCULATIONAHA.115.017443
Müller-Rischart AK, Pilsl A, Beaudette P, et al (2013) The E3 ligase parkin maintains mitochondrial integrity by increasing linear ubiquitination of NEMO. Mol cell, 2013. 49(5): p. 908–921. https://doi.org/10.1016/j.molcel.2013.01.036
Twig G, Elorza A, Molina AJ, et al (2008) Fission and selective fusion govern mitochondrial segregation and elimination by autophagy. The EMBO J 27(2): p. 433–446. https://doi.org/10.1038/sj.emboj.7601963
Li A, Gao M, Liu B, et al (2022) Mitochondrial autophagy: molecular mechanisms and implications for cardiovascular disease. Cell Death Dis 13(5): p. 444. https://doi.org/10.1038/s41419-022-04906-6
Gharanei M, Hussain A, Janneh O, Maddock H (2013) Attenuation of doxorubicin-induced cardiotoxicity by mdivi-1: a mitochondrial division/mitophagy inhibitor. PloS One 8(10): p. e77713. https://doi.org/10.1371/journal.pone.0077713
Wang F, Chandra J, Kleinerman ES (2021) Chandra, and E.S. Kleinerman, Exercise intervention decreases acute and late doxorubicin-induced cardiotoxicity. Cancer Med 10(21): p. 7572–7584. https://doi.org/10.1002/cam4.4283
Ahmadi Qaracheh R, Fathi M, Rahmati M (2022) Effect of Eight Weeks of High Intensity Interval Training and Crocin Consumption on Serum Markers of Dox-induced Cardiotoxicity in Male Wistar Rats. Compl Med J 12(2): p. 136–147. https://doi.org/10.32598/CMJA.12.2.615.2
Zare P, Moghadaszadeh M, Asadi M, et al (2020) Effect of high-intensity interval training on expression of microRNA-149 and genes regulating mitochondrial biogenesis in doxorubicin-cardiotoxicity in rats. Comparative Clinical Pathology 29: p. 425–431. https://doi.org/10.1007/s00580-019-03077-9
Ebrahimi k, Choobineh S, Badalzadeh R, Soori R (1018) Protective Effect of Aerobic High-Intensity Interval Training Against Doxorubicin-Induced Cardiotoxicity in Rats. J Know Heal 13(1). https://doi.org/10.22100/jkh.v13i3.2040
Liu J, Liang X, Zhou D, et al., Coupling of mitochondrial function and skeletal muscle fiber type by a miR-499/Fnip1/AMPK circuit. EMBO Mol Med 8(10): p. 1212–1228. https://doi.org/10.15252/emmm.201606372
Choobineh S, Ebrahimi K, Soori R, Badalzadeh R (2022) Protective Effect of High-Intensity Interval Training on Doxorubicin-Induced Cardiotoxicity by Reducing MiR-499 Expression in Male Rats. J Sport Biosci (HARAKAT) 14(2): p. 5–16. https://doi.org/10.22059/jsb.2021.263165.1303
Du J, Hang P, Pan Y, et al (2019) Inhibition of miR-23a attenuates doxorubicin-induced mitochondria-dependent cardiomyocyte apoptosis by targeting the PGC-1α/Drp1 pathway. Toxicol Appl Pharmacol 369: p. 73–81. https://doi.org/10.1016/j.taap.2019.02.016
MacInnis, M.J. and M.J. Gibala (2017) Physiological adaptations to interval training and the role of exercise intensity. J Physiol 595(9): p. 2915–2930. https://doi.org/10.1113/JP273196
Ding H, Jiang N, Liu H, et al (2010) Response of mitochondrial fusion and fission protein gene expression to exercise in rat skeletal muscle. Biochim Biophy Acta (BBA)-General Subjects 1800(3): p. 250–256. https://doi.org/10.1016/j.bbagen.2009.08.007

No competing interests reported.

Download PDF

Reviewers agreed at journal
26 Aug, 2024
Reviewers agreed at journal
21 Aug, 2024
Reviewers agreed at journal
19 Aug, 2024
Reviewers invited by journal
19 Aug, 2024
Editor assigned by journal
06 Aug, 2024
Submission checks completed at journal
06 Aug, 2024
First submitted to journal
06 Aug, 2024

You are reading this latest preprint version

High-Intensity Interval Training Protectively Modulates Doxorubicin- Induced Changes in Cardiac Mitochondrial Dynamics and Autophagy Process

Status:

Version 1

Abstract

Purpose

Methods

Results

Conclusion

Figures

Introduction

Materials And Methods

Animals

The HIIT protocol

DOX injection and tissue removal

RNA isolation and cDNA synthesis

Real-time quantitative polymerase chain reaction (qPCR) technique

statistical analysis

Results

Discussion

Conclusion

Declarations

References

Additional Declarations

Status:

Version 1