Plasma EBV miRNA Profiles Reveal Potential Biomarkers for Clinical Prognosis of Acquired Immunodeficiency Syndrome-related Lymphoma

doi:10.21203/rs.3.rs-49452/v1

Background Acquired Immunodeficiency Syndrome-related lymphoma (ARL) is closely related to Epstein-Barr virus (EBV) infection. However, there are few studies on the occurrence and development of EBV miRNAs in ARL patients.

Methods The plasma of 5 EBV-infected ARL patients and 8 EBV-infected HIV patients were screened for EBV miRNAs differentially expressed between the two groups through EBV microRNA quantification chip. The plasma of 35 EBV-infected ARL patients and 20 EBV-infected HIV patients was verified by qRT-PCR expanded samples. And we gave a further analysis of the correlation between differentially expressed EBV miRNAs and clinical prognosis indicators in ARL patients.

Results 1. There were differential expressions of EBV miRNAs in the plasma of EBV-infected ARL patients and EBV-infected HIV patients. It was found that EBV-miR-BART2-5p,EBV-miR-BART8-3p,EBV-miR-BART15, EBV-miR-BART19-5p expression was significantly up-regulated and EBV-miR-BART9-5p expression was significantly down-regulated; 2. EBV microRNAs with significantly different expressions in the screening results were expanded and verified by qRT-PCR, and the differential expression was found to be consistent with the screening results; 3. The relative expression levels of EBV-miR-BART8-3p in plasma were positive correlated with the International Prognostic Index (IPI) score of Lymphoma(r = 0.37,P = 0.03),EBV-miR-BART19-5p was positive correlated with B symptoms (r = 0.42,P = 0.01) and EBV-miR-BART9-5p, was positive correlated with Eastern Cooperative Oncology Group (ECOG) scores (r = 0.35,P = 0.04).

Conclusions The expression of EBV-miR-BART2-5p, EBV-miR-BART8-3p, EBV-miR-BART15,EBV-miR-BART19-5p,EBV-miR-BART9-5p in ARL patients were highly different; and EBV-miR-BART8-3p, EBV-miR-BART19-5p, EBV-miR-BART9-5p could be used as the biomarkers for the prognosis of ARL.

Cancer Biology

Oncology

EBV

microRNA

lymphoma

HIV

Prognosis

Epstein-Barr virus (EBV) is the first human tumour virus to be discovered [1]. EBV mainly establishes infection in two types of cells, lymphocytes and epithelial cells, and exists for a long time in the host,which is the cause of many malignancies, including nasopharyngeal carcinoma (NPC), EBV-associated gastric cancer (EBVaGC) as well as AIDS-related lymphoma (ARL) and lymphoproliferative disease (PTLD) after transplantation [1, 2]. EBV has two infection states in the human body, namely latent infection and lytic infection. The latent infection period can be divided into 4 types: latent period 0, I, II and III [3]. EBV infections in different periods have been proved to promote the occurrence and development of EBV-related tumors[1, 4]. MicroRNAs (miRNAs) are a group of non-coding small RNAs, consisting of 19–25 nucleotides, which directly bind to the 3'-untranslated region (3'-UTR) of mRNA, promote mRNA degradation and inhibit its translation gene regulation[2]. EBV was the first virus found to encode miRNAs [5]. So far, previous studies have found that there were 44 mature miRNAs encoded by EBV : (40 mature miRNAs encoded by 22 miRNA precursors (miR-BART1-22) in BamHI-A region right transcript (BART) encodes and 4 mature miRNAs produced by 3 miRNA precursors(miR-BHRF1-1, -2, -3) expressesed in BamHI fragment H opens to the right Reading frame 1 (BHRF1) [5, 6]. EBV miRNAs are expressed differently during different infection periods. Among them, miR-BARTs are expressed in all types of incubation periods, especially in incubation periods I and II, while miR-BHRF1s are more common in cells infected in incubation period III and lysis periods[7, 8]. At present, there are many studies on the occurrence and development of EBV miRNAs in nasopharyngeal carcinoma, but such studies are few in AIDS-related lymphoma patients. Studies have reported that compared with non-HIV-infected patients with EBV-positive Diffuse large B-cell lymphoma (DLBCL), the expression of the three miR-BHRF1s is higher in patients with AIDS and DLBCL[6].

In this study, we firstly performed differential expression analysis of EBV miRNAs in 13 blood samples of patients with AIDS and lymphoma. Then, these results were verified by 55 patients. Whether thesse EBV miRNAs could be the biomaker for clinical prognosis were be tested by ROC analysis.

Research Subjects

The study included 55 HIV-1 patients with EBV infection admitted to the AIDS ward of the First Affiliated Hospital of Zhejiang University School of Medicine. The average age was 47 years old, 48 male patients and 7 female patients. Of these, 35 were lymphoma patients (including 1 Hodgkin lymphoma patient, 34 non-Hodgkin lymphoma patients, 1 non-Hodgkin lymphoma patient, 1 plasmablastoma patient, 7 Burkitt lymphoma Tumor patients, 7 patients with high-grade B-cell lymphoma, 19 patients with diffuse large B-lymphoma). Twenty patients were non-lymphoma patients as a control group. Other basic information is shown in Table 1. The study was approved by the Ethics Committee of the First Affiliated Hospital of Zhejiang University School of Medicine (Approved No. of ethic committee: 2018764), and all patients signed an informed consent. Collect the whole blood specimens of 55 patients, routinely separate the plasma, and store in the refrigerator at -80 ℃ for future use.

Table 1

The description of the study population
Category	ARL(n = 35)	The controls(n = 20)	P-value
Age	45.29 ± 11.40	50.10 ± 15.73	0.50
Sex			0.24
male	91.43%(32/35)	80.00%(16/20)
female	2.86%(3/35)	20.00%(4/20)
CD4⁺Tcell count(cells/mm3)	153.00[93.00,271.00]	260.50[115.50,422.00]	0.85
CD4⁺/CD8⁺	0.41[0.22,0.87]	0.25[0.16,0.54]	0.55
HAART			0.11
2NRTIs + NNRTIs	57.14%(20/35)	50.00%(10/20)
2NRTIs + INSTIs	34.29%(12/35)	20.00%(4/20)
Others	2.86%(3/35)	30.00%(6/20)
HHART: highly effective antiretroviral therapy; NRTIs: nucleotide reverse transcriptase inhibitors; NNRTIs: non-nucleotide reverse transcriptase inhibitors; INSTIs: integrase inhibitors

RNA extraction

Remove the plasma sample, centrifuge at 3000G for 5 min after thawing, add 750 ul TRIZOL-LS (Invitrogen, NO. MAN0000806) to the supernatant, vortex for 5 s, and incubate at room temperature for 5 min. Add 0.2 ml of chloroform per 1 ml of homogenized sample and vortex for 15 s, then incubate for 3 min. Centrifuge at 13000G for 15 minutes at 4 ° C. Isopropanol was added to the aqueous phase layer, and after standing at 4 ° C for 30 minutes, it was centrifuged at 13000 G at 4 ° C for 15 minutes. Remove the supernatant and add 1 ml of 75% ethanol to each 1 ml of homogenized sample to wash the RNA pellet. Let stand for 10 min, then centrifuge at 10000G for 5 min at 4 ° C. Precipitate the RNA in the air for 5–10 min, add RNA-free water to elute the RNA, and measure the optical density (OD) at 260 nm, 260/280 ratio using a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) ) To assess the concentration and purity of RNA, and finally stored at -80 ℃.

Synthesis of cDNA

Add 1 µl of ATP (10 mM) to the reaction system, 1 µl of 10X A-Plus Reaction Buffer, 700 ng of RNA sample, 0.5 µl of A-Plus Poly (A) Polymerase (4U / µl), 0.2 µl of RNase inhibitor (40U / µl), Add RNase-free water to a total volume of 10 µl. After incubating at 37 ° C for 10 minutes, add oligo dT linker primer miR-RT (5'GTCGGTGTCGTGGAGTCGTTTGCAATTGCACTGGATTTTTTTTTT TTTTTTTTV3 ') 1 µl and downstream primer U6 (5'CGCTTCACGAATTTGCGTGTCAT3') 0.3 µl, mix at 60 ° C for 5 min, add dNTP (2.5 mM) 10X RT Buffer 2 µl, MMLV reverse transcriptase (10U / µl) 0.4 µl, RNase inhibitor (40u / µl) 0.3 µl to a total volume of 20 µl. Incubate at 30 ° C for 60 minutes, incubate at 85 ° C for 5 minutes, and store at -20 ° C until use.

EBV miRNAs gene chip screening differential expression and data analysis

Through the miRBase database (version 22.1, http: // www, mirbase.org/), 44 mature miRNA sequences of EBV were retrieved. The miR-423-5p sequence was used as an internal reference. Entrusted Shanghai Kangcheng Biology to customize the chip. Plasma samples of 13 HIV-1 infected patients (5 combined lymphomas and 8 non-lymphomas) were randomly selected for high-throughput screening. Use the software attached to the PCR instrument (QuantStudio5 Real-time PCR System (Applied Biosystems)) to perform preliminary data analysis to obtain the original Ct value, and then use GenEx qPCR analysis software (www.exiqon.com/mirna-pcr-analysis) for standardization and in-depth data analysis. Finally, the expression difference of the two groups of corresponding genes was calculated by 2-ΔΔCt, and the EBV miRNAs with obvious expression differences were further verified by the following expanded sample.

Verification of differentially EBV miRNAs expression by qRT-PCR

qRT PCR reaction system is 2 × Master Mix 5 µl, forward and reverse EBV miRNA primers (see Table 2) 0.5 µl, add water to a total volume of 8 µl, centrifuge briefly at 5000 rpm, and sequentially add to the 384-PCR well plate, each add 2 µl of cDNA to the well, cover with sealing film and centrifuge briefly. The specific PCR reaction program is 95 ℃, 10 min; 40 PCR cycles (95 ℃, 10 seconds; 62 ℃, 60 seconds).

Table 2

qRT-PCR primers of EBVmiRNAs
Gene name	Bidirectional primer sequence	Product length (bp)
hsa-miR-423-5p	F:5’TGAGGGGCAGAGAGCGAGA3’ R:5’GTGCGTGTCGTGGAGTCGTT3’	77
hsa-miR-191-5p	F:5’CAACGGAATCCCAAAAGCAG3’ R:5’GTGCGTGTCGTGGAGTCGTT3’	77
hsa-miR-93-5p	F:5’AAAGTGCTGTTCGTGCAGGTAG3’ R:5’GTGCGTGTCGTGGAGTCGTT3’	77
EBV-miR-BART2-5p	F:5’TATTTTCTGCATTCGCCCTTG3’ R:5’GTGCGTGTCGTGGAGTCGTT3’	76
EBV-miR-BART8-3p	F:5’GGTCACAATCTATGGGGTCGTA3’ R:5’GTGCGTGTCGTGGAGTCGTT3’	78
EBV-miR-BART9-5p	F:5’TACTGGACCCTGAATTGGAAAC3’ R:5’GTGCGTGTCGTGGAGTCGTT3’	76
EBV-miR-BART15	F:5’GGTCAGTGGTTTTGTTTCCTTG3’ R:5’GTGCGTGTCGTGGAGTCGTT3’	77
EBV-miR-BART19-5p	F:5’CATTCCCCGCAAACATGACAT3’ R:5’GTGCGTGTCGTGGAGTCGTT3’	76

Data analysis

The results of the differential expression levels of EBV miRNAs are expressed in standard errors. The non-parametric chi-square test is used to evaluate the difference analysis of EBV miRNAs between the ARL group and the control group; Spearman rank correlation coefficients are used to test the expression levels of EBV miRNAs and clinical indicators. Correlation between dehydrogenase (LDH), B symptoms, international prognostic index score (IPI score), Eastern Cooperative Oncology Group score (ECOG score), etc. ROC curve analysis was used to evaluate the sensitivity and specificity of EBV miRNAs as biomarkers for ARL prognosis evaluation. The study used SPSS 26.0 software for statistical analysis, P < 0.05 was considered statistically significant.

Differential expression of EBV miRNAs in ARL patients

In this study, 2-ΔΔCt was used to calculate the differential expression multiples of EBV miRNAs between ARL and the control group, and the P values were plotted as scatter plots, volcano plots, and histograms (Fig. 1A-C), and then screen based on the condition that the CT value is less than 35. Compared with the control group,, finally screen out EBV-miR-BART2-5p, EBV-miR-BART8-3p, EBV-miR-BART15, EBV-miR-BART19-5p EBV-miR-BART9-5p 5 EBV miRNAs were up-regulated.and EBV-miR-BART19-5p was down-regulated.

Expanded sample qRT-PCR verification

Further expanded sample qRT-PCR verification found that EBV-miR-BART2-5p, EBV-miR-BART8-3p, EBV-miR-BART15, EBV-miR-BART19-5p expression was significantly up-regulated and EBV-miR-BART9-5p expression was significantly down-regulated, the results are consistent with the screening results (see Fig. 2).

The expression of EBV-miR-BART8-3p, EBV-miR-BART19-5p and EBV-miR-BART9-5p in patients with ARL is related to clinical prognosis

We used the Spearman rank correlation coefficient for analysis and found that in ARL patients, the expressions of EBV-miR-BART8-3p, EBV-miR-BART19-5p and EBV-miR-BART9-5p were associated with IPI score, ECOG score and the occurrence of B symptoms. The relative expression levels of EBV-miR-BART8-3p in plasma were positive correlated with the International Prognostic Index (IPI) score of Lymphoma(r = 0.37,P = 0.03),EBV-miR-BART19-5p was positive correlated with B symptoms (r = 0.42,P = 0.01) and EBV-miR-BART9-5p, was positive correlated with Eastern Cooperative Oncology Group (ECOG) scores (r = 0.35,P = 0.04). (Fig. 3A-C).We used the clinical outcome of ARL patients to achieve complete remission after clinical chemotherapy as a clinical outcome, and found that EBV miRNAs were superior to IPI scores in ARL prognosis judgment (Fig. 4).

EBV expresses high levels of miRNAs at all stages of its life cycle, indicating that these miRNAs may be involved in the interaction between EBV and the host immune system [9]. More and more studies have found that EBV miRNAs can promote cell proliferation and transformation by targeting host mRNA and inhibit cell apoptosis[10]. In addition, EBV miRNAs can also suppress the expression of viral antigens, thereby allowing infected cells to escape immune recognition[11]. More interestingly, EBV miRNAs can directly suppress the host's antiviral immunity by interfering with antigen presentation and immune cell activation [12]. In ARL patients, there are few studies on the expression characteristics and related clinical significance of EBV miRNAs.

In this study, we collected blood samples from 55 HIV-1 infected people and found the higher expression of EBV-miR-BART2-5p, EBV-miR-BART8-3p, EBV-miR-BART15, EBV-miR-BART19-5p and lower expression of EBV-miR-BART9-5p in ARL patients compared with no-ARL.

Currently, the IPI score is the most commonly used prognostic evaluation system for patients with lymphoma[13].

At present, the IPI score is the most commonly used prognostic evaluation system for patients with lymphoma [13]. Clinicians evaluate the prognosis of patients by scoring five items: patient age, lymphoma stage, ECOG score, extranodal lesions, and LDH. These projects involve a variety of blood, ultrasound, PET-CT and other tests, which consume a lot of medical resources. Our research and further analysis found that the relative expression of EBV-miR-BART8-3p, EBV-miR-BART19-5p and EBV-miR -BART9-5p in plasma is correlated with ARL's IPI score, ECOG score and the occurrence of B symptoms. -miR-BART9-5p, which can be used as a biomarker for prognosis evaluation, can more easily achieve prognosis evaluation, and is better than IPI score in prognosis judgment. ECOG as a system for evaluating the physical status of patients with lymphoma can better assess the tolerance of patients to treatment. Our research results found that the expression level of EBV-miR-BART19-5p can also be used as a reference marker for this evaluation.

Related research further studies the mechanism of EBV miRNAs in promoting tumorigenesis and development. RND3 is a miR-BART2-5p targeting gene. RND3 is related to apoptosis, cell cycle arrest and cell differentiation[14]. According to reports, in nasopharyngeal carcinoma, miR-BART2-5p has potential value in promoting nasopharyngeal carcinoma tumor metastasis and its use as a prognostic indicator or therapeutic target [15]. There are also reports that miR-BART2-5p can be used as an early detection indicator for patients with nasopharyngeal carcinoma [16]. Experiments have shown that miR-BART8-3p can regulate ataxia telangiectasia mutations / ataxia telangiectasia mutations and Rad3 (ATM / ATR) The activity of related signaling pathways promotes NPC's radiation resistance [17]. MiR-BART15 is capable of targeting nucleotide-bound oligomerization domain-like receptor family pyridine domain-containing 3 (NLRP3) with less inflammation to limit inflammation and promote EBV infection [18]. LMP1 is a transmembrane latent protein encoded by EBV, which is essential for cell proliferation and transformation [19], but overexpression of LMP1 will inhibite cell proliferation, and increase the sensitivity of cells to pro-apoptotic stress [20]. According to previous reports, miR-BART19-5p can inhibit the expression of LMP1, thereby maintaining a balance between the growth-promoting effect of LMP1 and its pro-apoptotic function [10]. We infer that the EBV miRNAs found in our research may also be through similar molecular mechanisms It led to the occurrence and development of ARL and led to different clinical outcomes.

In the next stage of research, we will predict the target genes of differentially expressed EBV miRNAs and obtain relevant cell signaling pathways through further analysis to further reveal and clarify the role and mechanism of EBV miRNAs in the development and development of ARL for the prognosis of ARL provide a basis for judging and finding new therapeutic targets.

This study found that the differentially expressed EBV miRNAs in ARL patients are closely related to the clinical prognostic indicators (IPI score, ECOG score, and lymphoma B symptoms) of ARL patients, and can be used as biomarkers for ARL prognosis assessment.

ARL：Acquired Immunodeficiency Syndrome-related lymphoma

EBV：Epstein-Barr virus

miRNAs：microRNAs

BART：BamHI-A region right transcript

DLBCL：Diffuse large B-cell lymphoma

IPI：International Prognostic Index

ECOG： Eastern Cooperative Oncology Group

Ethics approval and consent to participate

All procedures conducted in this study involving human participants were performed in accordance with the ethical standards of the Hospital Institutional Research Council and the 1964 Helsinki Declaration and its subsequent revisions or similar ethical standards.

This study was approved by the ethics committee of the First Affiliated Hospital of Zhejiang University School of Medicine (Approval No. 2018764), and Chinese Clinical Trial Registry ( ChiCTR, ChiCTR1900023600 . Registered 3 June 2019, http://www.chictr.org.cn/usercen ter.aspx ).

The study has obtained informed consent from all study participants.

Consent for publication

Not applicable

Availability of data and materials

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Competing interests

All authors declare that they have no potential or actual competitive interests, economic issues or personal relationships with others or organizations to influence their research work.

Funding

This work was supported by the National Special Research Program for Important Infectious Diseases（grant numbers: 2017ZX10202102-002-002; 2018ZX10715-014-004）.

Authors' contributions

ZB conceived and designed the study. CY and GYZ performed the experiments. HY and XY collected and analyzed the clinical data. CY and PXL wrote the manuscript. ZB revised the manuscript. All authors read and approved the final manuscript.

Acknowledgments

We would like to thank the native English speaking scientists of LetPub Company for editing our manuscript.

Plasma EBV miRNA Profiles Reveal Potential Biomarkers for Clinical Prognosis of Acquired Immunodeficiency Syndrome-related Lymphoma

Status:

Version 1

Abstract

Figures

Background

Methods

Research Subjects

RNA extraction

Synthesis of cDNA

EBV miRNAs gene chip screening differential expression and data analysis

Verification of differentially EBV miRNAs expression by qRT-PCR

Data analysis

Results

Differential expression of EBV miRNAs in ARL patients

Expanded sample qRT-PCR verification

The expression of EBV-miR-BART8-3p, EBV-miR-BART19-5p and EBV-miR-BART9-5p in patients with ARL is related to clinical prognosis

Discussion

Conclusion

List of Abbreviations

Declarations

References

Status:

Version 1