Effects Of Orally Administered Recombinant Lactobacillus Casei Expressing HN Protein On Early Growth Performance, Intestinal Health And Protection Against NDV Challenge In Chickens

Abstract

Backgroud: Newcastle disease virus (NDV) is considered one of the most important diseases among chickens. In this study, we generated recombinant surface-displayed Lactobacillus casei (L.casei) expressing the hemagglutinin-neuraminidase (HN) of NDV and a live vector pPG alone (named Lc-pPG-HN and Lc-pPG), and evaluated their effects on early growth development, intestinal health and protection against NDV challenge in chickens. 270 chickens were randomly divided into three groups: Lc-pPG-HN, Lc-pPG and physiological saline (control) group, and chickens from each group were respectively immunized with Lc-pPG-HN, Lc-pPG and physiological saline on 1 and 10 days.

Results: Recombinant L.casei expressing the HN protein of NDV (Lc-pPG-HN) was successfully constructed. Orally immunized with Lc-pPG-HN could significantly increase body weight (BW) and immune organs index. Moreover, Lc-pPG-HN improved secretory immunoglobulin A (SIgA) in jejunum, the relative abundance of flora in cecum, histomorphological development of small intestine. In addition, the similar enhancement effects were also observed with hemaggluti-nation inhibition (HI) antibody titer and the expression of cytokines in the serum. The oral administration of Lc-pPG-HN also provided effective protection and alleviated the symptoms of NDV challenge.

Conclusions: Thus, a recombinant L.casei vaccine expressing HN may be a potential therapeutic candidate against NDV and improve chickens growth and development.

Introduction

Newcastle disease (ND) is considered one of the most devastating infectious diseases among domestic birds and considerably threatens commercial poultry production [1]. Current live attenuated ND virus (NDV) vaccines are unsatisfactory, and a viral vector vaccine that infects chickens but does not cause disease is needed [2, 3]. The NDV surface envelope is mainly surrounded by the viral hemagglutinin-neuraminidase (HN) glycoprotein, which plays a critical role in viral infectivity and pathogenicity, they produce virus-neutralizing antibody responses and are protective antigens [4]. One study showed that HN also protected chickens during a virulent NDV challenge, although the chickens showed lower neutralizing antibody titers. Thus, live vector vaccines centering on the NDV HN may protect against heterologous pathogens [5]. However, the individual contributions of the HN protein to the growth performance and intestinal health was not clearly known.

To date, many probiotic bacteria have been screened for their potential as animal feed additives to increase the nutritional value and provide additional health benefits. More recently, probiotics have been developed for human use; however, these products must be rigorously tested to ensure their safety and efficacy [6]. Studies have confirmed that probiotics can increase immunity, maintain intestinal health, and reduce pathogen proliferation, thereby enhancing animal and human health [7]. Thus, oral probiotics have significant health and economic benefits. Oral recombinant vaccines using lactic acid bacteria (LAB) as carriers are being extensively researched. As normal inhabitants of the intestines, LAB readily colonize the intestinal mucosa, making LAB vaccines simple to administer while stimulating a good immune response [8]. Previous studies have developed many Lactobacillus-associated model vaccines, such as L. acidophilus expressing Helicobacter pylori adhesin [9], L.casei producing porcine epidermal growth factor (pEGF) [10] and expressing muramyl dipeptide and tuftsin [11]. Studies have shown that intranasally or orally administering these vaccines can directly reduce antigen levels [12]. However, while genetic manipulation can enhance the immunogenicity of the proteins used in a vaccine, intestinal digestive enzymes rapidly degrade the vaccine components. Thus, a major focus of oral vaccine research is to optimize the environmental stress tolerance of antigen-presenting vectors and enhance antigen expression in the gut. Interestingly, LAB have immunoadjuvant properties and readily express foreign antigens, making them excellent candidates as vaccine vectors. Recent studies of genetically engineered LAB vaccines show that they have great potential for oral vaccine use [13, 14].

Recently, different type of recombinant L.casei have been studied as a novel vaccine in poultry. In particular, some studies showed that NDV HN-expressing L.casei via oral administration increased immune responses and did not impair the growth performances [15]. There is still little knowledge on how the dosage and the type of vectored vaccines may affect the growth performances, and intestine health of chickens. Therefore, the aim of this study was to evaluate the effects of recombinant L.casei inclusion on growth performance, intestinal health and immune system of chickens. The results suggested that the oral L.casei vaccine may provide a promising strategy for controlling viral infections in poultry.

Materials And Methods

Animal ethics statement

270 healthy chickens (Hy-line Variety White) were obtained from a local chickens factory (Runcheng Chickens Breeding Factory, Changchun, China). We followed all animal care protocols regarding the use of live chickens in our experiments, and all chickens had access to food, water, and necessary veterinary care add libitum.

Bacterial strains, plasmids and growth conditions

Lactobacillus casei ATCC 393 was isolated from cheese, a plasmid-free strain grown in De Man, Rogosa and Sharpe grown in De Man, Rogosa and Sharpe (MRS) medium (Oxoid, UK) at 30 ^◦C, without shaking. The Escherichia coli-Lactobacillus shuttle vector pPG, a type of cell-surface expression plasmid containing an anchoring matrix-encoding pgsA gene derived from Bacillus subtilis behind the target gene. The pPG has the ssUSP secretion signal before the target gene to ensure the target protein secretion. Escherichia coli (E.coli) competent cells MC1061 was grown in Luria-Bertani (LB) medium at 37 ^◦C with shaking for the cloning of plasmid. Chloramphenicol (Cm) (Sigma, USA) was utilized at final concentration of 10 μg/mL. Newcastle disease virus isolated from the allantoic fluid.

Generation of recombinantL. caseiexpressing HN gene

The HN gene (1617 bp) of NDV strain (GenBank: ABG56153.1) was amplified by PCR using the following primers with Nco I or EcoR V site underlined (forward primer: 5' CCCATGGATGGACCGCGC GGTTAACAGAGTC 3', Reverse primer: 5' AAGATATCTTAAACTCTATCATCCTTGAGGATC 3'); The PCR product of HN gene was cleaved with Nco I/EcoR V restriction endonuclease and inserted into the corresponding sites of pPG to give rise to pPG-HN. Finally, the recombinant pPG-HN and pPG plasmids were transformed into L.casei ATCC 393 by electroporation as previously described [16].

Western blot analysis

The expression of recombinant HN gene in L.casei was detected by Western blot analysis as described previously [17]. Briefly, Lc-pPG-HN and Lc-pPG were grown in basal MRS (MRS Broth) medium supplemented with 10 μg/mL of chloramphenicol Xylose was added to the culture medium to a final concentration of 10 g/L to induce antigen expression. After induction at 30 ^◦C for 10 h, approximately 1×10⁸ cells pellets or supernate (a 10-fold concentration) were examined by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to nitrocellulose membrane. The membrane was blocked with 5% skim milk, and then incubated with Rabbit anti-HN serum at dilution of 1:500 with phosphate buffered saline (Bioss, Beijing, China), overnight at 4 ^◦C. Affinity-purified horseradish peroxidase (HRP)-conjugated goat anti-Rabbit immunoglobulin G (IgG) (Bioss, Beijing, China) was used as second antibody. Finally, the blot was visualized by chemiluminescence detection with Western ECL substrate (Termo Scientific) in an Amersham Imager 600 (GE Healthcare, UK).

Immunofluorescence assay

Immunofluorescence was performed to determine the surface-displayed localization of the HN protein from Lc-pPG-HN as previously described [17]. In brief, 1x10⁵ cells of Lc-pPG-HN were resuspended in 50 μL PBS containing 1% bovine serum albumin (BSA) and rabbit anti-HN antiserum (1:1000 dilution) at 37 ^◦C for 1 h Subsequently, cells were incubated with fluorescein isothiocyanate (FITC)-conjugated goat anti-rabbit IgG (Bioss, Beijing, China) containing 1% Evans blue at 37 ^◦C for 2 h. The cells were visualized using a fluorescence microscopy (Zeiss LSM710). The Lc-pPG was used as negative control.

Vaccine preparation,animal treatment and sample collection

For oral administration, overnight cultures of recombinant L. casei grown in De Man, Rogosa and Sharpe medium supplemented with chloramphenicol and xylose were thoroughly mixed with commercial basal diet feed, then oven-dried at 37 ^°C for 8 h. Recombinant L.casei counts were expressed as 1×10⁹ CFU/mL and 2×10⁹ CFU/mL of sample. Three groups of with 3 replicates tray levels of 30 chickens each orally immunized with Lc-pPG-HN, Lc-pPG or the 0.9% physiological saline feed. Oral vaccinations were conducted on days 1 (1×10⁹ CFU/g, 1 mL per chick) and 10 (2×10⁹ CFU/g, 1 mL per chick), following the immune protocol administered on 3 consecutive days (Fig. 1). All samples were chosen, and the organs weight and body weight (BW) were measured on 1, 7, 14 and 21 days-old. Hematoxylin and eosin (H&E) staining was used to observe the changes in intestinal morphological structure (duodenum, jejunum and ileum) and organ pathologies (spleen, bursa of Fabricius, thymus, lung and liver). Serum was stored at −80 ^°C until further analysis. Pieces of the cecum and jejunum were rapidly excised, frozen in liquid nitrogen, and stored at −80 ^°C until DNA extraction.

Immune organ measurement

The bursa of Fabricius, thymus and spleen were the immune organs studied. The chickens were weighed, and the immune organs were excised and weighed on 1, 7, 14, and 21 days-old. The data are presented as the relative weight (index) of the given immune organ weight from the total BW. The indices were calculated as immune organ weight/BW × 100%.

Histomorphological investigations

The collected segments of intestine were the loop of duodenum, the tract before Meckel’s diverticulum (jejunum) and the tract before the ileocolic junction (ileum). Gut segments were fixed in 10% buffered formalin solution for morphometric analysis. Tissues were routinely embedded in paraffin wax blocks, sectioned at 5 µm thickness, mounted on glass slides and stained with HE. The villus height (VH) was measured from the top of the villus to the crypt mouth; the invagination depth between adjacent crypt mouths was measured and defined as the crypt depth (CD), and the VH/CD ratio was calculated. Morphometric analyses were performed on 5 well-oriented and intact villi and 5 crypts chosen from duodenum, jejunum and ileum [18, 19]. Histopathological lesions were assessed descriptively according to the presence of degeneration, hemorrhaging, congestion, and edema. Organs were graded based on the focal lesion distribution (low severity) and multifocal lesion distribution (moderate severity). Observation was conducted using 200× magnification and 3 view-field repetitions.

Hemagglutination inhibition (HI) and enzyme-linked immunosorbent assay (ELISA)

Blood samples from the immunized chickens were clotted at 37 ^°C and centrifuged at 3000 rpm for 10 min to collect the serum. Two-fold serial dilutions of the serum were prepared in 96-well plates. Next, equal volumes (25 µL) of 4 hemagglutination units (4 HAU) of NDV antigen were added to all rows except the last row. Thirty minutes later, 25 µL of 1% chickens erythrocytes were added and incubated for 30 min. The agglutination was monitored, and the HI titers were determined as the highest serum dilution that completely inhibited NDV agglutination [20]. The jejunum were infused with 0.5 mL phosphate-buffered saline (PBS); pH 7.4, containing 0.1% bovine serum albumin and aprotinin), washed three times, and centrifuged at 2000 rpm at 4 ^°C for 15 min to collect the supernatant. Commercial ELISA kits for determining secretory immunoglobulin A (SIgA) from jejunal lavage fluid, serum interleukin (IL-2) and interferon (IFN-γ) from chickens (Senbeijia, Nanjing, China) were used to determine the NDV antibody levels and cytokine production [21].

DNA isolation and bacterial quantification with qPCR

The cecum were removed, and 20–30 mg aliquots were weighed. Total cecum DNA was extracted according to the instructions with the DNA ΔSimple Total DNA kit-DP431 (Tiangen, Beijing, China). A 10 μL total reaction volume in a 96-well plate contained 5 μL Maxima SYBR Green qPCR Master Mix (Thermo Scientific/Fermentas, Vilnius, Lithuania), 0.2 μM of each primer specific to the 16S rDNA of Bifidobacterium spp. [22], Lactobacillus spp. [23], E.coli [24] or universal bacteria [25], and 2 ng of bacterial DNA template. Table 1 lists the forward and reverse primer sequences. DNA was amplified and detected using the SYBR® Premix Ex Taq^TM II real-time RT-PCR (qRT-PCR) kit (Bao Bioengineering Co., Ltd., DaLian, China) with the Applied Biosystems 7500 FAST Real-Time PCR System. During the PCR reaction, samples were subjected to an initial denaturation phase at 95 ^°C for 5 min followed by 40 cycles of denaturation at 95 ^°C for 15 sec and annealing and extension at 58 ^°C for 30 sec. Average Ct values of the four technical replicates obtained from the LightCycler 480 II System software were used for data analysis. PCR efficiency for each primer pair was calculated in the LightCycler 480 II software based on the separate reaction of 5 dilutions (1x, 0.5x, 0.25x, 0.125x and 0.0625x) of pooled bacterial DNA template. The relative abundances of the bacteria in the chyme were calculated as follows: Relative Abundances [%] = (Efficiency universal)^{Ct universal} / (Efficiency target)^{Ct target}.

Viral challenge

After two oral vaccinations, the chickens in the Lc-pPG-HN and control groups were orally challenged with a 2×10⁹ mean chickens infection dose (EID₅₀) of the NDV strain in 0.2 mL viral suspensions per chickens at 21-day-old. The chickens were monitored daily for 10 days after the challenge, and the numbers of dead chickens were recorded.

Statistical analysis

Statistical analysis was performed using SPSS 22.0 software and GraphPad PRISM 7.0. For multiple comparisons one-way ANOVA were preformed, followed by Tukey's test. Data are presented as the mean ± SEM. Differences were considered statistically significant at P > 0.05, P < 0.05, P < 0.01.

Result

Construction of L.casei vaccine and expression of HN protein

Extract the total RNA of NDV, and amplify the NDV HN gene by RT-PCR according to primers, the gene fragment is 1617 bp (Fig. 1a). The recombinant plasmids pPG-HN was constructed and transferred into L.casei by electroporation. The recombinant plasmids were confirmed by restriction enzyme digestion and sequence analysis (Fig. 1b). To examine whether the properties of the recombinant L.casei changed, growth and hereditary stability were analyzed after the recombinant L.casei were screened by PCR and DNA sequencing. PCR and sequencing analysis (Fig. 1c) showed that recombinant plasmids were stably inherited over 50 generations.

Expression of HN and immunofluorescence assays

To investigate whether the recombinant L.casei is capable of producing HN, cell pellets of Lc-pPG-HN, and Lc-pPG were confirmed by Western blot analyses. The results showed that there was immunoreactive band to 63 kDa were detected in the cell lysates of Lc-pPG-HN (Fig. 2a, lane 2), whereas no band was observed in the Lc-pPG (Fig. 2a, lane 1). These observations suggested that the HN protein is produced and secreted by recombinant L.casei. Clear fluorescence signals were observed in Lc-pPG-HN (Fig. 2b, left), making the morphology of L.casei faintly visible. There was no signal in cells containing the empty vector (Fig. 2b, right). Bacteria could be seen clearly under oil immersion. This finding suggested that Lc-pPG-HN cells could react with the polyclonal Rabbit anti-HN antibody.

Effects of oral immunization with recombinantL.caseion chickens immune organ index

Oral immunization with Lc-pPG-HN group had significant effect on BW and immune organ index of chickens compared with control and Lc-pPG groups (P < 0.05). However, on 14-21 days, the BW in Lc-pPG-HN group was significantly heavier than those in the other two groups (P < 0.01, Table 2).

The index of spleen, thymus and the index of fabricius of groups Lc-pPG and Lc-pPG-HN were increased by 5%, 18% (P < 0.05), increased by 7.9%, 10% (P < 0.05), and 1.3%, 4% (P < 0.05) on 21-day-old, respectively (Table 2).

Intestinal histomorphological analyses

The VH, CD and the ratio of VH/CD of duodenum, jejunum and ileum are shown in Table 3. However, the VH and ratio of VH to CD of chickens in the Lc-pPG and Lc-pPG-HN groups during the 14-21 days periods were significantly increased when compared with the control group (P < 0.05). Moreover, when compared with the control group, the CD of chickens in the Lc-pPG group during the 14-21 days periods was also significantly decreased (P < 0.05).

SIgA expression levels in the jejunal lavage fluid

Jejunal lavage fluid SIgA was measured to evaluate the systemic immune response. SIgA production was dramatically increased in the jejunal lavage fluid of the chickens immunized with Lc-pPG-HN compared with that of the Lc-pPG and control groups on 14 (P < 0.05) and 21-days-old (P < 0.01) (Fig. 3).

Effects of the intestinal flora

The effects of recombinant L.casei on the relative abundance of immune related Lactobacillus spp., E.coli and Bifidobacterium spp. were examined by qRT-PCR analysis (Fig. 4a, b or c). In Lc-pPG-HN group, significant changes in Lactobacillus spp. relative abundance observed after booster immunization ( P < 0.05) (Fig. 4a). The relative abundance of E.coli rapid decreased was detected at 7-day-old compared with the control and Lc-pPG groups, and Bifidobacterium spp. reached a fourfold upregulation in caecum at 21-day-old (Fig. 4b or c). Of note, almost no differences in relative abundance were observed between treatments and control groups after prime immunization (P > 0.05).

Serum IL-2 and IFN-γ expression levels

The effects of the recombinant L.casei on IL-2 levels of serum were shown in Fig. 5a. Chickens that oral administration of Lc-pPG-HN and Lc-pPG resulted in higher IL-2 activity as compared to the controls (P < 0.01) after booster immunization at 14-day-old. Likewise, the higher serum IFN-γ level (Fig. 5b) was observed in chickens received Lc-pPG-HN at 21-day-old compared to the controls (P < 0.05).

NDV-HN antibody titers by HI

The level of HI anti-HN in the serum of immunized chicken was determined. As the results showing (Fig. 6), significant level of HI was elicited in chickens that received Lc-pPG-HN (P < 0.05) as compared to the controls. After booster immunization, the higher antibodies titers in the serum was observed in chickens by oral administration of Lc-pPG-HN compared to the control and Lc-pPG (P < 0.05). By contrast, no significant elicitation of antibodies was detected in the control groups. No significant difference (P > 0.05) was observed between treatments and controls prior to the prime immunization.

Viral challenge

The NDV strain challenge experiment was performed to evaluate the protective immunity of the recombinant L.casei. Of the chickens immunized with Lc-pPG-HN, 80 % survived after being challenged with a low dose of NDV, whereas the control group exhibited the lower survival rate (Table 4).

Pathological organ changes

Clinical signs appeared in infected chickens and were first observed 2 days postchallenge, consisting of green-white soft feces, anorexia, diarrhea, crouch, paralysis, and eyelid edema. Histopathological changes in the visceral organs following the virulent viral challenge were studied separately for NDV.

In the control group, the immune organs showed moderately severe lymphoid depletion in the medulla, and the thinned cortical lymphocytes were loosely arranged, appearing as a few bleeding spots in the medullary lymph (Fig. 7A–F). The control group also presented lymphopenia in the smooth muscle wall of the tertiary bronchi and stenosis in the pulmonary atrium. The pulmonary capillary blood vessels had a few divided red blood cells, a messy cloth-like structure, and a lower cell density with low severity (Fig. 7H). The control group also presented central vein dilation in the liver and liver sinusoid expansion (Fig. 7J). The lung and liver in the Lc-pPG-HN group showed no obvious lesions (Fig. 7G and I). Pathological lesions and histopathological changes were reduced in the vaccinated chickens following the virulent NDV challenge.

Discussion

Newcastle disease (ND) is an economically important disease of poultry industry, and naturally occurring avirulent NDV strains are widely used as live attenuated vaccines all over the world [26]. Several previous studies have suggested that there is a need to develop live-virus-vectored vaccines that do not involve attenuated NDV strains [27]. In poultry, the small intestine is one of the main mucosal surfaces and immune barriers [28]. As a mucosal vaccine vector, L.casei was used very proficiently whereas excellent result was also found when it was used as a carrier in DNA vaccine through oral route [29, 30]. In this study, we engineered and evaluated the recombinant L. casei expressing HN protein of NDV to induce an individual development and immunity response in chicken.

In our study, the HN antigen was stably expressed on L.casei. HN detection in both the supernatant fluid and cell pellets indicated that the expression system also enabled the L.casei to surface display the HN antigen. In analyzing the properties of the recombinant L.casei, although overproduction of heterologous proteins often hampers bacterial growth, the HN-expressing strains grew well and were genetically stable. Our results are consistent with those of a previous report that L. plantarum expressing the Hirep2 (H2) antigen of Chlamydia trachomatis had only limited effects on bacterial fitness [31]. These data enable hypothesizing that HN immunogenicity based on the L.casei-expression system can be further investigated via oral administration in a chick model.

Immune organ index and intestinal histomorphology had been widely used for assessing growth performance and intestinal development. For instance, both Ding et al.[32] and Bu [33] found similar increasing growth performance and organs index when feeding chickens with L.casei or Lactobacillus vaccine. Also, Sumarsih et al [34]. Previous studies also indicated that increased VH and VH/CD are directly correlated with increased epithelial turnover, and longer villi are linked with activation of cell mitosis, with shortening of villi and deeper crypts leading to poor nutrient absorption, increased secretion in the gastrointestinal tract and reduced performance [35, 36]. In our study, chickens oral immunization Lc-pPG-HN consistently increased the VH of jejunum, duodenum and ileum, and the VH/CD significantly increased, which indicated the better digestive and absorption capability [37].

We conducted a oral route of vaccination to evaluate the immunogenicity of our developed vaccine candidate. SIgA is the principal antibody type for host mucosal defense system [38]. The detection of specific IgA from jejunum indicated that recombinant strain Lc-pPG-HN triggered strong mucosal immune response.

Relevant studies have shown that intestinal microbiota of animals plays an important role in the life activities of the host [39]. L.casei also determined a modification of the gut microbiota composition in chickens. Furthermore, the results show that Lc-pPG-HN can significantly increase intestinal the number of Lactobacillus and Bifidobacteria and reduce the number of Escherichia coli bacteria. Probiotics, such as Lactobacillus spp., Bifidobacterium spp. are living microorganisms that confer health benefits on the host [40]. Accordingly, recombinant lactic acid bacteria vaccine promising candidates to study intestinal microbiota/immune system modulation in chickens.

For the detection of cellular response, IL-2 and IFN-γ were selected which are produced by Th1 cells and play a critical role triggering in cell-mediated immune response for the clearance of intracellular pathogens. Oral administration group induced significant (P < 0.05) rise of IFN-γ and IL-2 from 14-day-old in comparing control and Lc-pPG groups. Although the level of IFN-γ and IL-2 induction is not so high but consistent with other observation [41]. From the cytokine study, it is also observed that serum from Lc-pPG group also produced a considerable amount of IL-12 and IFN-γ comparing control PBS group (Fig. 5) which may be due to the ability of Lactobacillus casei to induce IL-2 and IFN-γ by itself [42].

The results of the HI assay revealed that the Lc-pPG-HN significantly elicited higher antibody titers than the groups received Lc-pPG or saline at 21 day-old (P < 0.05). However, no significant changes were evident for any treatment when compared to the vaccinated Lc-pPG or control group at any time point (P > 0.05). Interestingly, The survival study revealed that the Lc-pPG-HN could provide strong protection (80%) for chickens against NDV challenge. However, the lesions observed in NDV-infected chickens were severe and manifested multifocal lesions in the immune organs. The most numerous and consistent gross lesions in these organs involved severe lymphoid depletion and necrosis. H&E staining showed obvious lymphocyte degeneration and necrosis in the immune organs, lung and liver 2 days post challenge. Another study showed that the clinical signs and pathological changes in experimentally infected geese were similar to those of ND induced by viscerotropic velogenic NDV strains in chickens [43]. In addition, anti-HN antibody induced by Lc-pPG-HN demonstrated significant increase and provided protection for vaccinated chicken, immunogenic of Lc-pPG-HN requires to be further identified.

Conclusion

In conclusion, we demonstrated five major points in this paper: (1) We generated a recombinant L.casei (surface-displayed) expressing the HN of NDV, and the recombinant plasmid in L.casei could be stably inherited over 50 generations; (2) Oral vaccination chickens with the recombinant vaccine candidate induced a higher immune organ index and intestinal development; (3) The recombinant vaccine candidate also stimulated jejunum mucus specific SIgA and serum HI antibody titers, and induced a higher IL-2, IFN-γ levels, eliciting inflammatory response and cell immune response; (4) Relative abundance of Bifidobacterium spp, Lactobacillus spp, E. coli in the oral immunization group with engineered L.casei was beneficially modulated in chickens cecum, improving intestine health; (5) Our study clearly demonstrates that the engineered L.casei developed in this study provide protection for chickens against infection with NDV. These results suggest that the potential of oral administration as a mucosal vaccine may be an attractive candidate for treating NDV response and improving early growth performance and intestinal health.

Abbreviations

Newcastle disease virus (NDV), Lactobacillus casei (L.casei), hemagglutinin-neuraminidase (HN), body weight (BW), secretory immunoglobulin A (SIgA), hemaggluti-nation inhibition (HI), lactic acid bacteria (LAB), porcine epidermal growth factor (pEGF), De Man, Rogosa and Sharpe (MRS), Escherichia coli (E.coli), Luria-Bertani (LB), Chloramphenicol (Cm), sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE), immunoglobulin G (IgG), fluorescein isothiocyanate (FITC), Hematoxylin and eosin (H&E), villus height (VH), crypt depth (CD), hemagglutination units (HAU), phosphate-buffered saline (PBS), serum interleukin (IL-2) and interferon (IFN-γ)

Declarations

Ethics approval and consent to participate

This study was conducted following the Jilin Agriculture University Institutional Animal Care and Use Committee (JLAU08201409), and the experimental procedures were performed in compliance with the National Institutes of Health guide for the care and use of Laboratory animals (NIH Publications No. 8023).

Consent for publication

Not applicable.

Availability of data and material

All data generated or analyzed during this study are available from the corresponding author on reasonable request.

Competing interests

The authors declare that they have no competing interests.

Funding

This work was financially supported by the 13th Five-year Science and Technology Plan Item of Jilin Provincial Education Department (Grant No. JJKH20200355KJ, JJKH20201293JY) and the National Natural Science Foundation of China (Grant No. 31372391).

Authors' contributions

Anqi Ju, Aoyi Duan, Shubao Yang and Yinnan Zhang contributed significantly to analysis and manuscript preparation;

Xin Ma and Weimin Luan performed the data analyses and wrote the manuscript;

Yanjun Qin and Ligang Xue helped perform the analysis with constructive discussions.

Acknowledgements

The authors thank the Animal Development and Immune Regulation Lab of Jilin Agricultural University for technical support.

References

1. La Rocca P, Rota P, Piccoli M, et al. 2β-3,4-Unsaturated sialic acid derivatives: Synthesis optimization, and biological evaluation as Newcastle disease virus hemagglutinin-neuraminidase inhibitors. Bioorg Med Chem. 2020;28(14):115563. doi:10.1016/j.bmc.2020.115563
2. Motamedi MJ, Ebrahimi MM, Shahsavandi S, et al. The Immunogenicity of a Novel Chimeric Hemagglutinin-Neuraminidase-Fusion Antigen from Newcastle Disease Virus by Oral Delivery of Transgenic Canola Seeds to Chickens. Mol Biotechnol. 2020;62(6-7):344-354. doi:10.1007/s12033-020-00254-y
3. Dimitrov KM, Afonso CL, Yu Q, Miller PJ. Newcastle disease vaccines-A solved problem or a continuous challenge?Vet Microbiol. 2017;206:126-136. doi:10.1016/j.vetmic.2016.12.019
4. Huang Z, Panda A, Elankumaran S, Govindarajan D, Rockemann DD, Samal SK. The hemagglutinin-neuraminidase protein of Newcastle disease virus determines tropism and virulence.J Virol. 2004;78(8):4176-4184. doi:10.1128/jvi.78.8.4176-4184.2004
5. Jiang Y, Hu J, Guo Y, et al. Construction and immunological evaluation of recombinant Lactobacillus plantarum expressing HN of Newcastle disease virus and DC- targeting peptide fusion protein.J Biotechnol. 2015;216:82-89. doi:10.1016/j.jbiotec.2015.09.033
6. Pace F, Pace M, Quartarone G. Probiotics in digestive diseases: focus on Lactobacillus GG. Minerva Gastroenterol Dietol. 2015;61(4):273-292.
7. Azad MAK, Sarker M, Li T, Yin J. Probiotic Species in the Modulation of Gut Microbiota: An Overview. Biomed Res Int. 2018;2018:9478630. Published 2018 May 8. doi:10.1155/2018/9478630
8. Zhou H, Li X, Wang Z, et al. Construction and characterization of thymidine auxotrophic (ΔthyA) recombinant Lactobacillus casei expressing bovine lactoferricin. BMC Vet Res. 2018;14(1):206. Published 2018 Jun 27. doi:10.1186/s12917-018-1516-y
9. Xu S, Wang D, Zhang P, et al. Oral administration of Lactococcus lactis-expressed recombinant porcine epidermal growth factor stimulates the development and promotes the health of small intestines in early-weaned piglets.J Appl Microbiol. 2015;119(1):225-235. doi:10.1111/jam.12833
10. Jiang X, Yu M, Qiao X, et al. Up-regulation of MDP and tuftsin gene expression in Th1 and Th17 cells as an adjuvant for an oral Lactobacillus casei vaccine against anti-transmissible gastroenteritis virus.Appl Microbiol Biotechnol. 2014;98(19):8301-8312. doi:10.1007/s00253-014-5893-2
11. Zhai L, Li Y, Wang W, Hu S. Enhancement of humoral immune responses to inactivated Newcastle disease and avian influenza vaccines by oral administration of ginseng stem-and-leaf saponins in chickens. Poult Sci. 2011;90(9):1955-1959. doi:10.3382/ps.2011-01433
12. Laudadio V, Passantino L, Perillo A, et al. Productive performance and histological features of intestinal mucosa of broiler chickens fed different dietary protein levels. Poult Sci. 2012;91(1):265-270. doi:10.3382/ps.2011-01675
13. Hongying F, Xianbo W, Fang Y, Yang B, Beiguo L. Oral immunization with recombinant Lactobacillus acidophilus expressing the adhesin Hp0410 of Helicobacter pylori induces mucosal and systemic immune responses.Clin Vaccine Immunol. 2014;21(2):126-132. doi:10.1128/CVI.00434-13
14. Cano-Garrido O, Seras-Franzoso J, Garcia-Fruitós E. Lactic acid bacteria: reviewing the potential of a promising delivery live vector for biomedical purposes.Microb Cell Fact. 2015;14:137. Published 2015 Sep 16. doi:10.1186/s12934-015-0313-6
15. Kumar S, Nayak B, Collins PL, Samal SK. Retraction for Kumar et al., "Evaluation of the Newcastle Disease Virus F and HN Proteins in Protective Immunity by Using a Recombinant Avian Paramyxovirus Type 3 Vector in Chickens" [retraction of: J Virol. 2011 Jul;85(13):6521-34]. J Virol. 2020;94(6):e01867-19. Published 2020 Feb 28. doi:10.1128/JVI.01867-19
16. Hou XL, Yu LY, Liu J, Wang GH. Surface-displayed porcine epidemic diarrhea viral (PEDV) antigens on lactic acid bacteria. 2007;26(1):24-31. doi:10.1016/j.vaccine.2007.10.065
17. Xu YG, Guan XT, Liu ZM, Tian CY, Cui LC. Immunogenicity in Swine of Orally Administered Recombinant Lactobacillus plantarum Expressing Classical Swine Fever Virus E2 Protein in Conjunction with Thymosin α-1 as an Adjuvant. Appl Environ Microbiol. 2015;81(11):3745-3752. doi:10.1128/AEM.00127-15
18. Laudadio V, Passantino L, Perillo A, et al. Productive performance and histological features of intestinal mucosa of broiler chickens fed different dietary protein levels.Poult Sci. 2012;91(1):265-270. doi:10.3382/ps.2011-01675
19. Qaisrani SN, Moquet PC, van Krimpen MM, Kwakkel RP, Verstegen MW, Hendriks WH. Protein source and dietary structure influence growth performance, gut morphology, and hindgut fermentation characteristics in broilers. Poult Sci. 2014;93(12):3053-3064. doi:10.3382/ps.2014-04091
20. Li Y, Wang S, Xin W, et al. A sopB deletion mutation enhances the immunogenicity and protective efficacy of a heterologous antigen delivered by live attenuated Salmonella enterica vaccines.Infect Immun. 2008;76(11):5238-5246. doi:10.1128/IAI.00720-08
21. Yadav SK, Meena JK, Sharma M, Dixit A. Recombinant outer membrane protein C of Aeromonas hydrophila elicits mixed immune response and generates agglutinating antibodies.Immunol Res. 2016;64(4):1087-1099. doi:10.1007/s12026-016-8807-9
22. Penders J, Vink C, Driessen C, London N, Thijs C, Stobberingh EE. Quantification of Bifidobacterium spp., Escherichia coli and Clostridium difficile in faecal samples of breast-fed and formula-fed infants by real-time PCR. FEMS Microbiol Lett. 2005;243(1):141-147. doi:10.1016/j.femsle.2004.11.052
23. Heilig HG, Zoetendal EG, Vaughan EE, Marteau P, Akkermans AD, de Vos WM. Molecular diversity of Lactobacillus spp. and other lactic acid bacteria in the human intestine as determined by specific amplification of 16S ribosomal DNA.Appl Environ Microbiol. 2002;68(1):114-123. doi:10.1128/aem.68.1.114-123.2002
24. Walter J, Tannock GW, Tilsala-Timisjarvi A, et al. Detection and identification of gastrointestinal Lactobacillus species by using denaturing gradient gel electrophoresis and species-specific PCR primers.Appl Environ Microbiol. 2000;66(1):297-303. doi:10.1128/aem.66.1.297-303.2000
25. Pham VH, Kan L, Huang J, et al. Dietary encapsulated essential oils and organic acids mixture improves gut health in broiler chickens challenged with necrotic enteritis.J Anim Sci Biotechnol. 2020;11:18. Published 2020 Feb 21. doi:10.1186/s40104-019-0421-y
26. Kim SH, Wanasen N, Paldurai A, Xiao S, Collins PL, Samal SK. Newcastle disease virus fusion protein is the major contributor to protective immunity of genotype-matched vaccine.PLoS One. 2013;8(8):e74022. Published 2013 Aug 28. doi:10.1371/journal.pone.0074022
27. Zhao W, Spatz S, Zhang Z, et al. Newcastle disease virus (NDV) recombinants expressing infectious laryngotracheitis virus (ILTV) glycoproteins gB and gD protect chickens against ILTV and NDV challenges.J Virol. 2014;88(15):8397-8406. doi:10.1128/JVI.01321-14
28. Tannock GW, Tilsala-Timisjarvi A, Rodtong S, Ng J, Munro K, Alatossava T. Identification of Lactobacillus isolates from the gastrointestinal tract, silage, and yoghurt by 16S-23S rRNA gene intergenic spacer region sequence comparisons.Appl Environ Microbiol. 1999;65(9):4264-4267.
29. Wyszyńska A, Kobierecka P, Bardowski J, Jagusztyn-Krynicka EK. Lactic acid bacteria--20 years exploring their potential as live vectors for mucosal vaccination [published correction appears in Appl Microbiol Biotechnol. 2015 May;99(10):4531]. Appl Microbiol Biotechnol. 2015;99(7):2967-2977. doi:10.1007/s00253-015-6498-0
30. Hou XL, Yu LY, Liu J, Wang GH. Surface-displayed porcine epidemic diarrhea viral (PEDV) antigens on lactic acid bacteria. Vaccine. 2007;26(1):24-31. doi:10.1016/j.vaccine.2007.10.065
31. Suebwongsa N, Lulitanond V, Mayo B, Yotpanya P, Panya M. Development of an Escherichia coli-Lactobacillus casei shuttle vector for heterologous protein expression in Lactobacillus casei. 2016;5:169. Published 2016 Feb 24. doi:10.1186/s40064-016-1760-1
32. Ding L, Chen P, Bao X, et al. Recombinant duck enteritis viruses expressing the Newcastle disease virus (NDV) F gene protects chickens from lethal NDV challenge.Vet Microbiol. 2019;232:146-150. doi:10.1016/j.vetmic.2019.04.022
33. Bu Y W , Yang H M , Jin J H , et al. Recombinant Newcastle disease virus (NDV) La Sota expressing the haemagglutinin–neuraminidase protein of genotype VII NDV shows improved protection efficacy against NDV challenge[J]. Avian Pathology, 2018, 48(225):1-28.
34. Sumarsih S , Sulistiyanto B , Setya A C . The Effect of Different Methods of Giving Probiotic Lactobacillus salivarius I-11 on Broilers Performance in Starter Period. doi.org/10.29037/digitalpress.22334
35. Cheung QC, Yuan Z, Dyce PW, Wu D, DeLange K, Li J. Generation of epidermal growth factor-expressing Lactococcus lactis and its enhancement on intestinal development and growth of early-weaned mice.Am J Clin Nutr. 2009;89(3):871-879. doi:10.3945/ajcn.2008.27073
36. Laudadio V, Passantino L, Perillo A, et al. Productive performance and histological features of intestinal mucosa of broiler chickens fed different dietary protein levels.Poult Sci. 2012;91(1):265-270. doi:10.3382/ps.2011-01675
37. Nyachoti CM, Omogbenigun FO, Rademacher M, Blank G. Performance responses and indicators of gastrointestinal health in early-weaned pigs fed low-protein amino acid-supplemented diets.J Anim Sci. 2006;84(1):125-134. doi:10.2527/2006.841125x
38. Pan L, Zhao PF, Ma XK, et al. Probiotic supplementation protects weaned pigs against enterotoxigenic Escherichia coli K88 challenge and improves performance similar to antibiotics.J Anim Sci. 2017;95(6):2627-2639. doi:10.2527/jas.2016.1243
39. Liu JK, Hou XL, Wei CH, et al. Induction of immune responses in mice after oral immunization with recombinant Lactobacillus casei strains expressing enterotoxigenic Escherichia coli F41 fimbrial protein. Appl Environ Microbiol. 2009;75(13):4491-4497. doi:10.1128/AEM.02672-08
40. Allen HK, Donato J, Wang HH, Cloud-Hansen KA, Davies J, Handelsman J. Call of the wild: antibiotic resistance genes in natural environments.Nat Rev Microbiol. 2010;8(4):251-259. doi:10.1038/nrmicro2312
41. Boyanova L, Mitov I. Coadministration of probiotics with antibiotics: why, when and for how long?Expert Rev Anti Infect Ther. 2012;10(4):407-409. doi:10.1586/eri.12.24
42. Kong X, Hu Y, Rui R, Wang D, Li X. Effects of Chinese herbal medicinal ingredients on peripheral lymphocyte proliferation and serum antibody titer after vaccination in chicken.Int Immunopharmacol. 2004;4(7):975-982. doi:10.1016/j.intimp.2004.03.008
43. Rue CA, Susta L, Cornax I, et al. Virulent Newcastle disease virus elicits a strong innate immune response in chickens. J Gen Virol. 2011;92(Pt 4):931-939. doi:10.1099/vir.0.025486-0

Tables

villus height (VH) to crypt depth (CD) ratio (VH/CD). ^a,b,cMeans in the same column followed by different letters differ significantly by the Tukey test, P < 0.05, P < 0.01. Results are presented as mean ± standard error, SE.n = 5.