Drugs and chemicals
Sulfasalazine (SAZO, 500mg), was procured from Wallace Pharmaceuticals Private, Limited, India. Trigonella foenum greacum L. seeds was obtained from the local market in Udupi, Karnataka, India, which was authenticated by a botanist. All the Chemicals Sodium carbonate (Na2CO3), Sodium hydroxide (NaOH), Sodium-potassium alloy (NaK), Copper sulphate (CuSO4), Trichloro acetic acid (TCA), DTNB [5-5’-dithiobis (2-nitrobenzoic acid)], Potassium dihydrogen phosphate (KH2PO4), Disodium hydrogen phosphate (Na2HPO4), Sodium bicarbonate, Adrenalin bitartarate, Thiobarbituric acid (TBA), 2-propanol, chloroform, formalin, ethanol, paraffin wax, xylene, and DPX were purchased from Sigma Aldrich, St.Louis, MO, USA. Trizol Reagent, Primers- TNF α: Forward: 5’ CACCATGAGCACGGAAAGCA 3’, Reverse: 5’ GCAATGACTCCAAAGTAGACC 3’, GAPDH: Forward: 5’ CAACTCCCTCAAGATTGTCAGCAA 3’, Reverse: 5’GGCATGGACTGTGGTCATGA 3’, cDNA synthesis kit and GoTaq Green mater mix were procured from Gennext Scientific and IT solutions, Mulky, India. All the solutions were freshly prepared and all the reagents used were of analytical grade.
Animals and ethics approval
The study was approved by institutional Animal Ethics Committee (IAEC/KMC/93/2018). Wistar rats were procured from the Central Animal Facility of the institute in accordance with the committee for the purpose of Control and supervision of experimentation on animal guidelines (CPCSEA). Thirty male albino wistar rats of weight ranging 150-250gm, aged around 8-10 weeks were used in the study. The animals were housed under standard condition, 12:12 light-dark cycle, 50% humidity and 28°C temperature and provided with standard food granules and water ad libitum.
Preparation of extract
Trigonella foenum-graecum L. aqueous extract was prepared as described by Noor (2007). Stock solution was prepared by boiling 10 gm of dried, grounded fenugreek seeds in 250 mL of double distilled water for 1 h. The extract was left all night and then filtered and made to 250 mL by double distilled water.
Experimental design
Thirty adult male rats were randomly allocated into five groups:
Group I- Normal control
Group II- UC: Acetic acid plus distilled water
Group III- Standard: Sulfasalazine 100 mg/kg plus acetic acid
Group IV- TFG- I (500mg/kg): Trigonella foenum greacum L. seed extract 500mg/kg plus acetic acid (D. V. Joshi et al., 2015).
Group V- TFG- II (1000mg/kg): Trigonella foenum greacum L. seed extract 1000mg/kg plus acetic acid (D. V. Joshi et al., 2015).
The dose of Trigonella foenum greacum L. seed extract was selected based on the anti- inflammatory property and toxicity study which demonstrated that there was no mortality rate till 5g/kg of Trigonella foenum greacum L. seeds (Muralidhara et al., 1999). Based on this we have selected two doses of Trigonella foenum greacum L. seed (500mg/kg and 1000mg/kg).
Induction of Ulcerative colitis
The drugs were administered per orally for 7 days, along with diet. The volume of drugs were kept constant at 5 ml/kg. Control group received distilled water. On day 8 following overnight fasting, UC was induced by administration of 1 ml of 4% acetic acid (AA) transrectally using an 8Fr (2.7 mm) soft paediatric catheter coated with lignocaine anaesthetic. The catheter was passed till 6-8 cm from the anus under low dose ether anaesthesia. The rats were maintained in head down position (trendelenburg position) after AA administration for 10 seconds to prevent any leakage. The acidic solution was aspirated out and it was followed by transrectal colon wash with 2 ml of phosphate buffer saline (PBS) at pH 7. Ulcerative colitis was induced in groups II to V. The normal control group received only normal saline transrectally. Twenty-four hours following induction of colitis, animals were sacrificed under anaesthesia.
Colon weight/ length ratio
Colon weight was measured in grams and length in centimetres. The ratio of weight in grams to length in cm was calculated by Aleisa et al. (2014).
Disease Activity Index (DAI)
DAI was assessed by Cooper et al. (1993) method. The changes in growth rate, stool consistency, and presence of gross bleeding or occult blood in feces was scored from 0~4 for each animal with a score 0 as normal stool consistency and no occult/gross rectal bleeding while the maximum score 4 with diarrhea, gross bleeding along significant decrease in growth.
Macroscopic Scoring
Colon from each animal was separated and dissected out for macroscopic scoring. Scoring was done according to Morris et al. (1989). A colon of length 4 cm extending proximally 2 cm above the rectum was dissected, split longitudinally on a piece of paper, and the colon was scored macroscopically with score 0 as normal gross morphology and 5 as intensive inflammation and ulceration[13].
Histopathology
The colonic tissues stored in 10% formalin, fixed in paraffin wax and washed in graded alcohol series. The tissue sections of 5µm thickness were taken and mounted on the slides. The staining was done by deparaffinization using xylene at different time intervals followed by hydration using a series of graded alcohol (100%, 90%, 80%, 50%). After hydration, the tissues were stained with hematoxylin, and the slides were subjected to washing by slow running water. Differentiation and blueing were done after the hematoxylin stain and the tissues were counterstained with 1% eosin. Later the slides were dehydrated with absolute alcohol and cleared with pure xylene. Following this, the tissue was mounted with Dibutylphthalate Polystyrene Xylene, and coverslip was placed. The slides were left for air drying at room temperature and examined under light microscope.
The microscopic colon damage was scored as described by Gálvez et al. (2001) with a score 0 being normal colon and a maximal score of 5 with transmural inflammation and intense ulceration.
Biochemical Assessment
Preparation of Homogenate
For the determination of tissue Total protein (TP), antioxidants and Lipid peroxidation (LP), 10% homogenate of colon was prepared with ice cold KCL (150mM) using homogenizer (Model:Yamato L.S.GL.H-21, Japan) and centrifuged at 3000 rpm for 10 min at 4°C.
Total protein
The total protein estimation is based on the reduction of Cu2+ to Cu+ by protein in an alkaline medium. Chelation of copper (cupric ion) with protein in alkaline environment form a light blue chelate complex between peptides of three or more amino acids with cupric ion and results in formation of cuprous ion (biuret reaction). The Bicinchoninic acid (BCA) reagents reacts with the cuprous ions to form a strong purple colour, with maximum absorbance at 540nm (Assay et al., 2000).
Reduced Glutathione
Tissue glutathione was estimated as described by Laboratorien & Jenapharm (1962). The non-protein compound containing the sulfhydryl group in its structure is known as Glutathione reductase. It reduces 5,5'-dithiobis-2-nitrobenzoic acid to a deep yellow colored compound. The GSH activity was measured by spectrophotometer.
Catalase
Tissue catalase was estimated as described by Aebi (1984). The colon was homogenized and mixed with 50 mmol/L PBS (pH 7.0) and 20 mmol/L hydrogen peroxide. The catalase activity was measured by spectrophotometer.
Superoxide dismutase
Superoxide radicals present in supernatant oxidizes adrenaline bitartarate to form adrenochrome. Estimating the amount of adrenochrome formed is related to SOD activity as it will inhibit oxidation of adrenaline bitartarate by eliminating superoxide radicals (Kuninaka et al., 2000).
Lipid peroxidase by MDA assay
Polyunsaturated fatty acid breaks down to form malondialdehyde, which helps to determine the extent of peroxidation reaction. Pink color is formed by the reaction between thiobarbituric acid and malondialdehyde which is measured at 532nm (Ohkawa et al., 1979).
Reverse Transcription-Polymerase Chain Reaction (RT-PCR)
Total RNA was extracted from colonic tissues using Trizol reagent (Genext Scientific & IT Solutions, Mangalore) referring to the manufacturer’s protocol.
Primers (Designed by Genext Scientific & IT Solutions, Mangalore)
TNF α Forward 5’ CACCATGAGCACGGAAAGCA 3’
Reverse 5’ GCAATGACTCCAAAGTAGACC 3’
GAPDH: Forward 5’ CAACTCCCTCAAGATTGTCAGCAA 3’
Reverse 5’ GGCATGGACTGTGGTCATGA 3’
Method of RT-PCR
The total RNA was extracted from rat tissue biopsies homogenized in TRI-Reagent (T9424, Merck, India) following the manufacturer’s protocol. The extracted RNA was carefully assessed for its quality, purity and integrity using the 260/280 ratio, 260/230 ratio obtained from BioSpectrometer basic, (6135000009, Eppendorf, India) and agarose gel electrophoresis (intact gel bands corresponding to 28S and 18S RNA) respectively. The extracted RNA from each group was diluted to 180 ng/μl using nuclease free water to ensure a known amount of starting mRNA concentration from every group for cDNA synthesis. High-Capacity Reverse Transcriptase cDNA synthesis kit (ThermoFisher Scientific India Pvt. Ltd., India) was used to prepare cDNA (final volume of 20 μl) from the extracted total RNA using thermocycler (T100, BioRad, India). Synthesis of cDNA involved the use of random primers from the cDNA synthesis kit with internal controls as +RT/-RT(with or without reverse transcriptase) to reduce experimental errors and track specificity of primers in case of genomic DNA contamination. .
PCR was performed with a total volume of 25 μL. PCR mixture comprised: cDNA -4 μL, forward and reverse primers - 4 μL each, GoTaq Green master mix -12.5 μL and nuclease free water -4.5 μL. The reaction mixture was then subjected to 33 cycles which consists of 5 minutes pre-apo morphosis at 95°C, 30 seconds apo morphosis at 94°C, 30 seconds annealing at 54.1°C and 1 minute extension at 72°C. Then 10 μL of the ampicon was added to 1.5% agarose gel for electrophoresis. Gel doc (Gel Doc EZ Imager,BioRad, India) was used to capture the image of the gel followed by analysis using the Image- J software (Fiji) (Perera et al., 2010).
Statistical analysis
Statistical analysis was done using Graph Pad Prism 5.03 Demo Version (Graph Pad Software Inc., La Jolla, CA, USA) by one-way analysis of variance (Tukey test). Results were expressed as Mean ± SEM, and p≤0.05 was considered significant. The relative mRNA expression of TNFα was analyzed by Image-J 1.51f software (Wayne Rasband, National Institutes of Health, USA) using ANOVA (Dunnett’s test).