Chamaecyparis formosensis is an endemic species of Taiwan, threatened from intensive use and illegal felling. An individual identification system for C. formosensis is required to provide scientific evidence for court use and deter illegal felling. In this study, 36 polymorphic simple sequence repeat (SSR) markers were developed. By applying up to 28 non-linkage of the developed markers, it is calculated that the cumulative random probability of identity (CPI) is as low as 1.652×10-12, the combined power of discrimination (CPD) is as high as 0.999999999998348, and the identifiable population size is up to 60 million, which is greater than the known C. formosensis population size in Taiwan. Biogeographical analysis data show that C. formosensis from four geographic areas belong to the same genetic population which can be further divided into three clusters: SY (Eastern Taiwan), HV and GW (Northwestern Taiwan), and MM (Southwestern Taiwan). The developed system was applied to assess the provenance of samples with 88.44% of accuracy rate, and therefore can serve as a pre-screening tool to reduce the range required for comparison. The system developed in this study is a potential crime-fighting tool against illegal felling.
Research Article
Developing SSR Individual Identification System and Tracking the Geographical Origin of Timber for the Endangered Species Chamaecyparis Formosensis
https://doi.org/10.21203/rs.3.rs-493686/v1
This work is licensed under a CC BY 4.0 License
You are reading this latest preprint version
species
Taiwan
court
evidence
Mahogany tree
European ash
Merbau timber
Brazilian rosewood
Chamaecyparis formosensis Masam., also known as False Cypress, is endemic tree species in Taiwan distributed majorly in the cloud forest, a zonal forest type in the mid elevation (1,700-2,600 m) with extremely high biodiversity1. Gigantic C. formosensis is known for its superb timber quality. Due to its high quality and market value (4,050 USD/m3,woodprice.forest.gov.tw), C. formosensis is critically threatened by illegal felling. Unplanned felling and poor management had compromised the ecosystem and led these precious species endangered. Similar scenarios also happened to Brazilian rosewood2, Dalbergia Timber3, European ash4, Mahogany tree5, and Merbau timber6. Moreover, timber production countries suffer from illegal felling, particularly in South-east-Asian, African and South American countries7. Although suspects were arrested in some occasions, lack of direct scientific evidence to link seized timber and stump had led fail of conviction in majority8.
In recent years, countries suffering from serious illegal logging have successively begun to develop DNA-based timber individual identification systems that can provide court evidence for conviction. The technologies can be further categorized into SSR (Simple sequence repeat)-based systems including Chamaecyparis taiwanensis8, Fraxinus excelsior4, Cinnamomum kanehirae9, Entandrophragma cylindricum10 and Intsia palembanica6 and SNP (Single nucleotide polymorphism) and INDEL (Insertion/ Deletion)-based system including Acer macrophyllum11.
The SSR individual identification technique was developed more than 30 years and have been widely used in DNA paternity testing, forensic examination, victim identification, and animal individual identification12,13. SSR marker is a co-dominant and highly reproducible DNA marker with the following characteristics: it has a high degree of polymorphism; it is abundant and evenly distributed in eukaryotic genome; most of them are not functional, and can be easily and economically tested by PCR (polymerase chain reaction); last, the length is generally short which provides a higher opportunity to be amplified when applied to the lysed sample13,14. Therefore, SSR is the most commonly used method for individual identification systems15,16. In order to protect our precious cypress resources in Taiwan, we have developed and adapted several polymorphic SSR markers17 for individual identification.
In the illegal felling crime case reports C. taiwanensis8 and F. excelsior4, it is demonstrated that SSR individual identification system can provide scientific evidences which are considered acceptable by court. In these cases, the individual identification system developed with genetic markers for those species were used to link seized timbers and victim trees, while considering the random probability of the same genotype appearing in the population. Therefore, convincible scientific proof with confidence level close to 100% were accepted as court evidences for crime conviction.
The legality of wood products usually depends on their source18. SSR is also often used in genetic diversity and population structure analysis of species14,19, and can further predict the geographic provenance and distribution of species. Genetic methods have been applied to confirm the source and trade routes of protected species20,21. However, filing the DNA of every individual is not feasible even if C. formosensis has been listed as an endangered species. Therefore, it is important to analyze the genetic variation and population structure of C. formosensis. Genotyping can reveal the provenance of the timber and greatly reduces the range of possible plant sources.
The main purpose of this study is to develop C. formosensis SSR individual identification system, which provides high discrimination power against genetic variation, in order to prevent the occurrence of illegal felling. In addition, the biogeographical analysis of C. formosensis also facilitate to provide provenance information of the seized timber. In addition to being a long-developed individual identification tool15,16, SSR is also often used in plant conservation and breeding22,23. The SSR markers developed in this study can also support the future C. formosensis afforestation by providing the selection basis for mother trees with higher diversity.
Development of new SSR markers for C. formosensis
In order to develop SSR markers for individual identification, we constructed three DNA libraries (Fig. 1 and Supplementary 1). Three C. formosensis individuals from QL (Voucher no. Chung 4450) and SY (Voucher no. Chung 4905, 4906) were used for DNA library preparation. To build three DNA libraries, genomic DNA was extracted from fresh leaves using the VIOGENE plant DNA extraction kit (VIOGENE, New Taipei City, Taiwan). The DNA libraries were sequenced using the Illumin MiSeq System (2 × 301 bp paired-end; Illumin, San Diego, California, USA) at Tri-I Biotech (New Taipei City, Taiwan).
Bioinformatics analysis was conducted with CLC Genomics Workbench version 10 (QIAGENE, Aarhus, Denmark). The raw reads were prescreened to remove adapter sequences and reads with greater than 0.01 error or with an average quality less than QV20. The trimmed sequences were further subjected to de novo assembly (Fig. 1).
MISA (MIcroSAtellite v 1.0)27 was applied to screen the SSR containing sequences from contigs. To design SSR primers, sequences with at least five di-, tri-, tetra-, penta-, and hexa-nucleotide repeats were selected using BatchPrimer328, with optimized conditions set length at 18-23 bp, melting temperature 45-62°C, and a product size of 80-300 bp (Fig. 1).
A total of 100 candidate SSR primer pairs were newly designed in this study. These markers were subjected to validation test on 92 samples from four C. formosenses geographic areas (MM, HV, GW, SY see Fig.2 and Supplementary 1). The samples DNA used in marker validation were extracted using the VIOGENE plant DNA extraction kit (VIOGENE, New Taipei City, Taiwan). The PCR reaction was conducted with a final volume 20 μL containing 2 ng of genomic DNA, 0.25 μL of 10 μM each primer and 10 μL of Q-Amp 2x Screening Fire Taq Master Mix (Bio-Genesis Technologies, Taipei, Taiwan). The following PCR process was conducted: an initial denaturation of 95°C for 2 min; 30 cycles of 95°C for 45 sec, a primer-specific annealing temperature for 45 sec, and 72°C for 45 sec; followed by a 15-min extension at 72°C (Table 1). The amplified products were evaluated on the ABI 3500 (Applied Biosystems, Waltham, Massachusetts, USA) with GeneScan 600 LIZ Size Standard (Applied Biosystems). Fragment size was determined by using GeneMapper ID-X v1.6 (Applied Biosystems).
The the cross-species transferability of the designed markers were tested in Chamaecyparis taiwanensis, for details see Supplementary 2 and 3.
Developing C. formosensis individual identification system
Marker analysis was conducted by combining 27 pairs published SSR markers17 with 9 validated SSR markers abovementioned. GenAlex 6.51b244 was used to calculate number of alleles (A), observed heterozygosity (Ho), expected heterozygosity (He), Hardy-Weinberg equilibrium (HWE). PowerMarker V3.2551 was used to calculate polymorphism information content or power of information content (PIC)52. Power of discrimination (PD)35, PD = 1 − ΣPi2, where Pi is the frequency of genotype i . Probability of identity (PI)36, PI = 1 − PD. Combined power of discrimination (CPD)35, here we calculated CPD of 28 markers. CPD = 1 – [(1 – PD1)(1 – PD2)…(1 – PD28)].Combined probability of identity (CPI)36. Microsoft Excel (Microsoft Office 2016) was used to calculate PD, PI, CPD, CPI. GENEPOP 4.237 was used to test for linkage disequilibrium.
Population genetics analysis
Genetic differentiation and gene flow among 4 geographic areas (MM, HV, GW, SY) were analyzed using Fst and Nm by Arlequin 3.5.2.253.
The population genetic structure was analyzed using STRUCTURE 2.3.446. The program was run for K = 1 to 5 clusters with 20 independent runs to assess simulation stability. Each simulation was run for an initial 1,000,000 burn-in period followed by 100,000 replications based on the Markov chain Monte Carlo (MCMC)54. The best grouping was evaluated by Delta K54 in Structure Harvester Web v0.6.9455. Bar graphs were generated by CLUMPP 1.1.256 for K ideal.
Individual provenance simulation was conducted with GENECLASS v. 2.050 on each 92 individuals independently. Pairwise simulation was also conducted on the pooled database deducted the sample itself.
Development of new SSR markers for C. formosensis
For a higher accuracy of court's judgment on illegal felling, it is necessary to establish a complete forensic system. Although some SSR markers of cypress have been published17,24-26, the reported detection rates for dried timber were only 20-40%. Therefore, it is necessary to develop more SSR markers as a contingency plan. When the sample is in a poor condition, more markers can be applied in order to achieve the threshold of combined power of discrimination (CPD) required for successful comparison between seized timbers and victim trees. In order to maximize potential loci, Next generation sequence (NGS) methods were used. In this study 3 DNA library were constructed. We used the Illumina MiSeq platform (2 × 301 bp; Illumina, San Diego, California, USA) to sequence the DNA libraries (Fig. 1 and Supplementary 1).
A total of 70,325,072 raw reads were produced. The raw reads were deposited in the NCBI BioProject (PRJNA454510). After quality-trimming to the raw reads with CLC Genomics Workbench version 10 (QIAGENE, Aarhus, Denmark), 70,319,509 contigs were generated with length between 133 and 146 bp in average. De novo assembly was then conducted with the following parameters: contig number 208,467, minimum length of contigs 18bp, maximum length contigs 108,928bp, and average length contigs 491bp. The sequence was assembled with software CLC Genomics Workbench version 10 and the length of assembly sequence was 102,281,642 bp.
A sum of 78,250 SSR containing sequences were screened by MISA (v 1.0, MicroSAtellite)27. We newly designed 100 candidate SSR primer pairs for testing in C. formosensis by BatchPrimer328.
There are 9 validated SSR markers are polymorphic (success rate 9.00%), which were registered in GenBank in NCBI (Table 1) and passed for cross-species tests (supplementary 2 and 3).
Different from the traditional SSR cloning method, with next generation sequencing technology, it is easy to obtain colossal amount of SSR containing sequences from sequenced genomes29. However, transforming candidate SSR primer pairs into validated SSR markers is still a time-consuming and expensive step. Qualified SSR markers need to succeed in PCR amplification, have good peak pattern quality with little stuttering, and be free of non-amplifying (invalid) alleles. The turnover rate from candidate SSR primer pairs to validated SSR markers varies from species to species29,30. The success rate in Chamaecyparis plants is between 5.24% and 9.27%8,17,24,25,31.
Developing C. formosensis individual identification system
In this study, newly developed 9 validated SSR markers and other 27 validated SSR markers17 polymorphic SSR markers were analyzed against 92 individuals from 4 geographic areas (MM, HV, GW, SY, Fig. 2 and Supplementary 1). The results of developed 36 SSR markers are summarized in Table 2. Among the 92 individuals in this study, each number of alleles of SSR is between 2 and 27, with average of 7.916. The levels of observed heterozygosity (Ho)32 are from 0.000 to 0.891, with average of 0.414. The levels of expected heterozygosity (He)32 are ranged from 0.103 to 0.906, with average of 0.565. Significant (P < 0.001) deviations of Hardy-Weinberg equilibrium (HWE)33 were detected in 23 SSR loci: Cred47, 225, 231, 236, 242, 248, 249, 250, 253, 260, 262, 276, 277, 280, 603, 610, 628, 640, 641, 674, 678, 682, 683. Ho is the actual proportion of heterozygous individuals contained in each locus within the population, whereas the He is the expected value estimated per HWE. Ho and He are the most popular parameters used in estimating genetic diversity in population. The population structural and even historical information can be obtained from Ho and He. Most marker within the 36 tested ones have higher He than Ho (all except Cred211, Cred220, Cred225, Cred248, Cred276, Cred281, Cred297, Cred298), suggesting that different loci have lower genetic diversity in C. formosensis and the population of C. formosensis is an inbred. HWE describes that under ideal conditions, gene frequency does not change over time or generation. However, there will always be one or more interfering factors affecting gene frequency in nature. Therefore, HWE is difficult to achieve in nature. In this study, 23 loci out of 36 markers deviated from HWE (63.89% deviation rate). The reason for this deviation could be artificial selection, non-panmixia or genetic drift.
Polymorphism information content or power of information content (PIC). PIC value is an index of relative ability of the SSR marker's genetic variability. The higher the polymorphism of marker's genotype, the higher the PIC value34. Polymorphic markers were highly informative (PIC > 0.50), reasonably informative (0.50 > PIC > 0.25), and slightly informative (PIC < 0.25). Power of discrimination (PD)35 refers to the ability of genetic markers to distinguish individuals within a population. Obviously, in a population with more allele types and evenly distributed genotypes, the low probability of two random individuals have the same genotype, and the greater probability of two random individuals can be identified by the system. Probability of identity (PI)36 is the probability of two individuals with the same genotype. PD = 1-PI . The value of PIC, PD and PI of individual markers reflects its identification ability in the individual identification system. The greater PIC and PD, the lower PI in value, suggesting the higher identification ability of the marker, and vice versa. The levels of PIC range from 0.097 to 0.876, with average 0.528. The levels of PD range from 0.102 to 0.885, with average 0.567. The levels of PI range from 0.114 to 0.897, with average 0.431. There were 19 out of 36 markers with PIC greater than 0.5, and the mean of these 36 markers PIC values was greater than 0.5, suggesting the markers have a high identification ability. The results of PD and PIcorrespond to those of PIC. The highly informative markers presented in PIC also show higher identification ability in PD and PI.
Significant linkages (P < 0.001) were detected among Cred35/229/277, Cred47/298, Cred231/249/253/262, Cred281/297, Cred603/683 and Cred640/678/682 with GENEPOP 4.237, suggesting the abovementioned group located in the same linkage group (Table 2). When identifying several independent polymorphic genetic markers at the same time (polymorphic markers located in different linkage groups), the combined probability of identity (CPI) is the product of the PI of each genetic marker. At this time, CPI will be greatly reduced, and combined power of discrimination (CPD) will become very high. As defined above, CPI + CPD = 1. The credibility of the individual identification system is calculated based on "Random match probability in population size and confidence levels’" published by Budowle et al (2000)38. Confidence levels (CL) = (1 – CPI)N，where N is number of individuals.
The individual identification system was applied to illegal felling cases8. When the seized timber and the victim tree are identified to be the same individual plant, under the considerations of fairness and objective, the court usually adopts 99.99%, 99% or 95% confidence level as the credibility standard39 (Wall 2002, ISO ISO/IEC 17025). In this study, the locus with the lowest PI within a linkage group was used to calculate the CPI (Table 3). The CPI decreased along with the accumulation of loci, and with the PI of each locus sorted in ascending order. The system can accumulate up to 28 loci without linkage. When reaching its maximum capability, even under most strict standard (confidence level 99.99%) by dictated by court, this system can be used to identify 60 million C. formosensis, with CPI as low as 1.652×10-12, CPD as high 0.999999999998348 (almost equal to 1), beyond the known population size 32.06 ± 3.20 million of C. formosensis40. Under ideal condition, a minimal of 6 loci can be applied to the system, with an identifiable C. formosensis population of 2,900 under 95% confidence level. The CPI is as low as 1.728×10-5, and CPD is as high as 0.999982712603209 (Table 3).
Population genetics analysis
The fixation index (Fst) is a measure of population differentiation due to genetic structure41. A higher Fst value means a higher degree of difference between populations. When Fst is less than 0.05, there is no differentiation among populations. When Fst is between 0.05 and 0.15, there is low differentiation among populations. On the other hand, estimation of number of migrants (Nm) is a measure of gene flow value41. When Nm is greater than one, it represents genes frequently exchange which counteracts the genetic drift and prevents the population differentiation42. When Nm is greater than 4, it would be a random mating population43. Fst and Nm analysis on the 4 geographic areas were conducted with GeneAlex 6.50344 (Table 4). The Fst value of HV and GW is 0.035, suggesting no inter-population differentiation. The highest Fst value 0.074 was found between HV and MM. The Fst values range from 0.056 to 0.065 were found between the rest geographic areas, indicating a low differentiation among geographic areas. The highest Nm value 6.832 was found between HV and GW, whereas the lowest value 3.141 between HV and MM. The Nm values of 4 geographic areas were all greater than 1 (between 3.141 and 6.832), suggesting a frequent gene exchange between the 4 geographic areas, which offsets genetic drift and prevents population differentiation. For GW/MM (Nm = 4.022), GW/HV (Nm = 6.382), the Nm values of the population are greater than 4, suggesting that they are random mating populations.
STRUCTURE analysis45,46 was used to analyze the population genetic structure of C. formosensis (Fig. 3), and the Delta K value was calculated to obtain the optimal number of clusters. K and Delta K were show in Fig. 3a and K=2, 3 and 4 are drawn respectively in Fig. 3b. These individuals of C. formosensis present the most likely three clusters: The SY located in Eastern Taiwan is an independent cluster, the MM located in Southwestern Taiwan is another standalone cluster, whereas the two HV and GW geographic areas are in the same genetic cluster. Combing the results of Fst (Table 4), Nm (Table 4) and STRUCTURE analysis (Fig. 3), the data show that the C. formosensis of the four geographical areas belongs to the same genetic population. The Fst and STRUCTURE analysis data suggests that the samples fall into three clusters. The hypothesis that Taiwan Island is one of the plant refuges during the Quaternary glaciation47,48 may help to explain the results. In the research on the historical biogeography and phylogeny of cypress48, C. formosensis in Taiwan Island was separated from Chamaecyparis in Japan at 2.9 million years ago. The arrival of the Quaternary glaciation caused the extinction of many species and led a continued retreat of species to lower latitudes, thus Taiwan Island became a refuge for many ancient species. After the glaciation, species spread from the refuge to the surrounding area and formed species diversity on a latitude gradient49. In our results, the low polymorphism of C. formosensis in the four geographic areas’ individuals may be from the same big population of C. formosensis during the glaciation. After the glacial retreat, C. formosensis spread out from the refuge. Due to the influence of terrain and distance, C. formosensis in different geographical areas has a tendency to form different clusters.
GENECLASS v. 2.050 was applied to analyse the provenance of 92 individuals independently and the probability of samples returning to the correct provenance is 95.00% (MM), 88.00% (HV), 69.57% (GW), and 100.00% (SY), with an overall mean correct rate of 88.04% (Table 5). Three HV individuals were mis-assigned to GW and four GW individuals were mis-assigned to HV, corresponding to the observation that HV and GW are the same cluster. However, 3 GW individuals were mis-assigned to MM, possibly because the geographic location of GW is between HV and MM, and therefore GW has characteristics of north and south at the same time. Likelihood, one MM was mis-assigned to GW, further supporting the inference that there is partial gene exchange between MM and GW. Overall, our data shows that the populations in eastern (SY) and western Taiwan (the rest populations) have distinct differences in genotype. Within the western populations, the northern (HV) and the southern one (MM) have obvious differences. Therefore, when seizing timbers in the futures, the genotype can be served as a prefilter to infer the geographic area of the victim tree if the provenance is found to be MM, HV or SY. A further inspection is required if the provenance is found to be GW because of the existence of gene exchange between nearby geographic area.
In this study, a C. formosensis individual identification system was built with 36 polymorphic SSR markers. When 28 non-linkage SSR markers are applied, the system is capable to identify 60 million C. formosensis individuals with confidence level of 99.99%. The lowest CPI is 1.652×10− 12 and the highest CPD is 0.999999999998348. This system can provide the scientific evidence to link seized timbers and victim trees required the illegal felling court cases, and facilitate the future legal sales by profiling timbers. Through population genetics analysis, the system is capable to provide provenance information, which would significantly enhance the efficiency by reducing the range required for investigation. The polymorphic markers developed in this study can be further applied to the conservation and breeding of the precious species C. formosensis.
Acknowledgements
The authors would like to thank Dr. Kuo-Fang Chung (Biodiversity Research Center, Academia Sinica, Taiwan) for his support in research funding and facilities. The authors would like to thank Dr. Chaolun Allen Chen and Dr. Shu-Miaw Chaw (Biodiversity Research Center, Academia Sinica, Taiwan) for their support in research facilities. This work was financially supported by Ministry of Science and Technology, Taiwan (grant no. MOST 104-2321-B-002-056) and Ministry of Justice, Taiwan (grant no. 109-1301-05-17-02).
Author contributions
C.J.H. conceived, designed and conducted the experiments, and wrote the main manuscript text, drew the figures and tables, sample collection, funding application and manuscript submitted. F.H.C. edited the manuscript. Y.S.H. edited the manuscript and assisted to draw figures and tables. Y.C.T. and Y.M.H. performed the experiments. Y.H.T. edited the manuscript. C.E.P. data analysis. C.T.H. drew the figures and sample collection. C.H.C. edited the manuscript. Y.S.C. data analysis. S.C.L., Y.T.Y., S.Y.H. and H.C.H. sample collection and performed the experiments. C.T.W. sample collection. C.T.C. funding application. All authors reviewed the manuscript.
Author statement
In regard to legislation compliance of experimental materials, we hereby declare that all of our experimental research and field studies on plants, either cultivated or wild, including the collection of plant material, comply with relevant institutional, national, and international guidelines and legislation.
- Hwang, S. Y., Lin, H. W., Kuo, Y. S. & Lin, T. P. RAPD variation in relation to population differentiation of Chamaecyparis formosensis and Chamaecyparis taiwanensis. Botanical Bulletin of Academia Sinica. 42, 173–179 (2001).
- Kite, G. C. et al. Dalnigrin, a neoflavonoid marker for the identification of Brazilian rosewood (Dalbergia nigra) in CITES enforcement. Phytochemistry. 71, 1122–1131 https://doi.org/10.1016/j.phytochem.2010.04.011 (2010).
- Espinoza, E. O., Wiemann, M. C., Barajas-Morales, J., Chavarria, G. D. & McClure, P. J. Forensic analysis of CITES-protected Dalbergia timber from the Americas. IAWA journal. 36, 311–325 (2015).
- Tereba, A., Woodward, S., Konecka, A., Borys, M. & Nowakowska, J. A. Analysis of DNA profiles of ash (Fraxinus excelsior L.) to provide evidence of illegal logging. Wood Science and Technology. 51, 1377–1387 https://doi.org/10.1007/s00226-017-0942-5 (2017).
- Cabral, E. C. et al. Wood typification by Venturi easy ambient sonic spray ionization mass spectrometry: the case of the endangered Mahogany tree. J Mass Spectrom. 47, 1–6 https://doi.org/10.1002/jms.2016 (2012).
- Lowe, A. J., Wong, K. N., Tiong, Y. S., Iyerh, S. & Chew, F. T. A DNA Method to verify the integrity of timber supply chains; confirming the legal sourcing of merbau timber from logging concession to sawmill. Silvae Genetica. 59, 263–268 https://doi.org/10.1515/sg-2010-0037 (2010).
- Dormontt, E. E. et al. Forensic timber identification: It's time to integrate disciplines to combat illegal logging. Biol. Conserv. 191, 790–798 https://doi.org/10.1016/j.biocon.2015.06.038 (2015).
- Huang, C. J. et al. Development and technical application of SSR-based individual identification system for Chamaecyparis taiwanensis against illegal logging convictions. Scientific reports. 10, 1–14 (2020).
- Hung, K. H., Lin, C. H. & Ju, L. P. Tracking the geographical origin of timber by DNA fingerprinting: a study of the endangered species Cinnamomum kanehirae in Taiwan. Holzforschung. 71, 853–862 (2017).
- Jolivet, C. & Degen, B. Use of DNA fingerprints to control the origin of sapelli timber (Entandrophragma cylindricum) at the forest concession level in Cameroon. Forensic Sci Int Genet. 6, 487–493 (2012).
- Dormontt, E. et al. Forensic validation of a SNP and INDEL panel for individualisation of timber from bigleaf maple (Acer macrophyllum Pursch). Forensic Science International: Genetics. 46, 102252 (2020).
- Jeffreys, A. J., Wilson, V. & Thein, S. L. Individual-specific ‘fingerprints’ of human DNA. Nature. 316, 76–79 (1985).
- Robinson, A. J., Love, C. G., Batley, J., Barker, G. & Edwards, D. Simple sequence repeat marker loci discovery using SSR primer. Bioinformatics. 20, 1475–1476 (2004).
- Ali, A. et al. Genetic diversity and population structure analysis of Saccharum and Erianthus genera using microsatellite (SSR) markers. Sci Rep. 9, 395 https://doi.org/10.1038/s41598-018-36630-7 (2019).
- Jobling, M. A. & Gill, P. Encoded evidence: DNA in forensic analysis. Nat Rev Genet. 5, 739–751 https://doi.org/10.1038/nrg1455 (2004).
- Butler, J. M. Genetics and genomics of core short tandem repeat loci used in human identity testing. Journal of forensic sciences. 51, 253–265 (2006).
- Huang, C. J. et al. Isolation and characterization of SSR and EST-SSR loci in Chamaecyparis formosensis (Cupressaceae). Applications in plant sciences. 6, e01175 https://doi.org/10.1002/aps3.1175 (2018).
- Finch, K. N. et al. Predicting the geographic origin of Spanish Cedar (Cedrela odorata L.) based on DNA variation. Conserv. Genet. 21, 625–639 (2020).
- Dorji, J., Tamang, S., Tshewang, T., Dorji, T. & Dorji, T. Y. Genetic diversity and population structure of three traditional horse breeds of Bhutan based on 29 DNA microsatellite markers. PloS one. 13, e0199376 (2018).
- Paredes-Villanueva, K. et al. Nuclear and plastid SNP markers for tracing Cedrela timber in the tropics.Conservation Genetics Resources,1–6(2019).
- Blanc-Jolivet, C., Yanbaev, Y., Kersten, B. & Degen, B. A set of SNP markers for timber tracking of Larix spp. in Europe and Russia. Forestry: An International Journal of Forest Research. 91, 614–628 (2018).
- Penha, J. et al. Estimation of natural outcrossing rate and genetic diversity in Lima bean (Phaseolus lunatus L. var. lunatus) from Brazil using SSR markers: implications for conservation and breeding. Genetic Resources and Crop Evolution. 64, 1355–1364 (2017).
- Yang, H., Zhang, R., Jin, G., Feng, Z. & Zhou, Z. Assessing the genetic diversity and genealogical reconstruction of cypress (Cupressus funebris Endl.) breeding parents using SSR markers. Forests. 7, 160 (2016).
- Matsumoto, A. et al. Development and polymorphisms of microsatellite markers for hinoki (Chamaecyparis obtusa). Mol. Ecol. Notes. 6, 310–312 https://doi.org/10.1111/j.1471-8286.2006.01212.x (2006).
- Nakao, Y., Iwata, H., Matsumoto, A., Tsumura, Y. & Tomaru, N. Highly polymorphic microsatellite markers in Chamaecyparis obtusa. Canadian journal of forest research. 31, 2248–2251 https://doi.org/10.1139/cjfr-31-12-2248 (2001).
- Kim, Y. M., Shin, Y. S. & Jeong, J. H. Development and characterization of microsatellite primers for Chamaecyparis obtusa (Cupressaceae). Applications in plant sciences. 4, 1500136 (2016).
- Thiel, T., Michalek, W., Varshney, R. & Graner, A. Exploiting EST databases for the development and characterization of gene-derived SSR-markers in barley (Hordeum vulgare L.). Theoretical and applied genetics. 106, 411–422 (2003).
- You, F. M. et al. BatchPrimer3: a high throughput web application for PCR and sequencing primer design. BMC Bioinformatics. 9, 253 https://doi.org/10.1186/1471-2105-9-253 (2008).
- Zalapa, J. E. et al. Using next-generation sequencing approaches to isolate simple sequence repeat (SSR) loci in the plant sciences. American journal of botany. 99, 193–208 (2012).
- Gardner, M. G., Fitch, A. J., Bertozzi, T. & Lowe, A. J. Rise of the machines–recommendations for ecologists when using next generation sequencing for microsatellite development. Molecular Ecology Resources. 11, 1093–1101 (2011).
- Iwaizumi, M., Watanabe, A. & Isoda, K. Primer Note: Development of Highly Polymorphic Nuclear Microsatellite Markers for Hinoki (Chamaecyparis obtusa). Silvae Genetica. 60, 62–65 (2011).
- Nei, M. Analysis of gene diversity in subdivided populations. Proceedings of the National Academy of Sciences 70, 3321–3323(1973).
- Rodriguez, S., Gaunt, T. R. & Day, I. N. Hardy-Weinberg equilibrium testing of biological ascertainment for Mendelian randomization studies. American journal of epidemiology. 169, 505–514 (2009).
- Pan, Y. B. Highly polymorphic microsatellite DNA markers for sugarcane germplasm evaluation and variety identity testing. Sugar Tech. 8, 246–256 (2006).
- Fisher, R. Standard calculations for evaluating a blood-group system. Heredity. 5, 95 (1951).
- Jones, D. A. & Blood Samples Probability of Discrimination. Journal of the Forensic Science Society. 12, 355–359 https://doi.org/10.1016/s0015-7368(72)70695-7 (1972).
- Raymond, M. & Rousset, F. GENEPOP (version 1.2): population genetics software for exact tests and ecumenicism. Journal of Heredity. 86, 248–249 (1995).
- Budowle, B., Chakraborty, R., Carmody, G. & Monson, K. L. Source attribution of a forensic DNA profile. Forensic Science Communications. 2, 6 (2000).
- Wall, W. Genetics & DNA technology: legal aspects (Routledge-Cavendish, 2002).
- Qiu, L. W., Huang, Q. X., Wu, C. C. & Hsieh, H. T. (Taipei, 2015).
- Wright, S. Isolation by distance. Genetics. 28, 114 (1943).
- Wright, S. Evolution and the genetics of populations: Vol. 2. The theory of gene frequencies(1969).
- Hartl, D. & Clark, A. Principles of population genetics. Sinauer Assoc. Inc, Sunderland, Massachusetts(1989).
- Peakall, R. & Smouse, P. E. GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research—an update. Bioinformatics. 28, 2537–2539 (2012).
- Falush, D., Stephens, M. & Pritchard, J. K. Inference of population structure using multilocus genotype data: linked loci and correlated allele frequencies. Genetics. 164, 1567–1587 (2003).
- Pritchard, J. K., Stephens, M. & Donnelly, P. Inference of population structure using multilocus genotype data. Genetics. 155, 945–959 (2000).
- Qian, H. & Ricklefs, R. E. Large-scale processes and the Asian bias in species diversity of temperate plants. Nature. 407, 180–182 (2000).
- Wang, W. P., Hwang, C. Y., Lin, T. P. & Hwang, S. Y. Historical biogeography and phylogenetic relationships of the genus Chamaecyparis (Cupressaceae) inferred from chloroplast DNA polymorphism. Plant Systematics and Evolution. 241, 13–28 https://doi.org/10.1007/s00606-003-0031-0 (2003).
- Qian, H. A comparison of the taxonomic richness of temperate plants in East Asia and North America. American Journal of Botany. 89, 1818–1825 (2002).
- Piry, S. et al. GENECLASS2: a software for genetic assignment and first-generation migrant detection. Journal of heredity. 95, 536–539 (2004).
- Liu, K. & Muse, S. V. PowerMarker: an integrated analysis environment for genetic marker analysis. Bioinformatics. 21, 2128–2129 (2005).
- Botstein, D., White, R. L., Skolnick, M. & Davis, R. W. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. American journal of human genetics. 32, 314 (1980).
- Excoffier, L., Laval, G. & Schneider, S. Arlequin (version 3.0): an integrated software package for population genetics data analysis.Evolutionary bioinformatics,47–50(2005).
- Evanno, G., Regnaut, S. & Goudet, J. Detecting the number of clusters of individuals using the software STRUCTURE: a simulation study. Mol Ecol. 14, 2611–2620 https://doi.org/10.1111/j.1365-294X.2005.02553.x (2005).
- Earl, D. A. & vonHoldt, B. M. STRUCTURE HARVESTER: a website and program for visualizing STRUCTURE output and implementing the Evanno method. Conservation Genetics Resources. 4, 359–361 https://doi.org/10.1007/s12686-011-9548-7 (2011).
- Jakobsson, M. & Rosenberg, N. A. CLUMPP: a cluster matching and permutation program for dealing with label switching and multimodality in analysis of population structure. Bioinformatics. 23, 1801–1806 https://doi.org/10.1093/bioinformatics/btm233 (2007).
Table 1. Characteristics of 9 SSR loci developed in Chamaecyparis formosensis.
|
Locus |
Primer sequences (5’ -3’) |
Repeat motif |
Fluorescent label |
Allele size (bp) |
Ta (°C) |
GenBank accession no. |
Putative function [organism] |
|
Cred603 |
TTGCTACATTAGCACTAGATAGCAAAGAAA |
(AAG)13 |
6-FAM |
106 |
60 |
MW052386 |
No hit |
|
|
ACTGAAGATACTGAGGATATTGAAGAGGAA |
|
|
|
|
|
|
|
Cred610 |
TGAGATATACATGTGTGAAAGAGAGTGAAGC |
(GTAT)5 |
PET |
166 |
60 |
MW052387 |
No hit |
|
|
TGCAATAATTTCTTCAGTGTTACCACTACC |
|
|
|
|
|
|
|
Cred628 |
GCTGGAGTCATTATAGTGCCATGTCTTTGT |
(GCCC)3 |
6-FAM |
142 |
60 |
MW052388 |
No hit |
|
|
TTTTCAAATAGCCGACCGACCTATGTAGAG |
|
|
|
|
|
|
|
Cred640 |
ACCCATATCTTCCTTCCCAACCATTAAGAT |
(TCTT)5 |
6-FAM |
137 |
60 |
MW052389 |
No hit |
|
|
CTTTCAGTGGAATGGAAGAAAGCCCTACTA |
|
|
|
|
|
|
|
Cred641 |
ACTTCTAATGAATCCCCATGCCGAATTGTA |
(GC)19 |
VIC |
193 |
60 |
MW052390 |
No hit |
|
|
CTGTTCGCGATAAGATAATTGGCTAGTGTG |
|
|
|
|
|
|
|
Cred674 |
TAAAGAGGCTCTGCTACTGGCTTTTCAACT |
(GGGC)4 |
NED |
147 |
60 |
MW052391 |
No hit |
|
|
GTGGGTGGCCCTCTATTCTATTGTTGAT |
|
|
|
|
|
|
|
Cred678 |
GGTCCATATCCTGGAGTAGAACCTCCCTAC |
(GGGC)5 |
PET |
162 |
60 |
MW052392 |
No hit |
|
|
GTGTCGCAGGCATAGACTTCTCCCTATATT |
|
|
|
|
|
|
|
Cred682 |
CCGCCCTTCTAATAACAGGGAAGATAAGTT |
(CCCT)5 |
NED |
147 |
60 |
MW052393 |
No hit |
|
|
CCGCCCTTCTAATAACAGGGAAGATAAGTT |
|
|
|
|
|
|
|
Cred683 |
GCAGCCTAAATAAACAATAGGGGGATTGAT |
(GCCT)4 |
NED |
146 |
60 |
MW052394 |
No hit |
|
|
CATGTTACGTATAGAATCGAGTGCAGGTCA |
|
|
|
|
|
|
Table 2. Genetic characterization of 36 polymorphic SSR loci of 92 Chamaecyparis formosensis individuals. A number of alleles, Ho observed heterozygosity, He expected heterozygosity, PIC polymorphism information content or power of information content, PD power of discrimination, PI probability of identity, PD is equal to 1 – PI. *Highly significant from Hardy-Weinberg equilibrium (P < 0.001). Significant linkage disequilibrium (P < 0.001) was detected in the same colored pairs.
Table 3. The discrimination power in SSR marker combination. CPI cumulative random probability of identity, CL = (1- CPI)N , N number of individuals.
Table 4. Pairwise Fst and Nm among four populations of Chamaecyparis formosensis using 36 simple sequence repeat (SSR) data. Fst < 0.05, no differentiation among populations. 0.05 < Fst < 0.15, low differentiation among populations. The gene flow value (Nm), Nm > 1 represents genes frequently exchange which counteracts the genetic drift and prevents the population differentiation42. When Nm is greater than 4, it would be a random mating population43.
Table 5. Chamaecyparis formosensis individual provenance simulation result. A total of 92 samples composed of 20 MM, 25 HV, 23 GW, and 24 SY individuals were subjected to provenance simulation. Correct provenance is 95.00% (MM), 88.00% (HV), 69.57% (GW), and 100.00% (SY), with an overall mean correct rate of 88.04%.
|
|
MM (N=20) |
HV (N=25) |
GW (N=23) |
SY (N=24) |
Over all (N=92) |
|
Sum of correct samples |
19 |
22 |
16 |
24 |
81 |
|
Correct cluster (%) |
95.00 |
88.00 |
69.57 |
100.00 |
88.04 |
No competing interests reported.
- Individualidentificationsystemofredcypresssupplementary.docx
Supplementary 1-3