PKN2 signalling induces stromal cell protrusions to preserve lymph node structural integrity

doi:10.21203/rs.3.rs-4921177/v1

Download PDF

Article

PKN2 signalling induces stromal cell protrusions to preserve lymph node structural integrity

https://doi.org/10.21203/rs.3.rs-4921177/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Secondary lymphoid tissues develop specialized stromal networks to facilitate immune cell communication and efficient activation of adaptive immunity. This stromal architecture is robust, maintaining topology throughout extensive remodelling and tissue expansion in response to immune challenge. We have previously reported that cytoskeletal mechanics of the fibroblastic reticular cell (FRC) networks determine tissue tension, and that increased tension initiates stromal proliferation required for lymph node growth. However, it is not known how FRCs mechanistically reshape the stromal network to preserve integrity through the early phases of inflammation. Here, we find a signalling mechanism which coordinates reduced FRC contractility and induction of stromal cell protrusions. RhoA/C GTPase activity is blocked in FRCs to inhibit actomyosin contractility upon contact with CLEC-2⁺ dendritic cells (DCs) and binding to podoplanin⁺ stroma. We now find that an additional Rho GTPase target, the PKC family kinase PKN2, regulates activity of myristoylated alanine-rich protein kinase C-substrate (MARCKS). FRCs use MARCKS to generate protrusions in response to DC contact. We tested this mechanism in vivo and found that PKN2 knock-out lymph nodes are unable to regulate MARCKS and show severely disrupted stromal architecture during lymph node expansion. We now present a mechanism of stromal/immune cell crosstalk which actively induces FRC protrusions – an essential component of lymph node remodelling – to maintain tissue integrity during an adaptive immune response.

Biological sciences/Immunology/Imaging the immune system

Biological sciences/Immunology/Lymphoid tissues

Tissue structure and topology correspond to the purpose and function of that tissue. Mechanisms of communication and feedback between cells maintain tight control of tissue homeostasis. Conversely, in disease, tissue structure and cellular function is disrupted. To understand complex, dynamic, physiological processes, we need to understand cellular and molecular mechanisms of crosstalk between diverse cell types.

Immune responses are facilitated by secondary lymphoid tissues such as the lymph nodes, spleen and Peyer’s patches. These tissues share structural similarities and functions to guide and compartmentalise immune cell populations, while simultaneously filtering fluids and capturing antigens¹. The tissue structures are constructed of stromal cells including blood vessels, lymphatic vessels and immunoregulatory fibroblasts termed fibroblastic reticular cells (FRCs). FRCs form intricate interconnected networks connecting the tissue parenchyma to both the lymphatic sinuses and the high endothelial venules and serve as a key cellular highway for immune cell trafficking^2,3. Further, FRCs adhere to and ensheathe a network of extracellular matrix fibres known as the conduit system which functions to control the flow of soluble molecules through the tissue. FRCs are also the predominant source of vital chemokines and growth factors for lymphocytes^4,5 and play an active role in tempering immune cell activation^6,7. FRCs are critical for secondary lymphoid organ function as shown in vivo by studies deleting FRCs using a Fap^DTR mouse model. Lymph nodes lacking FRCs rapidly lost B cells, T cells and dendritic cells from the tissues and significantly decreased the magnitude of immune responses⁸. Exploring stromal/immune crosstalk in lymphoid tissues has been necessary to widen our understanding of immune function in a systemic, physiological context.

Beyond the steady state, we also need to ask how lymphoid tissues, and the stromal cells which support their function, adapt and reversibly remodel through cycles of immune activation and rapid tissue expansion. It is clear that the intricate stromal structures do have the capability to swiftly reshape the network since the FRC network remains connected with robust topology as the tissue expands^9–11. It is also clear that interactions between immune cells and stromal cells are key to triggering tissue remodelling^9,10,12. In the acute phase of tissue expansion, the FRCs are stretched by increasing numbers of lymphocytes and elongate to maintain network cohesion^9,10. It is recently revealed that the growth of the stromal network through FRC proliferation is controlled through mechanical cues, thereby matching stromal cell numbers to the increased force exerted by proliferating lymphocytes and the ratio of stromal cells to lymphocytes remains consistently balanced¹³. The extracellular matrix structures being non-living material are initially disrupted due to the mechanical load¹⁴, but are readily restored to their homeostatic state later in the tissue remodelling process. But despite these studies, there is still much we do not understand about how this sophisticated network of individual fibroblasts succeeds in maintaining tissue structure and function through immune challenge.

Here we investigate how individual fibroblasts respond to the changing structural needs of a lymph node through immune challenge. We asked how neighbouring fibroblasts physically connect with one another, and what cellular and molecular mechanisms determine network connectivity within the expanding stromal cell network.

Morphological adaptation of FRCs during acute lymph node expansion

It is known that the spaces between fibroblastic reticular network fibres, and the distances between FRC nuclei are both increased during the acute phase of lymph node expansion^9,15 and that FRC proliferation lags behind lymphocyte proliferation in these early phases^12,16,17 since FRC proliferation is triggered by increased tissue tension¹³. It is reported by our group and others that FRC size increases following immunization^9,16, however it is unknown how the morphology of individual FRCs adapts during tissue expansion while maintaining network integrity. We asked whether the morphology of FRCs changed in response to immune challenge and whether this determines how FRCs form and maintain an interconnected cellular network through lymph node expansion. To fluorescently label individual FRCs within the intact FRC network in lymph node tissue, we induced sporadic Cre-recombinase activation in Pdgfra^{mGFP−CreERT2} mice using low doses of tamoxifen to express the R26R-Confetti conditional allele (Pdgfra^{iR26R−Confetti}). We used this model system to quantify morphological parameters of individual FRCs in steady state and following immunization (Fig. 1A). Lymph node sections from Pdgfra^{iR26R−Confetti} mice showed PDPN⁺RFP⁺ and PDPN⁺YFP⁺ FRCs integrated with the rest of the FRC network which is constitutively labelled with membrane-targeted EGFP (Fig. 1B). We could now observe that the FRC cell body did not lie along the length of the conduit network as often depicted diagrammatically. Rather, the FRC cell body was situated as a node at a junction in the network and protrusions extended in multiple directions along the conduit network (Fig. 1B-C). This topology was maintained in immunized lymph nodes (Fig. 1C). We used cell surface rendering and automated image analysis to quantify changes to morphological parameters of FRCs following immunization. During acute lymph node expansion, we found that the sphericity of FRCs was reduced (Fig. 1D) and cell volume was increased (Fig. 1E), meaning that the tissue volume spanned by one FRC (measured by bounding box volume) was more than doubled (Fig. 1F). Interestingly, in addition to each cell increasing in size and spreading, FRCs in immunized lymph nodes also made a larger number of protrusions (Fig. 1G). We could observe that FRCs were extensively branched by day 5 after immunisation (Fig. 1C, 1H). Protrusions extending from the cell body would commonly split and often ended in a ‘foot-like’ structure when meeting a neighbouring FRC in the network (Fig. 1C, 1H). We also observed protrusions that did not follow the physical guide of the underlying ECM (Fig. 1H). Thus, we show that FRCs undergo extensive morphological adaptation that we predict is important for maintaining FRC-FRC connections and network integrity through lymph node expansion.

CLEC-2/podoplanin signalling promotes membrane translocation of MARCKS in FRCs

We next sought to determine the molecular signalling pathways that controlled protrusion formation in FRCs in the early phases of lymph node expansion. A key signalling pathway for lymph node tissue remodelling is the binding between CLEC-2 and podoplanin which occurs as CLEC-2^hi antigen-presenting dendritic cells (DCs) migrate to lymph nodes following activation^3,9,11,13. This cellular crosstalk reduces actomyosin contractility through the FRC network permitting rapid lymph node expansion^9,11,18, but cannot fully explain how structural integrity is maintained. We asked whether additional signalling pathways downstream of CLEC-2/podoplanin might drive formation of the extensive protrusions we observed in early lymph node expansion (Fig. 1). We analysed published phospho-proteomics data (tandem mass tag mass spectrometry (TMT-MS)) of FRCs¹¹ (Fig. 2A) and compared changes to signalling cascades following 15 minutes of treatment with recombinant CLEC-2-Fc. As we have previously reported, CLEC-2 induces rapid and transient signalling responses in FRCs^9,11,18. We focused on targets linked to actin polymerization and crosslinking relevant to protrusion formation and found significantly reduced phosphorylation of Myristoylated Alanine Rich C-Kinase Substrate (MARCKS). All identified MARCKS peptides showed reduced phosphorylation, and phosphorylation of S163 located in the effector domain was most significantly affected (Fig. 2B-C). MARCKS is an F-actin crosslinker reported to play important roles in the formation of branched protrusions during neuritogenesis^19–22. We therefore asked whether FRCs use MARCKS for similar functions in lymphoid tissue driving cell extensions to maintain FRC network integrity as the lymph node expands. Firstly, we validated the phospho-proteomics data using Western blotting. We confirmed that phosphorylated (p)MARCKS (S159/163) levels are reduced in FRCs responding to CLEC-2 (Fig. 2C). Importantly, we also showed that CLEC-2 was unable to regulate pMARCKS (S159/163) in FRCs where podoplanin (PDPN) had been knocked down using shRNA (PDPN KD) or knocked out using CRISPR/Cas9 (PDPN KO) (Fig. 2C), confirming that MARCKS regulation is dependent on CLEC-2/podoplanin engagement. Further, steady state levels of pMARCKS were considerably higher in resting FRCs with reduced or completely lacking podoplanin expression (Fig. 2C). MARCKS localization in the cell is determined by phosphorylation in the effector domain; pMARCKS is restricted to the cytosol while unphosphorylated MARCKS binds to the plasma membrane²³. Using live imaging of GFP-MARCKS in combination with a membrane labelling dye, we confirmed that CLEC-2 treatment of FRCs caused relocation of MARCKS to the plasma membrane as would be predicted from the phosphorylation data (Fig. 2D-E). To determine whether regulation of MARCKS occurred in FRCs in vivo in response to the arrival of CLEC-2^hi antigen-presenting DCs, we quantified pMARCKS levels in the FRC network using segmentation of podoplanin-positive regions. We found that levels of pMARCKS were indeed reduced in the FRC network 3 days following immunization (Fig. 2F-G). Having validated that MARCKS was regulated by podoplanin/CLEC-2 signalling and that dephosphorylation of MARCKS correlates with the early phases of lymph node expansion as FRCs begin to alter their morphology within the network, we next tested if MARCKS regulation was required for FRCs to generate protrusions.

MARCKS regulation is required for FRC morphological adaptation in response to DCs

To test the role of MARCKS in FRCs directly, we generated MARCKS knockout (KO) FRC cell lines. Genetic deletion in single cell clones was confirmed by qPCR (Fig. S1A, Fig. 3A). The pan-PKC activator Phorbol 12-myristate 13-acetate (PMA) confirmed that MARCKS phosphorylation could not be detected in MARCKS KO cell lines (Fig. S1B, Fig. 3B). Next, we examined morphology index and F-actin intensity of FRCs as a quantitative measure of their response to DCs. Control FRCs increase their area and perimeter resulting a higher morphology index when in contact with DCs while F-actin intensity is reduced^18,24. We compared control versus MARCKS KO FRCs in steady state and observed no clear differences in cell morphology, cell size nor F-actin intensity (Fig. 3C-E). Rescue of MARCKS expression in MARCKS KO FRCs using GFP-tagged WT MARCKS also made no measurable difference to FRC morphology nor cytoskeletal organization in steady state (Fig. 3C-E). However, when FRCs were co-cultured with DCs, MARCKS KO FRCs were unable to form lamellipodial protrusions upon FRC-DC contact (Fig. 3C, 3F). Protrusion formation by FRCs in response to DC contact was MARCKS-dependent since over-expression of GFP-tagged WT MARCKS was sufficient to rescue lamellipodia formation (Fig. 3C, 3F). In contrast, downregulation of F-actin intensity in FRCs upon contact with DCs was unaffected in MARCKS KO FRCs which suggests that MARCKS specifically regulates protrusion formation in FRCs and is not involved in signalling pathways regulating actomyosin contractility.

Constitutively cytosolic MARCKS (Fig. S2, S3) failed to rescue cell morphological adaptation and lamellipodia formation upon FRC-DC contact indicating that MARCKS required membrane localization to induce protrusions (Fig. S3). Indeed, a constitutively membrane-bound MARCKS (Fig. S2) restored protrusion formation confirming that membrane-bound MARCKS facilitates protrusion formation in response to contact with DCs (Fig. S3). To differentiate between FRC failure to form or to sustain lamellipodial protrusion, we examined the responses of control versus MARCKS KO FRCs to DCs using live imaging (Fig. 3G, Supplementary movies 1 and 2). While control FRCs gradually and progressively spread via lamellipodia at their poles, MARCKS KO FRCs rapidly extended and retracted protrusions, including some collapsing lamellipodia (Fig. 3H-I). We quantified changes in FRC morphology index during the first 15 minutes following DC contact and found that control FRCs steadily spread (Fig. 3H-I) whereas MARCKS KO FRCs exhibited erratic morphological changes (Fig. 3H-I). Therefore, we conclude that while both control and MARCKS KO FRC can respond to DC by starting to spread (as indicated by the increased morphology index), the MARCKS KO FRCs are unable to form stable lamellipodial protrusions.

Membrane localization of MARCKS is sufficient to induce protrusions in FRCs

We have previously reported that FRCs require expression of membrane protein CD44 to interact with DCs and form broad lamellipodial protrusions in 2D culture conditions¹⁸. We have also recently reported that CD44 is required for the molecular clustering of podoplanin induced by CLEC-2 binding²⁵. CD44 is a membrane binding partner of podoplanin^26,27 and may regulate signalling downstream of CLEC-2/podoplanin engagement^13,18, but the signalling mechanisms are not fully understood. Having now revealed that MARCKS regulates protrusion formation through its phosphorylation status and membrane-localisation, we sought to determine whether CD44 expression in FRCs impacted MARCKS regulation. We stimulated FRCs in vitro with recombinant CLEC-2-Fc protein to mimic the signalling between FRCs and DCs. As expected, MARCKS phosphorylation was downregulated in response to CLEC-2 in control FRCs, but PDPN KO FRCs were unable to regulate MARCKS (Fig. 4A). Interestingly, CD44 KO FRCs showed lower steady state levels of MARCKS phosphorylation and were unresponsive to CLEC-2 treatment (Fig. 4A). These data indicate that MARCKS dephosphorylation downstream of CLEC-2/podoplanin signalling is also dependent on CD44. Immunofluorescence confirmed our previous findings¹⁸ that CD44 KO FRCs do not form protrusions in response to DC contact (Fig. 4B-C). However, when transfected to overexpress membrane-localised MARCKS (AS MARCKS), CD44 KO FRCs exhibited lamellipodia both in steady state and in response to DCs (Fig. 4B-C) indicating that MARCKS functions downstream of CD44. CD44 KO FRCs showed no change in morphology upon DC contact (Fig. 4D). Over-expression of membrane-localised MARCKS (AS MARCKS) in CD44 KO FRCs increased morphology index relative to control FRCs in both steady state and in response to DCs (Fig. 4D). Interestingly, CD44 KO FRCs exhibited an equivalent decrease in F-actin intensity to control FRCs although there was no lamellipodia formation and increase in morphology index (Fig. 4C-D). Overexpression of membrane-localised MARCKS (AS mutant) actually increased F-actin intensity following contact with DCs (Fig. 4E), providing further evidence that MARCKS specifically regulates protrusion formation in FRCs and is not involved in the downregulation of actomyosin contractility seen in control FRCs (Fig. 4E). These results confirm that protrusion formation and inhibition of actomyosin contractility in FRCs are driven by distinct signalling pathways but that both pathways are triggered by CLEC-2/podoplanin engagement.

PKN2 regulates FRC network integrity following immune challenge via regulation of MARCKS phosphorylation

We next asked which kinase regulated MARCKS in FRCs. We compared pMARCKS levels in FRCs treated with a set of pharmacological inhibitors in vitro (Fig. 5A-B). pMARCKS levels were reduced in FRCs treated with a pan-PKC inhibitor (Go 6983) as expected, since MARCKS is reported to be a PKC target^22,28,29. Targeting actomyosin contractility pathways directly through inhibition of myosin light chain kinase (MLCK) using ML7 or blebbistatin had little or no effect on pMARCKS which confirmed that MARCKS regulation is independent of actomyosin contractility (Fig. 5A-B). However, inhibition of Rho-kinase using two different inhibitors gave two different results. Inhibition with the Rho-kinase inhibitor Y27632 exhibited an inhibitory effect on MARCKS phosphorylation comparable to PKC inhibition (Fig. 5A-B). In contrast, inhibition with the Rho Kinase inhibitor H1152 had little to no effect on MARCKS phosphorylation, leading us to conclude that Rho kinase could not be responsible for MARCKS phosphorylation in FRCs. To investigate further, we examined published kinase activity data (https://www.kinase-screen.mrc.ac.uk/kinase-inhibitors) to search for an off-target kinase inhibited by Y27632 but that was not affected by H1152. These data revealed that 10 µM Y27632 but not H1152 inhibited PKN2 very strongly (> 95%) (Fig. 5C-D). Y27632 has also been reported to directly PKN1 and PKN2 as confirmed by competitive substrate binding assays³⁰. Since the PKC family has expanded into subgroups including the Rho family-responsive PKN kinases³¹, we hypothesized that PKN2 might be the kinase responsible for MARCKS regulation in FRCs. Examination of scRNAseq data from lymph nodes⁵ confirmed that PKN2 was expressed by all T-zone reticular cell subsets (collectively called FRCs), therefore validating PKN2 as a potential target in vivo. If PKN2 regulates MARCKS downstream of RhoA/C in FRCs then we predict that contact with CLEC-2⁺ DCs will have a dual effect on FRC morphology. Firstly, a relaxation of actomyosin contractility, and secondly, in parallel, an induction of protrusion formation through MARCKS activity at the plasma membrane – both as a consequence of reduced RhoA/C activity in FRCs. We hypothesize that this mechanism is important to maintain FRC-FRC contact and fibroblastic reticular network integrity through lymph node expansion in vivo.

To directly test whether PKN2 regulates MARCKS in the FRC network in vivo, we firstly compared lymph nodes in steady state and following immune challenge from control (Rosa26^Cre) or PKN2 KO mice (Rosa^ind.∆PKN2). Cre recombination and therefore PKN2 deletion was confirmed by genotyping as well as imaging of GFP signal indicating conversion of dTomato to EGFP using the mT/mG reporter (Fig. S4). We hypothesise that MARCKS regulation is required for the adaptation of FRC morphology during lymph node expansion, and that PKN2 is the key regulator of MARCKS in FRCs in vivo. Therefore, we predict changes to lymph node size and fibroblastic reticular network structure specifically following immune challenge, when DCs arrive in lymph nodes to prime the fibroblastic reticular network for expansion. Indeed, PKN2 KO lymph nodes were comparable in size to controls in steady state (Fig. 5E). However, following immunization PKN2 KO lymph nodes were significantly larger than controls (Fig. 5E). These data suggest that PKN2 is not required for lymph node expansion and may even enhance the rate of expansion.

Upon closer examination of the lymph node structure, we observed that the FRC network in the immunized, larger lymph nodes of the PKN2 KO mice was disrupted and some rounded up FRCs were observed that had become disconnected from their neighbouring FRCs (Fig. 6A). This resulted in a fragmented FRC network with shorter branch lengths (Fig. 6B). To confirm that this breakage of the FRC network was indeed linked to dysregulation of MARCKS in PKN2 KO mice, we quantified pMARCKS in lymph node tissue sections (Fig. 6C-E). Examining individual cells, we quantified specific loss of pMARCKS staining in the FRCs, but pMARCKS levels in blood vessel structures remained high (Fig. 6C-D), suggesting that in endothelial cells MARCKS is phosphorylated by a different PKC family kinase. We also quantified pMARCKS levels across larger tissue areas in FRCs, masking images using podoplanin staining, and found that pMARCKS levels in control FRCs were reduced by around 50% following immunization (Fig. 6E) as we had seen previously (Fig. 2G-H). In PKN2 KO mice, pMARCKS levels were lower in steady state, but importantly remained low following immunization meaning that PKN2 KO FRCs had lost the ability to regulate MARCKS in vivo. These data confirm that PKN2 is required for FRCs to regulate MARCKS in vivo, and that failure to regulate MARCKS in PKN2 KO results in rapid lymph node expansion which damages and disrupts the fibroblastic reticular network.

Immune cell function and communication in secondary lymphoid tissues, such as lymph nodes, is facilitated by stromal cell networks formed of interconnected FRCs. This stromal network adapts and remodels as lymph nodes swell to accommodate activated and proliferating lymphocytes, importantly maintaining the integrity of the FRC network as the tissue expands. Our accepted understanding of FRC network adaptation during lymph node expansion has been of a contractile scaffold with CLEC-2⁺ DCs triggering relaxation of the FRC actomyosin cytoskeleton as a mechanism to permit stretching, rather than actively drive lymph node expansion^9,10. However, we now present a mechanism driving FRC protrusions which indicates that FRCs are also actively adapting their morphology in response to DCs. The FRC network stretching model is supported by our finding that FRCs elongate in three dimensions, which is likely to be caused by the expansion forces from trapped and proliferating T-cell populations^8,13,16. We propose that a coordinated combination of passive FRC stretching and active protrusion formation are at play in the expanding lymph node.

Here we show that genetic deletion of PKN2 caused the FRC network to fragment during the acute phases of lymph node expansion. We observed that FRCs in reactive PKN2^−/− lymph nodes were rounded up and severed from the network or only partially connected to neighbouring FRCs by fine spindly extensions. Disruption of the FRC network in reactive PKN2^−/− lymph nodes allowed the tissue to expand to a greater degree than control lymph nodes. This suggests that connection between FRCs constrains tissue size during lymph node expansion. Previous mechanical studies of the lymph node have shown that the capsule limits tissue size¹⁴, and we now propose that the internal stromal networks also contribute to attenuating and controlling tissue expansion. We have previously shown that stromal network structure and increasing tissue tension through the FRCs is the necessary mechanical trigger for FRCs to exit a quiescent state, enter the cell cycle and start to proliferate¹³. Since PKN2 is required to maintain the network structure during lymph node expansion and withstand higher tissue tension, we would also predict that PKN2 activity, or lack of activity, would indirectly impact FRC proliferation.

We present a molecular mechanism whereby signalling between podoplanin⁺ FRCs and CLEC-2⁺ myeloid cells coordinates simultaneous changes in both FRC contractility and protrusion formation through regulation of RhoA/C activity. In steady state, the FRC network is contractile and under tension^13,14 and RhoA/C activity is high, maintained via GEFH1⁹. Upon binding to CLEC-2, podoplanin molecules form large clusters in cholesterol rich areas of the membrane with CD44^9,18,25, disengage from Ezrin, causing reduced cortical tension¹³ and a rapid reduction in RhoA/C activity⁹. Both ROCK1 and PKN2 are RhoA/C effector kinases; therefore in steady state the activity of both ROCK1 and PKN2 is high. We find that in FRCs, PKN2 regulates the phosphorylation and localisation of MARCKS, an actin binding protein and key regulator of cell morphology and migration in other cell types^32,33. High RhoA/C activity and therefore high PKN2 activity phosphorylates MARCKS which inactivates and constrains MARCKS in the cytoplasm, meaning that in steady state FRCs are not actively making protrusions. In contrast, during the acute phase of an immune response, we demonstrate that MARCKS phosphorylation in FRCs is regulated by the CLEC-2/podoplanin pathway in vitro and within the lymph node tissue, allowing MARCKS to localise to the plasma membrane to induce protrusions.

MARCKS is a substrate of PKC family kinases^28,34,35, but this is the first study proposing a role for PKN2 in phosphorylating MARCKS in a cellular system. MARCKS has clear roles in neurones controlling dendritic spine formation and maintenance, and MARCKS activity is required for normal brain development^20,21. The branching protrusions formed by FRCs are somewhat reminiscent of dendritic spine branching of neurons³⁶, though FRC protrusions are broader and branches are fewer. At the plasma membrane, MARCKS binds to and sequesters PI(4,5)P₂ and facilitates F-actin crosslinking required for generating protrusions. In many systems, MARCKS is required to bind and unbind PI(4,5)P₂, releasing the phospholipid for downstream signalling^37–39. This is likely also true in FRCs and is consistent with the CLEC-2 signal being transient, as loss of CLEC-2⁺ DCs from the lymph node would facilitate MARCKS returning to the cytosol and a more contractile FRC state being restored.

The mechanisms outlined here may also be relevant to stromal function in non-lymphoid tissues. Podoplanin is reported to be upregulated in various tissues in inflammation or following injury^40–42. Indeed, many cancer-associated fibroblast subsets identified are podoplanin-positive⁴³, and stroma associated with tertiary or ectopic lymphoid structures is also reported to be podoplanin-positive⁴⁴. There are also many potential sources of CLEC-2 on both platelets and myeloid cells⁴⁰. It is therefore possible that the podoplanin/CLEC-2 signalling axis could regulate contractility and protrusion formation in inflammatory fibroblasts through PKN2 and MARCKS. PKN2 has been shown to regulate the conversion between inflammatory CAFs and myofibroblasts in pancreatic ductal adenocarcinoma (PDAC), and PKN2 deletion in pancreatic stromal cells reduced CAF contractility and altered matrix production which caused tumours to become more invasive⁴⁵. Similarly, MARCKS has been associated with increased fibroblast migration⁴⁶ and linked with CAF activation in metastatic ovarian cancer⁴⁷. A later study reported that MARCKS phosphorylation is associated with fibrosis in idiopathic pulmonary fibrosis fibroblasts⁴⁸. The work presented here now links stromal/immune crosstalk through the podoplanin/CLEC-2 signalling axis with coordinated regulation of both contractility and protrusion formation through PKN2 and MARCKS. This pathway is critical for maintaining FRC network integrity in lymph nodes, but may also be important to understand how stromal cells respond to immune cells in other inflammatory contexts.

Acknowledgements

This work was supported by a European Research Council Starting Grant (LNEXPANDS; to S.E.A.), a Cancer Research UK Careers Development Fellowship (CRUK-A19763; to S.E.A.), the Medical Research Council (MC-U12266B). H.L.H is supported by an EMBO Postdoctoral Fellowship ALTF 776-2022. C.J.T. is supported by a Sir Henry Wellcome Fellowship (098847/Z/12/Z), UKRI Medical Research Council (MR/T028270/1), Cancer Research UK (DRCPFA-May23/100003), the Cancer Research UK City of London Centre (C7893/A26233), and the UCLH Biomedical Research Centre (BRC422). P.J.S. is supported by the Human Frontier Science Program (Grant No. RGP0032/2022), and the Deutsche Forschungsgemeinschaft project ID 335447717 – SFB13228 - Project A20. A.J.M.C. and S.M. were supported by Cancer Research UK Centre Grants to Barts Cancer Institute (C355/A25137) and the City of London Centre (C7893/A26233), and a Barts Charity Seed Award (G-002098). C.M.d.W. is supported by the Dutch Research Foundation (Nederlandse Organisatie voor Wetenschappelijk Onderzoek, NWO) Rubicon Postdoctoral Fellowship (019.162LW.004) and the Dutch Cancer Foundation (KWF; Young Investigator Grant no. 2022-4 EXPL/14641).

Contributions

L.J.M., C.M.d.W and S.E.A designed the study and wrote the manuscript. L.J.M. performed and analyzed the majority of the experiments. A.C.B. and S.E.A. generated the PDGFRα-mGFP-CreERT2 mouse model. S.M. and H.L.H assisted with in vivo experiments. S.M. and A.C. generated and validated PKN2 KO mice for use in the study and provided expertise on PKN2 function and inhibitors. D.S. undertook imaging analysis for quantification of lymph node FRC network integrity. C.J.T. generated phosphoproteomics data to identify MARCKS downstream of CLEC-2 stimulation. P.J.S. provided expertise to quantify membrane dynamics in live cell imaging. A.C. contributed to the study design and writing of the manuscript. All authors contributed to editing the manuscript.

PDGFRa-mEGFP-CreERT2 x Rosa26-CAG-Brainbow2.1/Confetti mice (Pdgfraⁱ^{R26R-Confetti})

PDGFRα-mEGFP-CreERT2 mice are heterozygous for membrane EGFP (N-terminal 0-20 amino acids of neuromodulin GAP-43) under their PDGFRα promotor, alongside a CreERT2 cassette, linked to EGFP with a P2A self-cleavage site^13,49. Rosa26-CAG-Brainbow2.1/Confetti mice express the Brainbow 2.1 cassette from their Rosa26 locus under a strong CAGG promotor, facilitating stochastic combinatorial expression of four fluorescent reporter proteins controlled by the cre-lox system^50,51. Breeding was performed by Charles River, to produce heterozygous PDGFRa-mEGFP-CreERT2 x Rosa26-CAG-Brainbow2.1/Confetti mice (Pdgfraⁱ^{R26R-Confetti} mice).

PKN2fl/fl x ROSACreERT2/WT x ROSAmT/mG mice (Rosa26^ind.^∆^Pkn2)

PKN2 fl/fl x ROSACreERT2/WT x ROSAmTmG mice and PKN2 WT/WT ROSACreERT2/WT x ROSAmTmG controls, named Rosa26^ind.^∆^Pkn2 mice and cre-only controls, were gifted by Dr Angus Cameron, Queen Mary University London⁵². PKN2 genes of PKN2 fl/fl mice contain a loxP site at the start of PKN2 exon 7 and a second loxP site inside intron 8, a region which encodes the PKN2 N-terminal regulatory region, disrupting PKN2 gene function following tamoxifen induction.

Mouse Breeding and Husbandry

Mouse breeding was carried out by Charles River. Mice were ordered when 6-8 weeks old, and were quarantined in the UCL central biological services unit (BSU) for 1 week before use. During and following this period, all husbandry was performed by UCL central BSU staff. Experiments were performed immediately following acclimatisation. A mixture of male and female mice were used. Mice were housed in pathogen-free conditions. All animal experiments were reviewed and approved by the Animal and Ethical Review Board (AWERB) within University College London and approved by the UK home office in accordance with the Animals (Scientific Procedures) Act 1986 and the ARRIVE guidelines.

Subcutaneous IFA/OVA immunization

Mice were shaved on their right flank, then injected at the shaved site with 100μl of IFA/OVA emulsion, subcutaneously using a 27G needle. Immunisation drained into their right inguinal LN, and left inguinal LN was used as a control (non-draining). Mice were weighed before immunisation.

Intraperitoneal tamoxifen injection

Mice were injected with tamoxifen reconstituted at 22mg/ml in corn oil at 2mg/20g body weight, intraperitoneally using a 27G needle. Number of injections varied per experiment – 3/5 days consecutively. The side of their intraperitoneal cavity was alternated each day to avoid irritation. Mice were weighed before and after tamoxifen administration.

Lymph node harvesting and sectioning

Mice were sacrificed using the ASPA Schedule 1 approved method of exposure to a rising concentration of CO₂ with a flow rate of 3l/min for 5 minutes followed by confirmation of cervical dislocation. Lymph nodes (LNs) were harvested by dissection and fixed using antigen fix. For vibratome sectioning, LNs were mounted in 3% ultra-pure low melting point agarose in PBS, allowed to solidify then transferred to the vibratome mounting tray in ice-cold PBS. Slices of 100μm were produced. Approximately 10-15 sections were obtained per LN; the first or last 2-3 sections of the LN were not imaged as these are expected to consist of mainly B-cell follicles. For cryosectioning, tissues were fixed in antigen fix for 6-8 hrs at 4^oC. Tissues were washed twice in PBS, then dehydrated overnight at 4^oC in 30% sucrose with 0.01% sodium azide. Tissues were incubated in a solution of 50% OCT (Tissue-Tek, 62550-12) with 50% sucrose for 1hr at RT. Moulds were labelled then half filled with OCT, then LNs were arranged into desired position in mould. LNs were covered with OCT, then snap frozen on dry ice for approximately 20 mins. Mounts were stored at -80^oC until ready to section. 10-20μm cryostat (Leica) sections were produced laterally in the horizonal plane of mounted LNs. Sections were stored at -20^oC until ready to carry out immunofluorescence staining.

Cell culturing

All experiments were performed in a background strain of immortalised murine fibroblastic reticular cell lines (FRCs), as previously described⁹. Experiments reported here were performed using published cell lines: PDPN shRNA KO and PDPN KO FRCs⁹, CLEC-2-Fc FRCs (FRCs secreting CLEC-2 immobilised on a Rabbit Fc receptor¹¹), and CD44 and CD9 KO FRCs¹⁸. Additionally, novel MARCKS-GFP FRCs and MARCKS KO FRCs were produced in this study. All FRC lines are grown at 37^oC, 10% CO₂, in cell culture-treated dishes, in FRC media (DMEM plus glutamax (Thermo Fisher Scientific, 31331028), 10% FBS (Sigma, F9665), 1% Penicillin/Streptomycin (100 units/ml, Thermo Fisher Scientific, 15140122) and 1% Insulin-Transferrin-Selenium (Thermo Fisher Scientific, 11875093)). FRCs are harvested by incubation in prewarmed 2mM EDTA/DPBS for 5 min at 37^oC, 10% CO₂, followed by incubation in 0.25% Trypsin (Thermo Fisher Scientific, 15090046) for 1 min, before quenching in prewarmed FRC media and plating. FRCs were passaged for a maximum of 2 months.

MARCKS-GFP stable FRC cell line production

FRCs were transfected using Attractene transfection reagent (Qiagen, 3001005) according to manufacturer’s instructions, then harvested after 48hrs. FRCs were washed once in FACS sorting buffer (1% FBS, 1mM EDTA, 25mM HEPES, diluted in DPBS) then resuspended to a concentration of 10-20x10⁶ cells/ml. GFP⁺ FRCs were sorted at the UCL Cancer Institute using a BD Aria III. Three rounds of transfection and sorting were carried out, with the same gating used for all cell lines to only obtain highly GFP⁺ FRCs.

CRISPR-Cas9 MARCKS disruption

CRISPR gene editing was carried out by introducing a piggyBac vector for efficient insertion of the plasmid into the host genome, encoding hCas9, two guide RNAs specific for mouse MARCKS, and a blasticidin resistance cassette (see Table 6). The same plasmid encoding one non-targeting gRNA was transfected as a control. FRCs of WT, PDPN shRNA KD and CLEC-2-Fc backgrounds were plated to 80% confluency and co-transfected using attractene (2.2.3) with the pPB[2CRISPR]-Bsd-hCas9-U6>{benchling 1}-U6>mMarcks[gRNA#427] or pPB[CRISPR]-Bsd-hCas9- U6>Scramble_gRNA1 and a plasmid encoding the PiggyBac PBase enzyme (see Table 6, Figure 2.2.2). 24 hrs post transfection, media was changed and blasticidin (Invivogen, ant-bl) was added at 10μg/ml in FRC complete media. Following approximately 10 days of growth, polyclonal cell lines from each of the 3 FRC backgrounds were harvested. Single cell cloning was carried out from these polyclonal cell lines. Polyclonal cell lines were seeded in 96-well plates at an average of 1 cell/ 2 wells, to ensure colony growth is from a single cell. ~20 colonies were harvested per cell line, which were screened initially using PCR of a crude lysate, then selected colonies were screened for MARCKS RNA levels by qPCR and protein level by western blot.
Two-dimensional FRC-BMDC co-culture

Bone marrow is isolated from tibias and femurs from WT C57BL/6 mice at 6.5 weeks old by flushing with RPMI media. Bone marrow-derived dendritic cells (BMDCs) are derived using recombinant murine GM-CSF as previously described in BMDC media (RPMI media (Thermo Fisher Scientific, 11875093), 10% FBS, 1% Penicillin/Streptomycin, 50μM b-mercaptoethanol (Thermo Fisher Scientific, 31350010))⁵³. CLEC-2 expression was stimulated by addition of lipopolysaccharides from Escherichia coli (Sigma, L4391) to a final concentration of 10ng/ml⁵⁴. For co-culturing, a collagen-matrigel gel was produced on ice by combining per well of 24-well plate: 100μl Rat Tail Collagen I (Thermo Fisher Scientific, CB354249), 25μl 5x alphaMEM media (Thermo Fisher Scientific, 12000063), 50μl Matrigel (Corning, 734-0269), 25μl FBS and 50μl BMDC medium and 20ng/ml GM-CSF containing 2.5x10⁵ BMDCs (or media alone for controls). Media was removed from wells containing FRCs grown in a two-dimensional monolayer in a MatTek plate, to ~50% confluency. 150μl gel mix was distributed on top of FRCs following media aspiration, then after 30 minutes at 37^oC, 10% CO₂ for gel setting, FRC media was added to wells. FRC-DC co-culture was incubated for 24hrs at 37^oC, 10% CO₂ prior to fixation.

Confocal Microscopy

Confocal imaging was carried out using a Leica TCS SP5 confocal microscope, using 63X or 40X HCX PL APO lenses, with a pinhole of 1 airy unit. For fixed imaging, Z-stacks were taken with intervals of 0.5μm. For timelapse confocal microscopy, cells were seeded 24hrs ahead of imaging in 35mm MATTEK dishes at 50% confluency. For FRC-DC live imaging, 150μl labelled DCs were added at concentration 1x10⁶ cells/ml prior to image acquisition. Cells were imaged using Leica TCS SP5 confocal microscope as before, using a heated platform set at 37^oC (tempcontrol 37-2 digital) and a CO₂ chamber set at 10% CO₂ (CTI-controller 3700 digital). Frames were taken 10s apart for approximately 100 frames (~16 mins).

Multiphoton microscopy

The LSM 880 Multiphoton microscope with 63x oil objective with Zeiss Immersol 518F oil was used, using Zeiss Zen Black software. A Ti:Sapphire (multiphoton) laser emits two photons of long wavelength (900nm used). Photons combine in energy, to elevate fluorophores of lower wavelength to their excited state. The multiphoton laser also facilitates label-free detection of LN conduit ECM structures using second harmonic generation microscopy. Images were acquired using lambda mode, using the chameleon laser at 900μm to acquire images in 34 channels to be separated into individual channels by spectral unmixing on the same software. The pinhole was opened to acquire widefield images, and z-stack intervals of 0.5μm were obtained, for an approximate thickness of 30-60μm.

Linear unmixing

34-channel images obtained using LSM 880 multiphoton were processed using Zeiss zen black linear unmixing to separate channels, as YFP, GFP and CFP fluorophores are spectrally very close. Emission wavelengths for each fluorophore were set on Zeiss Zen Black software spectral unmixing function by selecting labelled cells within the confetti imaging. The correct fluorophore was assigned according to known wavelengths of each fluorophore in prior confetti labelling. The 2^nd harmonic of the multiphoton laser detected the ECM conduit structure in the LN, and this was chosen as a channel, in addition to GFP, CFP and YFP.

Analysis

Confocal image analysis was carried out using Image J software. To determine MARCKS intensity within PDPN⁺ FRCs, an Image J analysis pipeline developed by Dr Harry Horsnell was used¹³. All statistical analysis was carried out using GraphPad Prism. Shapiro-Wilk normality test was performed and if normality was not achieved, non-parametric analyses were used. For column analysis of 2 conditions, t-tests or Mann-Whitney tests were carried out for normally distributed and not normally distributed datasets respectively. For 3 or more conditions, one-way ANOVA or Kruskal Wallis tests were used. Two-way ANOVA was used in all co-culture experiments, as the two variables analysed were DC contact and impact of gene KO/transfection. Dunn’s multiple comparisons were carried out following Kruskal-Wallis, and Tukey’s multiple comparisons were carried out following two-way ANOVA. Holm-Sidak’s multiple comparisons were performed following one-way ANOVA.

Acton, S. E., Onder, L., Novkovic, M., Martinez, V. G. & Ludewig, B. Communication, construction, and fluid control: lymphoid organ fibroblastic reticular cell and conduit networks. Trends Immunol 42, 782–794 (2021).
Bajénoff, M., Glaichenhaus, N. & Germain, R. N. Fibroblastic reticular cells guide T lymphocyte entry into and migration within the splenic T cell zone. J Immunol 181, 3947–54 (2008).
Acton, S. E. et al. Podoplanin-rich stromal networks induce dendritic cell motility via activation of the C-type lectin receptor CLEC-2. Immunity 37, 276–89 (2012).
Malhotra, D. et al. Transcriptional profiling of stroma from inflamed and resting lymph nodes defines immunological hallmarks. Nat Immunol 13, 499–510 (2012).
Rodda, L. B. et al. Single-Cell RNA Sequencing of Lymph Node Stromal Cells Reveals Niche-Associated Heterogeneity. Immunity 48, 1014–1028.e6 (2018).
Link, A. et al. Fibroblastic reticular cells in lymph nodes regulate the homeostasis of naive T cells. Nat Immunol 8, 1255–1265 (2007).
Lukacs-Kornek, V. et al. Regulated release of nitric oxide by nonhematopoietic stroma controls expansion of the activated T cell pool in lymph nodes. Nat Immunol 12, 1096–1104 (2011).
Denton, A. E., Roberts, E. W., Linterman, M. A. & Fearon, D. T. Fibroblastic reticular cells of the lymph node are required for retention of resting but not activated CD8 ⁺ T cells. Proceedings of the National Academy of Sciences 111, 12139–12144 (2014).
Acton, S. E. et al. Dendritic cells control fibroblastic reticular network tension and lymph node expansion. Nature 514, 498–502 (2014).
Astarita, J. L. et al. The CLEC-2-podoplanin axis controls the contractility of fibroblastic reticular cells and lymph node microarchitecture. Nat Immunol 16, 75–84 (2015).
Martinez, V. G. et al. Fibroblastic Reticular Cells Control Conduit Matrix Deposition during Lymph Node Expansion. Cell Rep 29, 2810–2822.e5 (2019).
Chyou, S. et al. Coordinated regulation of lymph node vascular-stromal growth first by CD11c + cells and then by T and B cells. J Immunol 187, 5558–67 (2011).
Horsnell, H. L. et al. Lymph node homeostasis and adaptation to immune challenge resolved by fibroblast network mechanics. Nat Immunol 23, 1169–1182 (2022).
Assen, F. P. et al. Multitier mechanics control stromal adaptations in the swelling lymph node. Nat Immunol 23, 1246–1255 (2022).
Novkovic, M. et al. Topological Small-World Organization of the Fibroblastic Reticular Cell Network Determines Lymph Node Functionality. PLoS Biol 14, e1002515 (2016).
Yang, C.-Y. et al. Trapping of naive lymphocytes triggers rapid growth and remodeling of the fibroblast network in reactive murine lymph nodes. Proceedings of the National Academy of Sciences 111, E109-18 (2014).
Gregory, J. L. et al. Infection Programs Sustained Lymphoid Stromal Cell Responses and Shapes Lymph Node Remodeling upon Secondary Challenge. Cell Rep 18, 406–418 (2017).
de Winde, C. M. et al. Fibroblastic reticular cell response to dendritic cells requires coordinated activity of podoplanin, CD44 and CD9. J Cell Sci 134, jcs258610 (2021).
Hartwig, J. H. et al. MARCKS is an actin filament crosslinking protein regulated by protein kinase C and calcium-calmodulin. Nature 356, 618–22 (1992).
Stumpo, D. J., Bock, C. B., Tuttle, J. S. & Blackshear, P. J. MARCKS deficiency in mice leads to abnormal brain development and perinatal death. Proceedings of the National Academy of Sciences 92, 944–948 (1995).
Calabrese, B. & Halpain, S. Essential role for the PKC target MARCKS in maintaining dendritic spine morphology. Neuron 48, 77–90 (2005).
Gatlin, J. C., Estrada-Bernal, A., Sanford, S. D. & Pfenninger, K. H. Myristoylated, alanine-rich C-kinase substrate phosphorylation regulates growth cone adhesion and pathfinding. Mol Biol Cell 17, 5115–30 (2006).
Laux, T. et al. GAP43, MARCKS, and CAP23 modulate PI(4,5)P(2) at plasmalemmal rafts, and regulate cell cortex actin dynamics through a common mechanism. J Cell Biol 149, 1455–72 (2000).
de Winde, C. M. et al. C-type lectin-like receptor 2 (CLEC-2)-dependent DC migration is controlled by tetraspanin CD37. J Cell Sci 131, jcs214551 (2018).
Lim, S. E., Joseph, M. D., de Winde, C. M., Acton, S. E. & Simoncelli, S. Quantitative single molecule analysis of podoplanin clustering in fibroblastic reticular cells uncovers CD44 function. Open Biol 13, 220377 (2023).
Martín-Villar, E. et al. Podoplanin Associates with CD44 to Promote Directional Cell Migration. Mol Biol Cell 21, 4387–99 (2010).
Montero-Montero, L. et al. Interplay between Podoplanin, CD44s and CD44v in Squamous Carcinoma Cells. Cells 9, 2200 (2020).
Herget, T., Oehrlein, S. A., Pappin, D. J., Rozengurt, E. & Parker, P. J. The myristoylated alanine-rich C-kinase substrate (MARCKS) is sequentially phosphorylated by conventional, novel and atypical isotypes of protein kinase C. Eur J Biochem 233, 448–57 (1995).
Evans, J. H. & Falke, J. J. Ca2 + influx is an essential component of the positive-feedback loop that maintains leading-edge structure and activity in macrophages. Proc Natl Acad Sci U S A 104, 16176–81 (2007).
Falk, M. D. et al. Enzyme kinetics and distinct modulation of the protein kinase N family of kinases by lipid activators and small molecule inhibitors. Biosci Rep 34, (2014).
Cameron, A. J. M. & Parker, P. J. Protein kinase C – A family of protein kinases, allosteric effectors or both? Adv Enzyme Regul 50, 169–177 (2010).
El Amri, M., Fitzgerald, U. & Schlosser, G. MARCKS and MARCKS-like proteins in development and regeneration. J Biomed Sci 25, 43 (2018).
Brudvig, J. J. et al. MARCKS regulates neuritogenesis and interacts with a CDC42 signaling network. Sci Rep 8, 13278 (2018).
Palmer, R. H. et al. PRK1 phosphorylates MARCKS at the PKC sites: serine 152, serine 156 and serine 163. FEBS Lett 378, 281–5 (1996).
Cabell, C. H., Verghese, G. M., Rankl, N. B., Burns, D. J. & Blackshear, P. J. MARCKS phosphorylation by individual protein kinase C isozymes in insect Sf9 cells. Proc Assoc Am Physicians 108, 37–46 (1996).
Lanoue, V. & Cooper, H. M. Branching mechanisms shaping dendrite architecture. Dev Biol 451, 16–24 (2019).
Kalwa, H. & Michel, T. The MARCKS protein plays a critical role in phosphatidylinositol 4,5-bisphosphate metabolism and directed cell movement in vascular endothelial cells. J Biol Chem 286, 2320–30 (2011).
Yu, D. et al. Myristoylated Alanine-Rich Protein Kinase Substrate (MARCKS) Regulates Small GTPase Rac1 and Cdc42 Activity and Is a Critical Mediator of Vascular Smooth Muscle Cell Migration in Intimal Hyperplasia Formation. J Am Heart Assoc 4, e002255 (2015).
Ziemba, B. P. & Falke, J. J. A PKC-MARCKS-PI3K regulatory module links Ca2 + and PIP3 signals at the leading edge of polarized macrophages. PLoS One 13, e0196678 (2018).
Hitchcock, J. R. et al. Inflammation drives thrombosis after Salmonella infection via CLEC-2 on platelets. Journal of Clinical Investigation 125, 4429–4446 (2015).
Kasinath, V. et al. Urine podoplanin heralds the onset of ischemia-reperfusion injury of the kidney. American Journal of Physiology-Renal Physiology 316, F957–F965 (2019).
Meng, D. et al. A Role of the Podoplanin-CLEC-2 Axis in Promoting Inflammatory Response After Ischemic Stroke in Mice. Neurotox Res 39, 477–488 (2021).
Mathieson, L., Koppensteiner, L., Dorward, D. A., O’Connor, R. A. & Akram, A. R. Cancer-associated fibroblasts expressing fibroblast activation protein and podoplanin in non-small cell lung cancer predict poor clinical outcome. Br J Cancer 130, 1758–1769 (2024).
Peters, A. et al. Th17 cells induce ectopic lymphoid follicles in central nervous system tissue inflammation. Immunity 35, 986–96 (2011).
Murray, E. R. et al. Disruption of pancreatic stellate cell myofibroblast phenotype promotes pancreatic tumor invasion. Cell Rep 38, 110227 (2022).
Ott, L. E. et al. Fibroblast Migration Is Regulated by Myristoylated Alanine-Rich C-Kinase Substrate (MARCKS) Protein. PLoS One 8, e66512 (2013).
Yang, Z. et al. MARCKS contributes to stromal cancer-associated fibroblast activation and facilitates ovarian cancer metastasis. Oncotarget 7, 37649–37663 (2016).
Yang, D. C. et al. Tackling MARCKS-PIP3 circuit attenuates fibroblast activation and fibrosis progression. FASEB J 33, 14354–14369 (2019).
Makris, S. et al. Podoplanin expression in fibroblasts determines lymph node architecture and adaptive immune function. BioRXiV (2022) doi:10.1101/2022.12.01.518753.
Livet, J. et al. Transgenic strategies for combinatorial expression of fluorescent proteins in the nervous system. Nature 450, 56–62 (2007).
Snippert, H. J. et al. Intestinal crypt homeostasis results from neutral competition between symmetrically dividing Lgr5 stem cells. Cell 143, 134–44 (2010).
Quétier, I. et al. Knockout of the PKN Family of Rho Effector Kinases Reveals a Non-redundant Role for PKN2 in Developmental Mesoderm Expansion. Cell Rep 14, 440–448 (2016).
Lutz, M. B. et al. An advanced culture method for generating large quantities of highly pure dendritic cells from mouse bone marrow. J Immunol Methods 223, 77–92 (1999).
Lowe, K. L. et al. The expression of mouse CLEC-2 on leucocyte subsets varies according to their anatomical location and inflammatory state. Eur J Immunol 45, 2484–2493 (2015).
Spizz, G. & Blackshear, P. J. Overexpression of the myristoylated alanine-rich C-kinase substrate inhibits cell adhesion to extracellular matrix components. J Biol Chem 276, 32264–73 (2001).

Table 1

– Plasmids
Plasmid	Encodes	Source
WT MARCKS-GFP	WT bovine MARCKS in pEGFP-N1 vector tagged with GFP at C-terminus (Fig. 5.1.1)	⁵⁵
AS MARCKS-GFP	S158A, S162A, S166A, S169A bovine MARCKS in pEGFP-N1 vector tagged with GFP at C-terminus (Fig. 5.1.1)	⁵⁵
DS MARCKS-GFP	S158D, S162D, S166D, S169D bovine MARCKS in pEGFP-N1 vector tagged with GFP at C-terminus (Fig. 5.1.1)	⁵⁵
mTagRFP-T-Lifeact-7	Lifeact F-actin visualisation peptide tagged with RFP at C-terminus under a CMV promotor.	Marsh Lab, MRC LMCB
pBird-GFP	Produced by the Lloyd lab, encodes cytosolic GFP.	Lloyd lab, LMCB
pPB[CRISPR]-Bsd-hCas9- U6 > Scramble_gRNA1	Scr gRNA: GTGTAGTTCGACCATTCGTG human Cas9 enzyme, blasticidin resistance cassette	Vector builder
pPB[2CRISPR]-Bsd-hCas9- U6 > mMarcks[gRNA#422]-U6>{Benchling Exon1} Vector ID: VB191118-1211cmd	gRNA#427 mMARCKS CGCCGCGGCCGAAAAGGATG gRNA benchling 1: ATTTGCTTTGGAAGGCGACG PiggyBac vector encoding human Cas9 enzyme, blasticidin resistance cassette	Vector builder
PiggyBac transposase (PBase)	Piggybac transposase gene transformed and Cloned in A7 -XL-10 Gold B7

There is NO Competing Interest.

Download PDF

Version 1

posted

You are reading this latest preprint version

PKN2 signalling induces stromal cell protrusions to preserve lymph node structural integrity

Status:

Version 1

Abstract

Figures

Introduction

Results

Morphological adaptation of FRCs during acute lymph node expansion

CLEC-2/podoplanin signalling promotes membrane translocation of MARCKS in FRCs

MARCKS regulation is required for FRC morphological adaptation in response to DCs

Membrane localization of MARCKS is sufficient to induce protrusions in FRCs

PKN2 regulates FRC network integrity following immune challenge via regulation of MARCKS phosphorylation

Discussion

Declarations

Materials and Methods

References

Tables

Additional Declarations

Supplementary Files

Status:

Version 1