Polycomb protein Bmi1 promotes odontoblast differentiation by accelerating Wnt and BMP signaling pathways

doi:10.21203/rs.3.rs-4904329/v1

Download PDF

Research Article

Polycomb protein Bmi1 promotes odontoblast differentiation by accelerating Wnt and BMP signaling pathways

https://doi.org/10.21203/rs.3.rs-4904329/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Bmi1 is a polycomb protein localized in stem cells and maintains their stemness ability. This protein is also reported to regulate the expression of various differentiation genes. In this study, to analyze the role of Bmi1 during dentinogenesis, we examined the immunohistochemical localization of Bmi1 during rat tooth development as well as after cavity preparation. Bmi1 localization was hardly detected in the dental mesenchyme at the bud and cap stages. After the bell stage, however, this protein became detectable in preodontoblasts and early odontoblasts just beginning dentin matrix secretion. As dentin formation progressed, Bmi1 immunoreactivity in the odontoblasts decreased in intensity. After cavity preparation, cells lining the dentin and some pulp cells under the cavity were immunopositive for Bmi1 at 4 days. Odontoblast-like cells forming reparative dentin were immunopositive for Bmi1 at 1 week, whereas their immunoreactivity was not detected after 8 weeks. We further analyzed the function of Bmi1 by using KN-3 cells, a dental mesenchymal cell line. Overexpression of Bmi1 in KN-3 cells promoted mineralized tissue formation. In contrast, siRNA knockdown of Bmi1 in KN-3 cells reduced alkaline phosphatase activity and the expression of odontoblast differentiation marker genes such as Runx2, Osterix, and Osteocalcin. Additionally, KN-3 cells transfected with siRNA against Bmi1 showed reduced nuclear transition of β-catenin and expression of phosphorylated-Smad1/5/8. Taken together, these findings suggest that Bmi1 was localized in the odontoblast-lineage cells in their early differentiation stages. Bmi1 might positively regulate their differentiation by accelerating Wnt and BMP signaling pathways.

Bmi1

Polycomb protein

Dentin formation

Reparative dentin

Odontoblast differentiation

A number of growth factors and transcription factors such as bone morphogenetic proteins (BMPs), transforming growth factor (TGF)- β, Msx-2, runt-related transcription factor 2 (Runx2), and Osterix participate in dentin formation and regeneration (Chen et al. 2009; Hosoya et al. 2008a; Thesleff 2003; Liu et al. 2022). However, we know little about the mechanism by which each factor regulates odontoblast differentiation. Understanding the involvement of such molecules in odontoblast differentiation could assist in the development of new pulp regenerative therapy.

Bmi1, encoded by B cell-specific moloney murine leukemia virus integration site 1, is a member of the polycomb group of proteins, which are epigenetic regulatory factors that act through histone modification and chromatin remodeling. The target genes of this group are mainly developmental control molecules related to morphogenesis (Di Croce and Helin 2013). Bmi1 has been reported to regulate cell proliferation by repressing the gene expression of p16^Ink4A and p19^Arf, which are cell-cycle inhibitors (Jacobs et al. 1999; Yin et al. 2021). In addition, since Bmi1 promotes self-renewal ability in hematopoietic stem cells (Lessard and Sauvageau 2003) and neural stem cells (Molofsky et al. 2005), this protein is also known as a stem cell marker (Li et al. 2011). On the other hand, in postnatal mouse molar (Nakagawa et al. 2012) and human odontogenic tumors (Kumamoto and Ohki 2010), Bmi1 localization is not only seen in undifferentiated cells but also in ameloblasts, odontoblasts, and some dental pulp cells. However, the temporospatial localization of Bmi1 during tooth development has not been precisely examined.

Bmi1-deficient mice display hematopoietic and neurologic cell abnormalities due to a failure of stem cell division (Lessard and Sauvageau 2003; Molofsky et al. 2005) and die during early adulthood. Additionally, these mice show skeletal growth retardation with reduced proliferation of growth plate chondrocytes (Zhang et al. 2010). Mice lacking Bmi1 exhibit thin enamel and dentin formation due to decreased proliferation of ameloblast- and odontoblast-precursors (Biehs et al. 2013; Huang et al. 2018). It was also reported that dental pulp stem cells isolated from human permanent teeth (Gronthos et al. 2000) show decreased alkaline phosphatase activity and mineralized tissue formation after long term subculture, which decreased is a consequence of reduced expression of Bmi1 (Mehrazarin et al. 2011). Therefore, Bmi1 can be considered to be involved in the formation of hard tissues including bone and tooth.

In the present study, we focused on whether Bmi1 regulates odontoblast differentiation during dentin formation and regeneration. We demonstrated that Bmi1 was strictly expressed in odontoblast-lineage cells during tooth development as well as during dentin regeneration. The function of Bmi1 in odontoblast-lineage cells was also investigated by use of the gene transfer to KN-3 immortalized rat dental mesenchymal cells (Nomiyama et al. 2007). Furthermore, we analyzed the relationship between Bmi1 and signaling molecules β-catenin and phosphorylated (P)-Smad1/5/8, both of which are involved in odontoblast differentiation.

All experiments were approved and performed according to guidelines set forth by the Matsumoto Dental University Committee on Intramural Animal Use.

Immunohistochemistry

Lewis rat mandibles were collected at embryonic days (E) 15–17 and postnatal days (P) 2–28, and then fixed with 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.4). After demineralization with 10% ethylenediamine tetraacetic acid (pH 7.4), the specimens were embedded in paraffin and sectioned. The sections were processed for immunohistochemistry using mouse monoclonal antibody against human Bmi1 (Clone 384509; R&D Systems, MN, USA) and rabbit polyclonal antibodies against human β-catenin (Cell Signaling Technology, MA, USA) and P-Smad1/5/8 (Cell Signaling Technology). After the sections had been reacted with Histofine Simple Stain rat MAX-PO (MULTI; NICHIREI, Tokyo, Japan), the immune complexes were visualized by using diaminobenzidine (Envision kit; DAKO, CA). The immunostained sections were then counter-stained with hematoxylin.

Cavity preparation

Following anesthesia, semicircular cavities were prepared on the mesial surfaces of P28 rat lower first molars by using a tungsten carbide bur under water cooling. The distance from the bottom of the cavity to the pulpal wall was approximately 400 µm. At 1–4 days or 1–8 weeks after the cavity preparation, the mandibles were dissected; and paraffin sections were prepared as described above. Serial sections were stained with hematoxylin and eosin (H-E) or processed for immunohistochemistry using Bmi1 antibody. As a control, the mandible of an untreated rat was processed in the same way.

Cell culture

KN-3 cells (1x10⁴ per well/48-well plate) were plated in α-minimum essential medium (Sigma-Aldrich, St Louis, MO) containing 10% fetal bovine serum (BSA; Biological Industries LTD, Haemek, Israel), L-glutamine (Invitrogen, Carlsbad, CA), and antibiotic-antimycotic (Invitrogen) at 37°C in a humidified atmosphere of 5% CO₂ in air. The cells were then incubated in culture medium supplemented with 100nM dexamethasone, 5mM β-glycerophosphate, and 10mM ascorbic acid for the induction of odontoblast-lineage cells.

Transfection with plasmid DNA or siRNA

An expression vector encoding rat Bmi1 (OriGene Technologies Inc., Rockville, MD) and siRNA against Bmi1 (Bmi1 siRNA; target sequence: ATGCTGTTCTGTGAACCTGTA, QIAGEN, Hilden, Germany) were purchased from the indicated sources. TransIT-LT1 Reagent (Mirus, Madison, WI) was used for transfection of the KN-3 cells with expression vectors with or without Bmi1 DNA according to the manufacturer’s instructions. Other KN-3 cells were transfected with 20 nM Bmi1 siRNA or negative control siRNA (AllStars Neg. Control siRNA; QIAGEN) by use of Lipofectamine RNAiMAX (Invitrogen).

Western blotting

The cultured cells were lysed in sample buffer containing 20 mM N-ethylmaleimide and protease inhibitor cocktail (Sigma-Aldrich). Cell lysates were electrophoresed on an SDS-PAGE gel, transferred onto a PVDF membrane, reacted with mouse monoclonal antibody against human Bmi1 or rabbit polyclonal antibodies against human P-Smad1/5/8, Smad1/5/8 (Santa Cruz Biotechnology, CA, USA) or β-Tubulin (Santa Cruz Biotechnology) and then with horseradish peroxidase-conjugated anti-mouse or rabbit IgG (Sigma-Aldrich). Immunoreactivity was visualized by using ECL Western blotting detection reagents (Amersham Pharmacia Biotech UK Ltd., Buckinghamshire, England).

Alkaline phosphatase (ALP) staining

KN-3 cells were plated in 48-well plates and cultured in the differentiation medium. At 0–4 days after the induction, the cells were stained with a mixture of 330 µg/ml nitroblue tetrazolium, 165 µg/ml bromochloroindoylphosphate, 100 mM NaCl, 5 mM MgCl₂, and 100 mM Tris (pH 9.5).

Quantitative real-time PCR

Total RNA was extracted from KN-3 cells by using an RNeasy Plus Micro Kit (QIAGEN). The RNA was then subjected to real-time PCR analysis using a One Step SYBR PrimeScript PLUS RT-PCR Kit (Takara Bio Inc., Shiga, Japan) and an Opticon Real-Time PCR System (MJ Research, MA, USA). The primer sequences for Tissue non-specific alkaline phosphatase (TNALP), Runx2, Osterix, Osteocalcin, and β-actin genes are shown in Appendix Table 1. β-actin was used as internal reference for each sample. All experiments were repeated at least 3 times, and the data were expressed as the mean ± SD. Statistical significance between groups was evaluated by performing Student’s t test. Differences at P < 0.05 were considered statistically significant.

Alizarin red staining

For detection of calcification, KN-3 cells were inoculated into 48-well plates coated with collagen solution (Cellmatrix Type I-A; Nitta gelatin, Osaka, Japan) and cultured in the presence or absence of 100nM dexamethasone, 5mM β-glycerophosphate, and 10mM ascorbic acid in the culture medium for 4 or 7 days. The cells were then fixed in 4% paraformaldehyde in 0.1 M phosphate buffer and stained with 1% alizarin red solution.

Immunofluorescence staining

KN-3 cells transfected with plasmid DNA or siRNAs were cultured in the differentiation medium for 1 h. They were thereafter fixed with 4% paraformaldehyde for 5 min and rendered permeable in 0.1% NP-40 for 10 min. Samples were pretreated with 10% BSA for 1 h at room temperature and then incubated with anti-β-catenin antibody for 12 h at 4°C. Next, they were incubated with Alexa488-conjugated anti-rabbit IgG antibody (Invitrogen) for 1 h at room temperature and then counter-stained with DAPI. The fluorescence of specimens was observed under a fluorescence microscope (Axioplan 2; Carl Zeiss, Oberkochen, Germany).

Localization of Bmi1 during tooth development

Bmi1 was detected immunohistochemically in osteoblasts on the surface of the alveolar bone but not in cells in the tooth germ at the bud (E15) stage (Fig. 1A). At the cap stage (E17), some cells in the enamel organ including the inner or outer enamel epithelium and stellate reticulum showed a positive reaction (Fig. 1B–C). In the dental mesenchyme, Bmi1-positive cells were scarce in the dental papillae, but this reactivity was seen in some cells in the dental follicle (Fig. 1B, D).

At the bell stage (P2), at which time a thin layer of dentin and enamel had appeared at the upper crown, odontoblasts and preodontoblasts demonstrated intense immunoreactivity for Bmi1 (Fig. 1E–F). This localization was also confirmed in all cell types within the enamel organ and was particularly strong in ameloblasts (Fig. 1E). Some cells in the dental follicle and around the alveolar bone also displayed the immunoreactivity (Fig. 1G). However, the dental papillae hardly showed any immunoreactivity (Fig. 1F–G).

At the stage of root formation (P28), odontoblasts at the apical root and preodontoblasts near these odontoblasts showed strong immunoreactivities for Bmi1. The intensity gradually decreased in the more upwardly located odontoblasts (Fig. 2A–C). This immunoreactivity was also detected in some cells within the apical subodontoblastic cell-rich layer and in the Hertwig’s epithelial root sheath (Fig. 2D). Some cementoblasts, cementocytes, and periodontal ligament fibroblasts were also immunoreactive with antibodies against Bmi1 (Fig. 2B).

Localization of Bmi1 in the rodent incisor

Since the rodent incisors erupt continuously throughout the life of the animal, odontoblasts at all differentiation stages can be compared in one tooth at the same time (Hosoya et al., 2006). In addition, undifferentiated mesenchymal cells exist around the labial cervical loop (Harada and Ohshima 2004). Bmi1 was not detected in the dental papillae around the cervical loop nor in the layer of preodontoblasts (Fig. 2E). As the odontoblast differentiation progressed, Bmi1 expression appeared in the preodontoblast and odontoblast layers (Fig. 2F–H). Some cells in the subodontoblastic layer were also immunopositive for Bmi1 (Fig. 2H). Most cells in the cervical loop as well as preameloblasts and ameloblasts displayed the immunoreactivity (Fig. 2E–G).

Localization of Bmi1 during the process of dentin regeneration

Next, to clarify whether Bmi1 participates in dentin regeneration, we examined the localization pattern of Bmi1-positive cells in the dental pulp after cavity preparation. In the coronal pulp chamber of a P28 rat molar, columnar odontoblasts were aligned on the surface of the predentin (Fig. 3A). Immunoreactivity for Bmi1 hardly detected in these odontoblasts. Dental pulp cells also did not show any immunoreactivity (Fig. 3B–C). At 1 day after cavity preparation, the pulp tissue beneath the cavity was necrotic, as evidenced by scattered pyknotic nuclei of odontoblasts and dental pulp cells (Fig. 3D). The expression of Bmi1 was not visible in the necrotic pulp (Fig. 3E–F). At 4 days after cavity preparation, when the necrotic region had been repaired, numerous blood vessels and pulp cells were observed beneath the cavity. A little eosin-stained matrix was formed on the original dentin (Fig. 3G). Cells close to the newly-formed matrix were positive for Bmi1 (Fig. 3H–I). By 1 week after cavity preparation, reparative dentin was formed beneath the cavity by reparative odontoblasts (Fig. 3J). These cells that actively formed the reparative dentin were immunopositive for Bmi1 (Fig. 3K–L), whereas this immunoreactivity was not seen in reparative odontoblasts after 8 weeks (Fig. 3M–O).

Bmi1 function in odontoblast differentiation

To clarify the role of Bmi1 in odontoblast differentiation, we carried out functional assays by both overexpression and knockdown of Bmi1 in KN-3 cells.

Western blotting analysis revealed that Bmi1 antibody reacted with the lysate of KN-3 cells before the induction of hard tissue-forming cells (data not shown). At 2 days after the induction, Bmi1 expression was slightly elevated in the cells transfected with the control vector. KN-3 cells transfected with Bmi1 DNA showed enhanced expression of Bmi1 at 2 days (Fig. 4A). No ALP activity was detected in cells before the induction or in those treated with control vector at 2 days. However, this activity was markedly enhanced in cells transfected with Bmi1 DNA (Fig. 4B). Consistent with the results of the ALP activity analysis, expression levels of odontogenic markers such as TNALP, Runx2, Osterix, and Osteocalcin (Thesleff 2003; Chen et al. 2009; Hosoya et al. 2007; Hosoya et al. 2008b; Zhang et al. 2024) were elevated in KN-3 cells transfected with Bmi1 vector. On the other hand, there was no significant difference in expressions of these 4 markers between non-treated cells and cells transfected with the control vector (Fig. 4C). At 4 days after the induction, Bmi1-overexpressing cells produced more alizarin red-positive mineralized matrix than did the control cells (Fig. 4D).

Bmi1 expression in KN-3 cells transfected with control siRNA was clearly detected by Western blotting at 4 days after the induction; whereas transfection with siRNA against Bmi1 robustly reduced the Bmi1 protein level to one similar to that seen in the non-treated cells (Fig. 4E). The cells transfected with control siRNA exhibited clear ALP activity and increased expression of 4 differentiation markers at 4 days after the induction, but this up-regulated expression was reduced in Bmi1-knockdown cells to almost the same level as seen in the non-treated cells (Fig. 4F–G). Alizarin red-positive matrix, indicating mineralization, was formed by KN-3 cells transfected with the control siRNA at 7 days after induction. However, Bmi1-knockdown cells showed much weaker staining (Fig. 4H). These findings indicate that Bmi1 positively regulated the odontoblast-lineage cell differentiation in KN-3 cells.

Regulation of Wnt and BMP signaling by Bmi1

Bmi1 knockdown has been shown to inhibit gene expression of several signaling molecules including those in the Notch, Hedgehog, Wnt, and BMP/TGF-β pathways (Wiederschain et al. 2007; Douglas et al. 2008). Among them, since Wnt and BMP signaling pathways are related to odontoblast differentiation (Balic and Thesleff 2015; Zhang et al. 2024; Fu et al. 2023), we further examined whether the regulation of Wnt and BMP signalings by Bmi1 was a common phenomenon in odontoblast differentiation.

Nuclear localization of β-catenin and P-Smad1/5/8, respectively indicating the activation state of canonical Wnt and BMP signaling pathways, was confined to apical odontoblasts and their adjacent preodontoblasts as well as to some cells in the apical subodontoblastic layer (Fig. 5A, C, D, F). The nuclear localization of β-catenin and P-Smad1/5/8 in the odontoblasts gradually decreased in the more upwardly located odontoblasts (Fig. 5B, E). Therefore, these localization patterns were similar to that pattern of Bmi1 in the P28 molar (Fig. 2A–D).

Next, β-catenin localization was examined in KN-3 cells after transfection of them with plasmid vectors or siRNAs. Immunoreactivity of β-catenin was seen within the cytoplasm of most KN-3 cells under normal culture conditions (Fig. 5G). At 1 hour after the induction of odontoblast-lineage cells, nuclear transition of β-catenin was observed in some cells transfected with control vector or control siRNA (Fig. 5H, J). On the other hand, most cells transfected with Bmi1 DNA showed the nuclear localization of Bmi1, whereas Bmi1-knockdown decreased this transition (Fig. 5I, K).

KN-3 cells transfected with expression vectors or siRNAs were treated with the induction medium for 1 h and then checked for the phosphorylation of Smad1/5/8 by Western blotting analysis. As shown in Fig. 5L, the phosphorylation level of Smad1/5/8 was enhanced by Bmi1-overexpression and suppressed by Bmi1-knockdown compared with their control levels.

Previous reports have described that Bmi1 is mainly expressed in some stem and precursor cells for maintaining their stemness ability (Lessard and Sauvageau 2003; Molofsky et al. 2005). In the tooth, dental pulp stem cells also express Bmi1 (Iohara et al. 2006; Mehrazarin et al. 2011). However, in the present study, we showed Bmi1 localization in a wide variety of hard tissue-forming cells including odontoblasts, ameloblasts, cementoblasts, and osteoblasts. Deletion of Bmi1 in mice has been shown to cause bone and tooth hypoplasia (Zhang et al. 2010; Biehs et al. 2013; Wang et al. 2018). Therefore, in light of its localization, Bmi1 can be thought to have a role not only in stem cells but also in hard tissue-forming cells. Our experiments using the Bmi1 expression vector revealed that Bmi1 overexpressed in KN-3 cells resulted in accelerated differentiation of odontoblast-lineage cells. In addition, KN-3 cells transfected with siRNA against Bmi1 were blocked in their differentiation into odontoblast-lineage cells. These results demonstrated that Bmi1 might function as a positive regulator for cell differentiation and matrix production of odontoblasts.

Histological studies have demonstrated that external stimuli, such as dental caries and cavity preparation, cause degeneration of odontoblasts and facilitate the migration of undifferentiated mesenchymal cells to the injured area. After that, the mesenchymal cells differentiate into reparative odontoblasts and form reparative dentin (Yoshiba et al. 1996; Harada et al. 2008; Shibui et al. 2023; Hosoya et al. 2013). Bmi1 was detected in cells lining the original dentin as well as around these lining cells at 4 days after cavity preparation. This finding suggests that Bmi1 might function in undifferentiated cells during the pulp healing process. In addition, at 1 week after cavity preparation, this protein was detected in the reparative odontoblasts; but by 8 weeks it was no longer present. After dentin injuries, the dental pulp undergoes a rapid reparative dentin formation to avoid pulp exposure. Bmi1 expression in reparative odontoblasts and their progenitors may be required for accelerating dentin matrix formation.

At the root formation stage, some cells in the apical subodontoblastic layer were immunopositive for Bmi1. The subodontoblastic layer is located near the odontoblast layer and has intense alkaline phosphatase immunoreactivity (Hosoya et al. 2003; Hoshi et al. 1997). It is speculated that this layer may provide odontoblast-lineage cells when odontoblasts are injured and their cellular activity is lost (Harada et al. 2008; Hosoya et al. 2012a). Additionally, differentiation marker proteins such as Smad4, Runx2, and Osterix demonstrate a similar pattern of immunoreactivity as the pattern of Bmi1 localization in apical subodontoblastic cells (Hosoya et al. 2012b; Hosoya et al. 2013). Furthermore, these Osterix-expressing cells at the beginning of the root formation stage were previously reported to contribute odontoblast-lineage cells within the tooth root (Ono et al. 2016). Bmi1-positive cells in the apical subodontoblastic layer might thus be the progenitors of odontoblast-lineage cells.

Bmi1 has been shown to interact with Wnt and TGF/BMP signaling pathways (Douglas et al. 2008; Wiederschain et al. 2007), which signalings promote dentin formation during tooth development (Balic and Thesleff 2015) and pulp healing processes (Ishimoto et al. 2015; Wang et al. 2014). In this study, β-catenin and Smad1/5/8 co-localized with Bmi1 in the nuclei of apical odontoblasts. Additionally, the expression of these signaling molecules became synchronous to Bmi1 expression in KN-3 cells after the stimulation to odontoblast-lineage cell differentiation. These results suggest that Bmi1 might regulate dentin matrix secretion in the apical odontoblasts by the induction of Wnt and BMP signaling pathways. Further research regarding the precise factors downstream of Bmi1 for odontoblast differentiation is required.

In conclusion, Bmi1 was expressed in odontoblast-lineage cells in their differentiation stages during dentin formation and regeneration. The results of gene transfection analyses suggested that this expression enhanced odontoblast differentiation. In addition, we showed that the regulation of odontoblast differentiation by Bmi1 might take place, at least in part, via Wnt and BMP signaling pathways. Our present findings regarding Bmi1 should contribute to a better understanding of odontoblast differentiation and may lead to the development of a more effective dentin regeneration therapy.

Conflict of Interest

The authors declare that there are no conflicts of interest.

Author Contribution

A. H. and H. N. designed the study and wrote the paper; A. H. carried out most of the experiments and analyzed the data; H. T., T. N. and A. Y. participated in the experiment; N. Y., Y. K., Y. N. and M. I. contributed to data interpretation; A. W., T. M. and C. K. participated in cell maintenance. All authors gave final approval and agree to be accountable for all aspects of the work.

Acknowledgement

This work was supported by Grant-in-Aid from the Japan Society for the Promotion of Science (JSPS).

Balic A, Thesleff I (2015) Tissue interactions regulating tooth development and renewal. Curr Top Dev Biol 115:157–186. https://doi.org/.org/0.1016/bs.ctdb.2015.07.006
Biehs B, Hu JK, Strauli NB, Sangiorgi E, Jung H, Heber RP, Ho S, Goodwin AF, Dasen JS, Capecchi MR, Klein OD (2013) BMI1 represses Ink4a/Arf and Hox genes to regulate stem cells in the rodent incisor. Nat Cell Biol 15:846–852. https://doi.org/10.1038/ncb2766
Chen S, Gluhak-Heinrich J, Wang YH, Wu YM, Chuang HH, Chen L, Yuan GH, Dong J, Gay I, MacDougall M (2009) Runx2, osx, and dspp in tooth development. J Dent Res 88:904–909. https://doi.org/88/10/904 10.1177/0022034509342873
Di Croce L, Helin K (2013) Transcriptional regulation by Polycomb group proteins. Nat Struct Mol Biol 20:1147–1155. https://doi.org/10.1038/nsmb.2669
Douglas D, Hsu JH, Hung L, Cooper A, Abdueva D, van Doorninck J, Peng G, Shimada H, Triche TJ, Lawlor ER (2008) BMI-1 promotes ewing sarcoma tumorigenicity independent of CDKN2A repression. Cancer Res 68:6507–6515. https://doi.org/10.1158/0008-5472.CAN-07-6152
Fu Y, Miyazaki K, Chiba Y, Funada K, Yuta T, Tian T, Mizuta K, Kawahara J, Zhang L, Martin D, Iwamoto T, Takahashi I, Fukumoto S, Yoshizaki K (2023) Identification of GPI-anchored protein LYPD1 as an essential factor for odontoblast differentiation in tooth development. J Biol Chem 299:104638. https://doi.org/10.1016/j.jbc.2023.104638
Gronthos S, Mankani M, Brahim J, Robey PG, Shi S (2000) Postnatal human dental pulp stem cells (DPSCs) in vitro and in vivo. Proc Natl Acad Sci U S A 97:13625–13630. https://doi.org/:10.1073/pnas.240309797
Harada H, Ohshima H (2004) New perspectives on tooth development and the dental stem cell niche. Arch Histol Cytol 67:1–11.
Harada M, Kenmotsu S, Nakasone N, Nakakura-Ohshima K, Ohshima H (2008) Cell dynamics in the pulpal healing process following cavity preparation in rat molars. Histochem Cell Biol 130:773–783. https://doi.org/10.1007/s00418-008-0438-3
Hoshi K, Amizuka N, Oda K, Ikehara Y, Ozawa H (1997) Immunolocalization of tissue non-specific alkaline phosphatase in mice. Histochem Cell Biol 107:183–191.
Hosoya A, Hiraga T, Ninomiya T, Yukita A, Yoshiba K, Yoshiba N, Takahashi M, Ito S, Nakamura H (2012a) Thy-1-positive cells in the subodontoblastic layer possess high potential to differentiate into hard tissue-forming cells. Histochem Cell Biol 137:733–742. https://doi.org/10.1007/s00418-012-0928-1
Hosoya A, Kim JY, Cho SW, Jung HS (2008a) BMP4 signaling regulates formation of Hertwig's epithelial root sheath during tooth root development. Cell Tissue Res 333:503–509. https://doi.org/10.1007/s00441-008-0655-z
Hosoya A, Nakamura H, Ninomiya T, Hoshi K, Yoshiba K, Yoshiba N, Takahashi M, Okabe T, Sahara N, Yamada H, Kasahara E, Ozawa H (2007) Hard tissue formation in subcutaneously transplanted rat dental pulp. J Dent Res 86:469–474. https://doi.org/86/5/469 [pii]
Hosoya A, Ninomiya T, Hiraga T, Zhao C, Yoshiba K, Yoshiba N, Takahashi M, Okabe T, Wakitani S, Yamada H, Kasahara E, Ozawa H, Nakamura H (2008b) Alveolar bone regeneration of subcutaneously transplanted rat molar. Bone 42:350–357. https://doi.org/10.1016/j.bone.2007.09.054
Hosoya A, Yoshiba K, Yoshiba N, Hoshi K, Iwaku M, Ozawa H (2003) An immunohistochemical study on hard tissue formation in a subcutaneously transplanted rat molar. Histochem Cell Biol 119:27–35. https://doi.org/10.1007/s00418-002-0478-z
Hosoya A, Yukita A, Ninomiya T, Hiraga T, Yoshiba K, Yoshiba N, Kasahara E, Nakamura H (2013) Localization of SUMOylation factors and Osterix in odontoblast lineage cells during dentin formation and regeneration. Histochem Cell Biol 140:201–211. https://doi.org/10.1007/s00418-013-1076-y
Hosoya A, Yukita A, Yoshiba K, Yoshiba N, Takahashi M, Nakamura H (2012b) Two distinct processes of bone-like tissue formation by dental pulp cells after tooth transplantation. J Histochem Cytochem 60:861–873. https://doi.org/10.1369/0022155412459741
Huang Y, Chen N, Miao D (2018) Pyrroloquinoline quinone plays an important role in rescuing Bmi-1(-/-) mice induced developmental disorders of teeth and mandible--anti-oxidant effect of pyrroloquinoline quinone. Am J Transl Res 10:40–53.
Iohara K, Zheng L, Ito M, Tomokiyo A, Matsushita K, Nakashima M (2006) Side population cells isolated from porcine dental pulp tissue with self-renewal and multipotency for dentinogenesis, chondrogenesis, adipogenesis, and neurogenesis. Stem Cells 24:2493–2503. https://doi.org/10.1634/stemcells.2006-0161
Ishimoto K, Hayano S, Yanagita T, Kurosaka H, Kawanabe N, Itoh S, Ono M, Kuboki T, Kamioka H, Yamashiro T (2015) Topical application of lithium chloride on the pulp induces dentin regeneration. PloS one 10:e0121938. https://doi.org/10.1371/journal.pone.0121938
Jacobs JJ, Kieboom K, Marino S, DePinho RA, van Lohuizen M (1999) The oncogene and polycomb-group gene bmi-1 regulates cell proliferation and senescence through the ink4a locus. Nature 397:164–168. https://doi.org/10.1038/16476
Kumamoto H, Ohki K (2010) Detection of CD133, Bmi-1, and ABCG2 in ameloblastic tumors. J Oral Pathol Med 39:87–93. https://doi.org/10.1111/j.1600-0714.2009.00807.x
Lessard J, Sauvageau G (2003) Bmi-1 determines the proliferative capacity of normal and leukaemic stem cells. Nature 423:255–260. https://doi.org/10.1038/nature01572
Li L, Kwon HJ, Harada H, Ohshima H, Cho SW, Jung HS (2011) Expression patterns of ABCG2, Bmi-1, Oct-3/4, and Yap in the developing mouse incisor. Gene Expr Patterns. 11:163–170. https://doi.org/10.1016/j.gep.2010.11.001
Liu M, Goldman G, MacDougall M, Chen S (2022) BMP Signaling Pathway in Dentin Development and Diseases. Cells 11:2216. https://doi.org/10.3390/cells11142216
Mehrazarin S, Oh JE, Chung CL, Chen W, Kim RH, Shi S, Park NH, Kang MK (2011) Impaired odontogenic differentiation of senescent dental mesenchymal stem cells is associated with loss of Bmi-1 expression. J Endod 37:662–666. https://doi.org/10.1016/j.joen.2011.02.009
Molofsky AV, He S, Bydon M, Morrison SJ, Pardal R (2005) Bmi-1 promotes neural stem cell self-renewal and neural development but not mouse growth and survival by repressing the p16Ink4a and p19Arf senescence pathways. Genes Dev 19:1432–1437. https://doi.org/10.1101/gad.1299505
Nakagawa E, Zhang L, Shin JO, Kim EJ, Cho SW, Ohshima H, Chen Z, Jung HS (2012) The novel expression of Oct3/4 and Bmi1 in the root development of mouse molars. Cell Tissue Res 347:479–484. https://doi.org/10.1007/s00441-011-1310-7
Nomiyama K, Kitamura C, Tsujisawa T, Nagayoshi M, Morotomi T, Terashita M, Nishihara T (2007) Effects of lipopolysaccharide on newly established rat dental pulp-derived cell line with odontoblastic properties. J Endod 33:1187–1191. https://doi.org/10.1016/j.joen.2007.05.015
Ono W, Sakagami N, Nishimori S, Ono N, Kronenberg HM (2016) Parathyroid hormone receptor signalling in osterix-expressing mesenchymal progenitors is essential for tooth root formation. Nat Commun 7:11277. https://doi.org/10.1038/ncomms11277
Shibui T, Hosoya A, Takebe H, Takahashi M, Seki Y, Fujii S, Irie K (2023) Immunohistochemical localization of CD146 and alpha-smooth muscle actin during dentin formation and regeneration. Anat Rec 306:2199–2207. https://doi.org/10.1002/ar.25155
Thesleff I (2003) Epithelial-mesenchymal signalling regulating tooth morphogenesis. J Cell Sci 116:1647-1648.
Wang H, Lv C, Gu Y, Li Q, Xie L, Zhang H, Miao D, Sun W (2018) Overexpressed Sirt1 in MSCs promotes dentin formation in Bmi1-deficient mice. J Dent Res 97:1365–1373. https://doi.org/10.1177/0022034518781509
Wang X, He H, Wu X, Hu J, Tan Y (2014) Promotion of dentin regeneration via CCN3 modulation on Notch and BMP signaling pathways. Biomaterials 35:2720–2729. https://doi.org/10.1016/j.biomaterials.2013.12.029
Wiederschain D, Chen L, Johnson B, Bettano K, Jackson D, Taraszka J, Wang YK, Jones MD, Morrissey M, Deeds J, Mosher R, Fordjour P, Lengauer C, Benson JD (2007) Contribution of polycomb homologues Bmi-1 and Mel-18 to medulloblastoma pathogenesis. Mol Cell Biol 27:4968–4979. https://doi.org/10.1128/MCB.02244-06
Yin Y, Zhou N, Zhang H, Dai X, Lv X, Chen N, Miao D, Hu Q (2021) Bmi1 regulate tooth and mandible development by inhibiting p16 signal pathway. J Cell Mol Med 25:4195–4203. https://doi.org/10.1111/jcmm.16468
Yoshiba N, Yoshiba K, Nakamura H, Iwaku M, Ozawa H (1996) Immunohistochemical localization of HLA-DR-positive cells in unerupted and erupted normal and carious human teeth. J Dent Res 75:1585–1589.
Zhang HW, Ding J, Jin JL, Guo J, Liu JN, Karaplis A, Goltzman D, Miao D (2010) Defects in mesenchymal stem cell self-renewal and cell fate determination lead to an osteopenic phenotype in Bmi-1 null mice. J Bone Miner Res 25:640–652. https://doi.org/10.1359/jbmr.090812
Zhang S, Guan J, Lv J, Dong X, Li R, Wang Y, Jin XA (2024) Neohesperidin exerts subtle yet comprehensive regulation of mouse dental papilla cell-23 in vitro. Arch Oral Biol 167:106055. https://doi.org/10.1016/j.archoralbio.2024.106055

No competing interests reported.

Appendixtable1.docx
Appendix table 1 List of oligonucleotides used for quantitative real-time PCR.

Download PDF

Editorial decision: Revision requested
02 Sep, 2024
Reviews received at journal
02 Sep, 2024
Reviews received at journal
20 Aug, 2024
Reviews received at journal
19 Aug, 2024
Reviewers agreed at journal
15 Aug, 2024
Reviewers agreed at journal
14 Aug, 2024
Reviewers agreed at journal
14 Aug, 2024
Reviewers invited by journal
13 Aug, 2024
Editor assigned by journal
13 Aug, 2024
Submission checks completed at journal
13 Aug, 2024
First submitted to journal
13 Aug, 2024

You are reading this latest preprint version

Polycomb protein Bmi1 promotes odontoblast differentiation by accelerating Wnt and BMP signaling pathways

Status:

Version 1

Abstract

Figures

Introduction

Materials and methods

Immunohistochemistry

Cavity preparation

Cell culture

Transfection with plasmid DNA or siRNA

Western blotting

Alkaline phosphatase (ALP) staining

Quantitative real-time PCR

Alizarin red staining

Immunofluorescence staining

Results

Localization of Bmi1 during tooth development

Localization of Bmi1 in the rodent incisor

Localization of Bmi1 during the process of dentin regeneration

Bmi1 function in odontoblast differentiation

Regulation of Wnt and BMP signaling by Bmi1

Discussion

Declarations

Conflict of Interest

Author Contribution

Acknowledgement

References

Additional Declarations

Supplementary Files

Status:

Version 1