This study elucidates Theileria annulata’s manipulation of host cell signaling using phosphoproteomic and transcriptomic approaches. We unveil the parasite's control over multiple cellular processes, including apoptosis, calcium/calmodulin-dependent protein kinase (CAMK) regulation, and telomere maintenance. A central finding of our study is the parasite's targeted manipulation of the ERK1/2 pathway, a key regulator of cellular proliferation and survival. By orchestrating the phosphorylation of essential transcription factors, T. annulata ensures its persistence within the host cell. Importantly, our data demonstrate that pharmacological inhibition of ERK signaling triggers apoptosis in infected cells, establishing this pathway as a promising therapeutic target. Beyond host manipulation, we characterize parasite phosphoproteins and transcription factors, revealing insights into Theileria's complex lifecycle and adaptive mechanisms. These findings collectively contribute to a more comprehensive understanding of the Theileria-host interaction, paving the way for the development of innovative therapeutic interventions to combat this economically significant disease.
Research Article
Theileria annulata Hijacks Host Signaling: Integrated Phosphoproteomics and transcriptomics Unveils ERK1/2 as a Central Regulator of Host Transcription Factors
https://doi.org/10.21203/rs.3.rs-4975647/v1
This work is licensed under a CC BY 4.0 License
Version 1
posted
You are reading this latest preprint version
Theileria annulata
bovine theileriosis
cancer-like transformation
phosphoproteomics
transcriptomics
kinase-mediated signaling
transcription factor regulation
Theileria annulata, a tick-borne apicomplexan parasite, is the causative agent of tropical theileriosis, a disease of significant economic burden to the cattle industry across Asia, Africa, and Southern Europe 1. This tick-borne disease results in substantial production losses, highlighting the need for improved control strategies. The parasite targets lymphocytes, crucial components of the adaptive immune system, leading to a spectrum of debilitating clinical manifestations, including pyrexia (fever), anemia, and lymphadenopathy. Despite its substantial economic and agricultural impact, our understanding of the intricate molecular mechanisms employed by T. annulata to manipulate host cell signaling cascades and establish a successful infection remains incomplete. While some studies have explored these mechanisms 2,3, a comprehensive understanding is still lacking. This knowledge gap hinders the development of effective control strategies for tropical theileriosis. Developing effective strategies to combat T. annulata infection necessitates a deeper understanding of the intricate molecular mechanisms underlying parasite-host interactions.
Infection of bovine leukocytes by Theileria parasites triggers a profound reprogramming of host cell signaling cascades 4. This manipulation results in a transformed phenotype, characterized by dysregulated proliferation and the acquisition of replicative immortality 1,5. Intriguingly, a viable parasite is essential for both transformed cell survival and phenotype, indicating these changes are driven by manipulated signaling and gene expression5. Theileria infection disrupts host leukocyte signaling, evidenced by altered kinase activity and protein phosphorylation 6. Protein phosphorylation is a fundamental regulatory mechanism in eukaryotic cells, governing a wide range of cellular processes 7. Kinases, a class of enzymes responsible for attaching phosphate groups to proteins, act as key regulators of signaling cascades that govern cell growth, survival, and differentiation. Theileria parasites orchestrate intricate posttranslational modifications (PTMs) within their host cells to manipulate essential processes and establish successful infections. For instance, constitutive NF-κB activation safeguards Theileria-transformed cells from apoptosis 8. Similarly, AP-1-driven MMP9 expression facilitates Theileria-infected leukocyte dissemination 9.
While the complete PTM landscape remains undiscovered, phosphorylation events mediated by kinases are recognized as crucial regulators. Previous studies have shown that Theileria-transformed cells activate a diverse array of kinases to sustain transformed cell survival, including mitogen-activated protein kinases (MAPKs), c-Jun N-terminal kinase (JNK), SRC family kinases, casein kinase-2 (CK2), and phosphatidylinositide 3-kinase (PI3K) and polo-like kinase 1 (Plk1) 3,6,10–16. Parasite proteins like p104 (sequestering JNK2) and secreted TaPIN1 (stabilizing c-Jun) have been shown to contribute to this manipulation 13,17. However, the exact mechanisms triggering such activations in these parasitized cells remain largely unknown. This coordinated activation of multiple signaling pathways by the parasite likely represents a mechanism to manipulate host cell cycle progression and survival, highlighting the need for further investigation. These findings highlight the importance of kinases in Theileria's life cycle. However, a comprehensive understanding of the host and the parasite's kinomes and its influence on PTM profiles during infection requires further exploration using advanced phosphoproteomic techniques. Unraveling the parasite's kinome and its impact on PTMs holds significant promise for identifying novel therapeutic targets and developing effective control strategies for Theileria-induced diseases. Traditional approaches for studying protein phosphorylation often rely on the investigation of specific kinases or known signaling pathways. However, these methods may miss crucial, yet unidentified, phosphorylation events. Global phosphoproteomics, a powerful technique that comprehensively analyzes and quantifies protein phosphorylation across the entire cellular proteome, offers an unbiased approach to uncover the global kinase-mediated signaling landscape during T. annulata infection.
In this study, we leverage the power of global phosphoproteomics and transcriptomics to investigate the kinome landscape in bovine lymphocytes infected with T. annulata. We employ high-throughput mass spectrometry to identify and quantify phosphopeptides, providing a comprehensive view of protein phosphorylation events triggered by the parasite. By comparing the phosphoproteome profile of infected cells to uninfected controls, we aim to identify differentially phosphorylated proteins and associated kinases. Our investigation identified novel phosphorylation sites within host and parasite proteins mediated by T. annulata. We have also demonstrated the intricate regulation of multiple transcription factors (TFs) by kinases. Furthermore, RNA-sequencing analysis of hallmarks associated with cancer reveal the profound influence of these TFs on gene expression. These findings underscore the critical role of these factors in promoting the observed proliferative phenotype in T. annulata-transformed cells. Deciphering the complex interplay within host cell signaling pathways elicited by T. annulata lays the groundwork for the discovery of novel therapeutic targets, with the potential to revolutionize our approach to combating this pathogen.
Data-Independent Acquisition and Label-Free Quantification Reveal Dynamic Phosphorylation Events During T. annulata Infection
Our investigation employed data-independent acquisition (DIA) coupled with label-free quantification to comprehensively analyze T. annulata-induced cellular signaling in lymphocytes. This approach enabled identifying and quantifying proteins from infected (TA) and non-infected (BL3) cells (Supplementary Fig. 1). The high quality and reproducibility of the data were confirmed by a strong correlation coefficient (R = 0.83) between biological replicates (Fig. 1a). Analysis of the host phosphoproteome indicated a substantial enrichment of phosphoserine (pS) residues (86.81%), with phosphothreonine (pT, 12.06%) and phosphotyrosine (pY, 1.15%) present at lower levels (Fig. 1b). The web logo (Fig. 1c) further visualizes the frequency of these modifications at specific amino acid positions (S/T/Y). Interestingly, most proteins (65%) harbored modifications at a single site, with a decreasing proportion exhibiting modifications at multiple sites (Fig. 1d). The analysis identified a total of 616 and 383 phosphorylated proteins in TA and BL3 cells, respectively (Fig. 1e, Supplementary Table 1). Notably, 364 proteins were unique to TA cells, suggesting parasite-induced phosphorylation events. Gene ontology analysis of these uniquely phosphorylated proteins highlighted potential pathways specifically regulated during infection, including negative regulation of apoptosis and positive regulation of telomere maintenance (Fig. 1.f). These findings suggest T. annulata may manipulate host cell survival and telomere integrity. We leveraged posttranslational modification (PTM) scores to elucidate differentially phosphorylated events. Stringent criteria were implemented to define a high-confidence set of class I phosphosites (n = 934) corresponding to 400 proteins based on a localization probability threshold of ≥ 0.75 (Fig. 1g). Principal component analysis (PCA) confirmed distinct clustering patterns between BL3 and TA samples based on these phosphosites (Fig. 1h). An additional filter was incorporated, requiring the presence of the modified site in at least 50% of the samples within each group. This resulted in 433 class I phosphopeptides qualifying for further analysis. Subsequent analysis using ANOVA identified 147 significantly altered phosphopeptide (Supplementary Table 2). A heat map (Fig. 1i) visualizes the expression patterns of these differentially phosphorylated peptides. Examples of upregulated protein in TA cells include E3 ubiquitin-protein ligase (TRIP12), Nucleophosmin (NPM1), Lymphocyte cytosolic protein 1 (LCP1), Pinin (PNN), and dual-specificity kinase (DYRK1B). For example, the phosphorylation intensity of NPM1 at serine 70 is depicted in Fig. 1j. These findings provide a comprehensive overview of the dynamic phosphorylation landscape induced by T. annulata infection. Identifying differentially phosphorylated proteins paves the way for further investigation into their functional roles during infection.
Dissecting T. annulata's Impact on Host Cell Response through Phosphoproteomics
To dissect the intricate interplay between T. annulata signaling pathways and host cell posttranslational regulation, a targeted pharmacological approach was employed to achieve parasite clearance in infected lymphocytes. This strategy facilitated a comprehensive analysis of the parasite's impact on the host phosphoproteome and the subsequent host cellular response following parasite elimination. Infected lymphocytes (TA cells) were treated with BPQ (200 ng/ml), a well-established anti-Theilerial drug 18. To assess cell viability over time, a trypan blue exclusion assay was performed. This assay revealed a progressive increase in cellular death, with statistically significant effects observed at 72 and 96 h post-treatment (Fig. 2.a). Concomitant Western blotting analysis corroborated successful parasite clearance, evidenced by a reduction in TaSP (TA17315) expression at these time points (Fig. 2b). Based on these findings, the 96h time point was chosen for subsequent comparative phosphoproteomic analysis of treated (TA-BPQ) and untreated (TA) cells.
We leveraged the established DIA-LFQ workflow for a comparative phosphoproteomic analysis. This approach aimed to identify changes in phosphorylation patterns and expression levels of individual phosphopeptides in both host and parasite proteomes. Four replicates per condition were used to ensure robust statistical analysis. A total of 616 host proteins with 1427 phosphorylation sites were identified in TA cells. Upon BPQ treatment, 244 proteins (533 phosphorylation sites) exhibited a loss of phosphorylation, while 34 gained new phosphorylation sites (Fig. 2c and 2d, Supplementary Table 3). Functional enrichment analysis on dephosphorylated host proteins revealed diverse cellular processes impacted by BPQ treatment, including DNA replication, apoptosis regulation, protein modification, RNA splicing, signal transduction, and symbiosis regulation (Supplementary Fig. 2). Interestingly, some of these processes, like regulation of CAMKK-AMPK signaling and negative regulation of apoptotic processes, were also enriched in the phosphoproteome unique to T. annulata-infected cells compared to uninfected controls (BL3). Furthermore, differential expression analysis identified 57 host cell phosphosites significantly regulated upon parasite clearance (Fig. 2e, Supplementary Table 4). Key downregulated proteins included RNA-binding motif protein 15 (RBM15), nucleophosmin 1 (NPM1), ubiquitin-specific peptidase 8 (USP8), FOSL2 (FRA2), hepatocyte growth factor (HDGF), and BCL2-associated factor 1 (BCLAF1). Notably, NPM1, previously observed to be upregulated in TA cells, displayed a decrease in phosphorylation (Y-67 and S-70) and protein expression upon parasite clearance, (Fig. 2f 2g). This suggests that these phosphorylation events might be crucial for NPM1 stabilization.
We also analyzed all three datasets (BL3, TA, and TA-BPQ) and revealed a distinct population of 465 phosphosites unique to TA cells (Fig. 2h). These infection-specific phosphorylation events likely represent the parasite's crucial regulatory mechanisms to manipulate host cell processes and establish a favorable environment for survival and replication. To unravel the functional significance of these unique phosphorylation events, we performed gene enrichment analysis on the corresponding proteins (n = 334) utilizing the DAVID bioinformatics tool. This analysis yielded critical insights into the biological processes potentially modulated by T. annulata infection (refer to Supplementary Fig. 3). The top five significantly enriched KEGG pathways included Nucleocytoplasmic Transport, Spliceosome Machinery, Cellular Senescence, MAPK Signaling Pathway, and mRNA Surveillance Pathways. The enrichment of these pathways suggests that T. annulata infection disrupts a multitude of cellular processes critical for host cell function. This orchestrated manipulation likely creates an environment conducive to parasite persistence within the host cell.
The parasite phosphoproteome exhibited a comparable overall profile to host, though with distinct phosphorylation site distribution. Phosphoserine residues constituted the predominant phosphorylation type (80%), followed by phosphothreonine (17.33%) and phosphotyrosine (2.66%). A comparative analysis revealed a significant downregulation of 48 phosphorylation sites across 32 parasite proteins following BPQ treatment (Figure i, Supplementary Tables 5 and 6). Notably, several key parasite proteins demonstrated a concurrent loss of phosphorylation and expression, including a microneme-rhoptry antigen (TA08425), cyclophilin (TA14055), splicing factor (TA06100), probable ATP-dependent 6-phosphofructokinase (TA13950), and RNA helicase (TA04765) (Fig. 2i). The decreased peptide intensity of TA08425 (104 kDa microneme/rhoptry antigen) in TA-BPQ compared to TA cells is depicted in Fig. 2j. For broader context, we compared our parasite phosphoproteomic data with the study by Wiens et al. (2014), which focused specifically on parasite proteins (Fig. 2k). Notably, our analysis of whole-cell lysate revealed some unique proteins compared to their schizont-enriched dataset. While potential sequence variations precluded a direct site-by-site comparison, we identified phosphorylation on the parasite protein TA08425 at six distinct sites. Four of these sites (S634, S640, S775, and S808) corroborated findings by Weins et al. (2014). Importantly, our data revealed two novel phosphorylation sites for this protein: S589 and S592 (Fig. 2.l).
These findings highlight the comprehensiveness of our phosphoproteomic analysis, encompassing both host and parasite components. This approach provides a more holistic understanding of the complex phosphorylation landscape during T. annulata infection, offering valuable insights into potential therapeutic targets and furthering our understanding of host-parasite interactions.
Phosphoproteomics-Guided Kinome Analysis: A Computational Approach Identifies Key Kinase Families in Host and Parasite
Infection with T. annulata significantly disrupts various host cell signaling pathways, as reflected by the enrichment of distinct signaling pathways within the identified phosphoproteome. Kinases are well-established master regulators of these pathways, and their dysregulation is implicated in numerous human diseases, including cancer. We employed in-silico kinase prediction utilizing the group-based prediction system (GPS) with the interaction filter (iGPS) to gain deeper insights into the upstream regulatory mechanisms governing these phosphorylation events. This computational tool leverages two complementary approaches: analysis of known kinase recognition motifs and protein-protein interaction databases. This combined strategy allows iGPS to predict kinases with the highest likelihood of phosphorylating specific protein sites. Next, we analyzed the regulatory landscape of kinases during T. annulata infection by leveraging phosphoproteomic analysis of both host and parasite components.
Specifically focusing on the host phosphoproteome, we investigated proteins exhibiting dephosphorylation following BPQ treatment. Using iGPS 1.0.1 predicted the kinases likely responsible for the observed phosphorylation events across 533 sites on 244 distinct proteins (Supplementary Table 7). Subsequently, we mapped these predicted kinase-substrate interactions onto the human kinome tree. This analysis revealed a diverse array of potentially involved kinase families, encompassing CMGC (e.g., CK2A, ERK1/ERK2, CDK2), CAMK (e.g., AMPKα1, AMPKα2, PKD1), AGC (e.g., AKT1, AKT2), CK1 (e.g., TTBK1, TTBK2, CK1α2), STE (e.g., MEK1, MEK2, YSK1), TKL (e.g., RAF1, BRAF1), TK (e.g., LTK, Fyn, Fgr), Atypical kinases (e.g., FRAP, DNAPK) and others (complete list). Interestingly, the CMGC family emerged as the most overrepresented group among the predicted kinase regulators (Fig. 3.a).
Given the considerably smaller kinome repertoire of T. annulata compared to the human host (52 reported kinases versus a much larger human kinome), a homology search was conducted to identify potential human counterparts for these parasite kinases. Notably, no tyrosine kinases were identified within the T. annulata kinome. The GPS 6.0 tool and its curated kinase-substrate relationship data were employed to predict upstream regulators responsible for parasite phosphoproteome modifications. A weightage score reflecting the potential importance of each predicted T. annulata kinase was assigned based on the number of predicted phosphorylation targets (lower score indicates higher potential significance). This data was then visualized using the CORAL kinome visualization tool (Fig. 3.b, Supplementary Table 8). The analysis revealed a diverse array of potential kinase families influencing parasite signaling pathways, including: CMGC (e.g., CLK2, ERK7, CDC2), CAMK (e.g., CaMK2α, CASK) and atypical kinases (e.g., RIOK3). Like the host analysis, the CMGC family emerged as the most prominent group among the predicted parasite kinase categories (Fig. 3.b). This intriguing observation suggests a potentially conserved role for CMGC kinases in regulating host and parasite signaling during T. annulata infection.
In conclusion, this phosphoproteomic exploration underscores the critical role of kinase families, particularly those belonging to the CMGC group, in regulating the intricate interplay between host and parasite signaling pathways during T. annulata infection.
T. annulata Infection Modulates Host Transcriptional Response by Phosphorylation of Key TFs
Building on our phosphoproteomic analysis that revealed a multitude of phosphorylated proteins, we delved deeper into their functional implications. Given the critical role of transcription factors (TFs) in gene regulation and the established effects of phosphorylation on TF activity, we specifically investigated phosphorylated TFs within T. annulata-infected cells. We identified a total of 19 transcription factors (TFs) within T. annulata-infected cells (TA) compared to the uninfected control group (BL3). Notably, twelve of these TFs exhibited distinct phosphorylation patterns upon infection, including MED14, SIN3A, BCL6, cJUN, NFATC1, STAT3, RUNX3, GTF2F1, MED1, JUNB, TLE3, and FOSL2 (Fig. 4a). Interestingly, subsequent treatment with BPQ resulted in the dephosphorylation and concomitant downregulation of seven of these TFs (MED14, SIN3A, BCL6, cJUN, NFATC1, STAT3, and RUNX3, but not JUNB). This observed correlation between phosphorylation status and protein abundance suggests a potential regulatory role for phosphorylation in governing TF functionality during T. annulata infection. To delve deeper into the downstream consequences of dysregulated TF activity, RNA sequencing (RNA-Seq) was performed on both BPQ-treated (72h & 96h) and control cells (Supplementary Table 9). Given the limited availability of established target genes for bovine TFs, human databases such as ENCODE, CHEA, and MotifMap4 were employed to identify potential downstream targets for eight of the identified TFs (STAT3, BCL6, RUNX3, cJUN, NFATC1, SIN3A, FOSL2, and GTF2F1) (Fig. 4b, Supplementary Fig. 4). Subsequent gene enrichment analysis utilizing DAVID revealed that cell cycle regulation emerged as a prominent pathway commonly impacted by all TFs except SIN3A (Fig. 4c). Differential expression analysis identified a significant downregulation in the transcripts of genes known to be regulated by these TFs (STAT3, BCL6, RUNX3, cJUN, NFATC1, FOSL2, and GTF2F1) after parasite clearance (Figs. 4d-i). Further investigation identified cMYC as a shared downstream target gene regulated by all seven TFs, with its expression gradually decreasing upon parasite clearance. RNA-Seq analysis confirmed these results, showing a gradual time dependent decrease in cMYC expression after BPQ administration. (Figs. 4j).
Although the phosphoproteomic analysis did not identify parasite-specific transcription factors (TFs), the RNA-Seq data provided valuable information (Supplementary Table 10). By interrogating the parasite transcriptome for genes annotated with the Gene Ontology (GO) term "sequence-specific DNA binding transcription factor activity" (GO:0003700), twelve putative parasite TFs were identified. Notably, eight of these TFs belonged to the ApiAP2 family, characterized by the presence of the AP2 domain (Fig. 4k). Interestingly, treatment with the anti-Theilerial drug BPQ resulted in differential expression patterns among these parasite TFs. Five members of the ApiAP2 family were downregulated, while three exhibited upregulation. The remaining four TFs, not belonging to the ApiAP2 family, all displayed downregulation upon BPQ treatment (Fig. 4.k).
This integrated phosphoproteomic and RNA-Seq approach sheds light on a novel regulatory mechanism employed by T. annulata. The parasite manipulates host cell signaling through targeted phosphorylation of TFs, potentially influencing the cell cycle pathway and cMYC expression. Additionally, the identification of parasite TFs opens avenues for future investigations into their role in parasite biology and potential therapeutic targets 19.
ERK1/2 Signaling Pathway Mediates Host Transcriptional Response During T. annulata Infection
In-silico analysis predicted ERK1/2 kinases as potential regulators of five transcription factors (TFs): FOSL2, cJUN, JUNB, RUNX3, and BCL6 (Fig. 5.a). This finding contrasted with prior studies suggesting no role for ERK1/2 in Theileria infection 14,20–22. To reconcile this discrepancy, we employed commercially available antibodies specific for the activated form of ERK1/2(phosphorylated threonine 202/204). Both immunoblotting and immunofluorescence assays (IFA) confirmed the presence and activation of ERK1/2 kinases within T. annulata-infected cells (Fig. 5.b-c). Furthermore, treatment with U0126, a well-established inhibitor of MEK, the upstream activator of ERK1/2, resulted in dephosphorylation of ERK1/2, validating the predicted role of these kinases in infected cells. We subsequently investigated the regulatory influence of ERK1/2 on the identified TFs. Antibodies targeting each TF (FOSL2, cJUN, phospho-cJUN (S73), JUNB, RUNX3, STAT3, and phospho-STAT3 (Y705)) were employed to assess protein expression and phosphorylation status. To strengthen the association between infection and TF regulation, we introduced additional experimental conditions: U0126 treatment to inhibit ERK1/2 and BPQ treatment to eliminate parasites.
Immunofluorescence analysis revealed prominent nuclear localization of FOSL2, RUNX3, JUNB, cJUN, and phospho-cJUN (S73) in T. annulata-infected cells (Fig. 5.d-m). Notably, inhibition of ERK1/2 with U0126 resulted in a significant decrease in the expression of these TFs. Similarly, parasite clearance via BPQ treatment mirrored the effect of U0126, demonstrating a reduction in all aforementioned TFs. Both STAT3 and phospho-STAT3 (Y705) were detected in infected cells; however, consistent with our in-silico predictions and prior observations, ERK1/2 inhibition did not affect STAT3 expression or phosphorylation (Supplementary Fig. 5). These findings bridge the gap in the existing literature and establish ERK1/2 as critical regulators of specific TFs during T. annulata infection. The activation of ERK1/2 appears to influence either directly or indirectly the expression and/or phosphorylation of FOSL2, cJUN, JUNB, and RUNX3, potentially impacting their transcriptional activity and the subsequent host cell response. To elucidate the functional role of FOSL-2, a key AP1 transcription factor, we employed siRNA-mediated knockdown (Fig. 5n-o). This approach revealed FOSL-2's critical role in both host cell proliferation and survival (Fig. 5p). These observations collectively suggest that FOSL-2 plays a vital part in the parasite's life cycle. Furthermore, inhibiting FOSL-2 likely disrupts a crucial pathway for parasite proliferation, potentially leading to a diminished parasite burden. To validate the in silico and transcriptome data suggesting a link between c-Myc and ERK1/2 signaling, we treated cells with U0126, an ERK1/2 inhibitor, and monitored c-Myc expression. U0126 treatment resulted in reduced c-Myc levels, supporting the hypothesis that ERK1/2 signaling plays a role in activating c-Myc (Fig. 5q). These findings demonstrate that host ERK1/2 signaling is necessary for c-Myc activation.
Our study highlights the crucial role of ERK1/2 signaling in Theileria survival. This pathway plays a central role in regulating parasite physiology by orchestrating directly or indirectly the phosphorylation of key transcription factors, including RUNX3, FOSL2, BCL6, c-JUN, JUNB, and c-Myc.
ERK1/2 Inhibition Impairs T. annulata Proliferation and Triggers Host Cell Apoptosis
To delineate the functional consequences of ERK1/2 inhibition, we assessed its impact on both Theileria annulata (TA) cell proliferation and host cell viability. A trypan blue exclusion assay revealed that U0126 treatment effectively halted TA cell proliferation by 24 h compared to untreated controls with sustained growth (Fig. 6a). This confirms U0126's ability to suppress TA cell expansion. Western blot analysis of PCNA, a marker of ongoing cellular proliferation, further corroborated this effect. U0126 treatment caused a time-dependent decrease in PCNA expression, solidifying its role in suppressing TA cell proliferation (Fig. 6b). Immunoblotting the parasite-specific protein TaSP showed a time-dependent reduction following U0126 treatment (Fig. 6b), suggesting a decline in parasite burden within infected cells. Additionally, cell death assays revealed a significant increase in dead TA cells within 48 h of U0126 treatment, reaching nearly 40% by 72 h (Fig. 6c). This aligns with the observed upregulation of cleaved caspase-3 (Asp175), a marker of apoptosis. Immunofluorescence analysis confirmed U0126-induced apoptosis, with cleaved caspase-3 (Asp175) levels substantially increased in treated cells at 48 h post-treatment compared to undetectable levels in untreated cells (Fig. 6d-e). Collectively, these findings demonstrate that U0126 disrupts ERK1/2 signaling, leading to a multi-pronged effect: (1) inhibition of TA cell proliferation, (2) reduction in parasite burden and (3) induction of host cell apoptosis. This highlights the critical role of ERK1/2 in promoting survival and proliferation pathways within TA cells.
By employing global phosphoproteomics this study aimed to shed light on the complex interplay between parasite and host cell signaling pathways. We performed an integrated global phosphoproteomic and transcriptomic analysis, revealing the striking impact of Theileria annulata on host cell signaling and cellular behavior. Identified phosphorylated proteins were used to generate a Theileria-responsive kinome network. Based on this, we identified the phosphorylation status of regulated transcription factors that are either direct or indirect MAPK/ERK substrates and demonstrated their important role in the resulting phenotype. The results reveal a substantially greater range of Theileria-regulated signaling cascades than previously appreciated and they provide a resource for generating deeper insights into their role in pathogenesis and potential host cell transformation. Deciphering the parasite's manipulation of the host kinome promises to advance our understanding of T. annulata pathogenesis and pave the way for the development of novel therapeutic strategies for combating tropical theileriosis.
While prior research has investigated global phosphorylation events in T. annulata schizont proteins, a critical knowledge gap persists in our understanding of host proteins and signaling used by the parasite during infection 3. We performed a phosphoproteomic analysis of infected, non-infected, and cured leukocytes to elucidate Theileria-induced signaling pathways. We performed a data-independent acquisition (DIA) for the analysis, allowing higher sensitivity and protein coverage than the classic data-dependent acquisition 23. Building on prior evidence that Theileria parasites disrupt host leukocyte signaling via altered kinase activity and protein phosphorylation 6, this study identified 465 host class 1 phosphorylation sites significantly modulated by parasite infection. Pathway analysis revealed the MAPK signaling pathway as a critical player. The MAPK pathway is well-established for its influence on diverse cellular processes, including proliferation 24. Notably, 14 proteins within this network exhibited phosphorylation specifically in Theileria-infected (TA) cells, with these modifications disappearing upon parasite clearance. These findings strongly suggest that T. annulata actively manipulates the MAPK pathway, reinforcing previous research that showed the importance of MAPK in Theileria pathogenesis 3,14,22. Bioinformatic analysis of phosphorylation sites significantly modulated by parasite infection revealed enrichment in processes critical for cancer development. These include (i) negative regulation of apoptosis, (ii) CAMK-mediated regulation, and (iii) positive regulation of telomere maintenance. This highlights the parasite's potential to manipulate these signaling pathways. Notably, Nucleophosmin (NPM1), an established oncogene, displayed parasite-dependent upregulation in infected cells (TA) compared to controls (BL3). Furthermore, our data revealed parasite-dependent phosphorylation of NPM1 at S70, a modification known to impact its stability in humans. CDKs are known to influence S70 phosphorylation and might play a role in Theileria infection 25. Therefore, future studies investigating targeted CDK inhibition in TA cells are warranted to elucidate their potential involvement in T. annulata-mediated regulation of NPM1.
Theileria infection is known to induce constitutive activation of specific host kinases, including PI3-K, JNK, CK2, and Src-family kinases 3,6,10–15. These activated kinases are believed to be critical in regulating the transformed phenotype observed in infected cells. In silico analysis of predicted kinase-substrate interactions identified kinase families, including CMGC, TK, TKL, STE, CK1, AGC, and CAMK, as potential regulators of host proteins exhibiting unique phosphorylation patterns during T. annulata infection. Future studies will be crucial to elucidate the functional consequences of these phosphorylation events. Most of the regulated phosphoproteins and the predicted upstream kinases identified in the present study have not been previously associated with the response to T. annulata infection. However, we did find certain kinases which were previously reported, such as CKII and CDK, to be present in our data, reinforcing their role during T. annulata infection 3,6,16,19,26. Adding to previous research we show CDK phosphorylation in Theileria-infected cells, particularly in CDK1NA, CDK12, CDK2, CDK11B, and CDK1. Building on the established role of PKM2 in Theileria-induced metabolic reprogramming 27, we identified phosphorylation at Ser-37 of PKM2 as a potential regulator. This modification might modulate the interaction between PKM2 and its stabilizer, TaPin1, thereby impacting HIF1α signaling 17. These findings suggest a novel mechanism in Theileria pathogenesis, warranting further investigation of this regulatory pathway. Our investigation of T. annulata-induced phosphoproteins revealed a panel of transcription factors, including FOSL2, GTF2F1, c-JUN, NFATC1, STAT3, and RUNX3. While STAT3's role in Theileria infections is well-established, the functions of the others (GTF2F1, and NFATC1) remain unclear 19. Our analysis identified phosphorylation of c-JUN(S63), FOSL2(S200), and JUNB(S251,255,259) during T. annulata infection. Cdk3-mediated phosphorylation of c-Jun at Ser63 is known to enhance cell transformation 28. Theileria infection induces a transformed phenotype in cells, which is attributed to the upregulation of Jun and Fos family members and the continuous activation of JNK signaling 22. While c-JUN(S63) phosphorylation has been previously reported for Theileria-infected leukocytes 22, phosphorylation of FOSL2 (S200) and JUNB (S251,255,259) appears to be a novel finding. RNA sequencing identified a downregulation of cell cycle-regulated genes known to be targeted by these TFs (FOSL2, GTF2F1, c-JUN, NFATC1, STAT3, and RUNX3) on parasite clearance. Our transcriptome analysis offers the first comprehensive view of downstream genes associated with each transcription factor during Theileria infection. Notably, E2F3, a well-established cell cycle regulator, was downregulated following parasite clearance. Previous research by Tretina et al. (2020) has demonstrated that Theileria parasites manipulate E2F signaling to promote leukocyte proliferation 1. These combined findings highlight E2F signaling as a promising avenue for therapeutic intervention. Intriguingly, c-MYC emerged as a potential link between these 6 TFs (FOSL2, GTF2F1, c-JUN, NFATC1, STAT3, and RUNX3), despite not being identified in our phosphorylation analysis. This is relevant because c-MYC activation by Theileria promotes infected B-cell survival 19. Theileria infection normally triggers cytokine secretion such a GM-CSF 19, activating TFs (STAT3, PI3-K, AP-1, and E2F) that drive c-MYC production. However, parasite death disrupts this pathway, leading to a combined decline in TF activity, c-MYC levels, and ultimately cell death 19. Our data suggests a more complex regulatory network for c-Myc activation during Theileria infection, potentially involving multiple pathways beyond the established GM-CSF/JAK2/STAT3 signaling cascade 19.
Our bioinformatics identified ERK1/2, as the main MAPK kinase activated by T. annulata 29.Our findings suggest an ERK-dependent regulatory pathway for FOSL2, JUNB and c-JUN in Theileria-infected cells. Interestingly, ERK1/2 deregulation is common in many cancers, promoting uncontrolled cell growth and survival. In contrast to our findings, previous research suggests MAPK family members, like JNK, and ATF2 are activated in Theileria-transformed cells, while ERK2 and p38 remain inactive 14,20–22,30. The discrepancy might also be attributed to the increased sensitivity of the ERK1/2 antibody used in our study. Our findings demonstrate that Theileria-mediated ERK phosphorylation triggers the subsequent direct or indirect phosphorylation of several transcription factors, including FOSL2, GTF2F1, c-JUN, JUNB, NFATC1, and RUNX3. Furthermore, inhibition of ERK signaling leads to the dephosphorylation of these transcription factors (FOSL2, c-MYC, c-JUN, JUNB, and RUNX3) and the subsequent induction of apoptosis in T. annulata-infected cells. This observation underscores the critical role of AP-1 signaling in Theileria pathogenesis, potentially mimicking features of cancer development. These findings suggest that targeting the ERK-AP-1 signaling axis holds promise as a therapeutic strategy against Theileria infection, warranting further investigation.
This study also sheds light on the multifaceted strategies employed by Theileria parasites to manipulate host cells and potentially evade immune defenses. We identified key parasite phosphorylated proteins and their potential cognate kinases, suggesting mechanisms by which Theileria might hijack host cellular processes. Our analysis expands on previous research by identifying novel phosphorylation sites on the parasite protein p104 (TA08425), including one that regulates JNK2 activity 3,13. These findings highlight the importance of p104 phosphorylation in Theileria biology. Our study identified phosphorylation at Ser183 of TA14055, a putative Theileria cyclophilin (CYP) with peptidyl-prolyl cis-trans isomerase (PPIase) activity, a critical process for protein folding and trafficking 31,32. Cyclophilins from parasites are attractive targets for drug development, but their specific function in Theileria remains unclear. Notably, a recent study found T. annulata Cyclophilin1 (TA19600) interacts with host cell MED21, suggesting a potential role in mediating interactions between the parasite and host leukocytes 33. The presence of both TA14055 and TaPin1, another PPIase, within Theileria suggests a potentially complex PPIase network 17. These findings highlight the need for further investigation into the functional role of TA14055, the impact of Ser183 phosphorylation, and the potential interplay between CyPs and TaPin1 in Theileria. While parasite TF phosphorylation was not detected, transcriptome analysis revealed upregulation of several TF families, including ApiAP2 and HAP complex factors. Our transcriptomic analysis unveiled significant modulations in the expression profiles of ApiAP2 transcription factors, recognized for their critical role in regulating developmental processes within Apicomplexan parasites 34. Notably, TA07550), an ApiAP2 factor exhibiting peak expression during the schizont stage, demonstrated a marked downregulation upon parasite elimination. This observation aligns with prior studies, highlighting the potential significance of TA07550 in Theileria's lifecycle 35. Further investigations into its downstream target genes and potential for targeted therapeutic intervention are highly warranted. Furthermore, our study identified a compelling finding: Theileria exhibited elevated expression of Hap complex transcription factors during the schizont stage, followed by a significant downregulation upon treatment that disrupts ROS production. The Hap complex, well-established for its role in managing cellular stress responses in yeast 36, suggests a potential Achilles' heel for Theileria. This discovery presents an exciting opportunity for further investigation into the specific role of the Hap complex in Theileria's stress response pathway, potentially leading to the identification of novel drug targets that exploit this vulnerability.
Our study is among the first to integrate phospho-proteomics with transcriptomics, unveiling a comprehensive map of T. annulata-induced phospho-signaling within infected cells. This innovative approach significantly advances our understanding of phosphorylation's critical role during parasite infection, extending far beyond the mere identification of parasite phospho-proteins achieved in prior studies. This investigation led to the discovery of unexpected regulatory pathways, including a pro-survival ERK-dependent network involving key transcription factors. This finding underscores the remarkable power of phospho-proteomics in dissecting intricate cellular signaling mechanisms. Furthermore, our analysis revealed parasite-mediated manipulation of host protein phosphorylation and the identification of novel phosphorylation sites within Theileria proteins themselves (p104, TA14055, Hap complex factors). When integrated with the infected cell phenotype data, these comprehensive phosphoproteomic resources provide a valuable foundation for elucidating the mechanisms by which the parasite promotes host cell transformation. This knowledge has the potential to significantly accelerate therapeutic development efforts. We posit that our datasets will serve as a foundation for further validation and mechanistic studies of novel proteins implicated in T. annulata's manipulation of host cell signaling pathways.
In vitro Cell Culture
Bovine peripheral blood mononuclear cells (PBMCs) were isolated from cattle diagnosed with clinical T. annulata infection. Following isolation, PBMCs were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) and 100 µg/mL Penicillin-Streptomycin solution. These cultures were maintained under controlled conditions at 37°C in a humidified incubator with 5% CO2 (adapted from Dandasena et al., 2018). PCR amplification was performed to ensure the successful establishment of T. annulata infection within the cultured bovine cells. Primers specific to the T. annulata -specific TaSP gene were utilized 37. A positive PCR result confirmed the presence of T. annulata parasites within the in vitro cell culture system. The BL3.1 bovine B lymphosarcoma cell line, obtained from ATCC, was maintained in RPMI 1640 medium supplemented with 10% FBS. This cell line served as a control for subsequent experiments. To investigate the effects of specific drugs on Theileria-infected cells, treatments were administered under the following conditions: Buparvaquone at 200 ng/mL and U0126 at 10 µM. The duration of drug exposure varied depending on the experiment and is specified within the individual results sections.
Phosphoproteomics using Label-Free Quantification (LFQ) and data analysis
Following specific treatment durations, samples from control and treated cells were collected and lysed with reagents prepared in ammonium bicarbonate (AMBIC) water with protease/phosphatase inhibitors. Samples underwent washes, sonication, centrifugation, and protein quantification (BCA). Proteins were then digested with trypsin (1:50 w/w) for 16 hrs at 37°C. Digested peptides were desalted and enriched for phosphopeptides using a TiO2 kit. Enriched phosphopeptides (500 ng) were separated by LC (C18 column, 240-minute gradient) and analyzed by MS (Orbitrap Q Exactive HF, DIA mode) (Supplementary Fig. 1). During DIA analysis, precursor ions were fragmented at a normalized collision energy of 27 within an isolation window of 40 m/z. These parameters facilitated the comprehensive identification and characterization of peptides.
MaxQuant software (version 2.0.3.0) facilitated the analysis and processing of raw mass spectrometry data 38. Search parameters allowed for a maximum of two missed cleavages during trypsin digestion and considered the fixed modification of cysteine carbamidomethylation. Additionally, for phosphoproteome analysis, variable modifications encompassing phosphorylation of serine, threonine, and tyrosine residues were incorporated. The search parameters included a peptide mass tolerance of 6 ppm for MS scans and 20 ppm for MS/MS scans. The "match between runs" feature was enabled to enhance data quality during analysis. The Andromeda search engine within MaxQuant was employed against a combined database containing the UniProt Bos taurus proteome (UP000009136_9913.fasta) and T. annulata proteome (UP000001950), along with common contaminant entries. A stringent false discovery rate (FDR) of 1% was applied at both the peptide and protein levels for reliable identification. Protein quantification required a minimum of two unique peptide identifications ("ratio counts"), and the "match between runs" setting was activated for improved data consistency. Following successful protein identification, Perseus software (versions 1.6.15.0 & 2.0.9.0) was utilized to statistically analyze the identified peptides and their corresponding proteins to pinpoint significantly altered phosphoproteins 39. The downstream analysis considered both the abundance (intensity) of phosphopeptides and the confidence score for the localization of modified amino acid residues. Only phosphopeptides with a localization score exceeding 0.75 were retained for further analysis, ensuring high confidence in phosphorylation site identification. Additional statistical parameters included: i) Data Filtering: Phosphoprotein data was filtered to ensure presence of valid values in at least half (50%) of the experimental groups ii) Imputation of Missing Values: Missing data points were imputed using a combination of normal distribution and K-Nearest Neighbor (KNN) methods iii) Multiple Testing Correction: Statistical significance was assessed using ANOVA with a pre-defined FDR of 0.05. This analysis involved randomization repeated 250 times to account for potential chance associations and iv) Data Normalization: Z-score normalization was employed to standardize the data and facilitate statistical comparisons between different experimental groups.
In silico Prediction of Kinase-Substrate Interactions
The software and resources used to predict kinase-substrate relationships between parasite and host proteins were:
Parasite Kinase Prediction: The publicly available GPS 6.0 server (https://gps.biocuckoo.cn/online.php) was utilized to analyze the protein sequences of T. annulata kinases for potential phosphorylation sites.
Host Kinase Prediction: The standalone version of iGPS v1.0.1 software was used to analyze the complete host proteome for potential kinase phosphorylation sites.
Kinome Tree Visualization: The CORAL online tool (http://phanstiel-lab.med.unc.edu/CORAL/) 40 was employed to generate a visual representation of the kinases (kinome tree).
Prediction and Weighting Strategy: Both iGPS and GPS predicted potential kinase phosphorylation sites within protein sequences. A weighted scoring system was implemented to prioritize kinases based on the prediction frequency. For each protein sequence, a weight was assigned to each predicted kinase using the following formula: Weight = 1 / (Number of predictions for that specific site and protein). This approach assigns a higher score to kinases that are frequently predicted to target a particular phosphorylation site. Subsequently, the cumulative weights for each kinase across all predictions were calculated.
Kinome Tree Representation: The cumulative kinase weights were then used to determine the relative size of circles within the kinome tree generated by CORAL. Kinases with a higher cumulative weight, indicative of a greater likelihood of targeting host proteins based on in silico predictions, were represented by larger circles within the tree.
Gene Ontology (GO) Enrichment Analysis
Functional Annotation of Phosphorylated Sites: To functionally characterize the phosphorylation sites specific to T. annulata (TA) cells, we performed Gene Ontology (GO) enrichment analysis using the DAVID online tool 41. This analysis identified biological processes, molecular functions, and cellular components significantly enriched with these unique phosphorylation sites.
Visualization of KEGG Pathways: Following the GO enrichment analysis, we focused on the top five enriched KEGG pathways. These pathways were visualized to gain insights into the potential functional consequences of parasite-mediated phosphorylation events.
Protein-Protein Interaction Network Analysis
Following the identification of transcription factors through phosphoproteomic analysis, we utilized the STRING 10 database 42 to explore potential protein-protein interactions. The analysis was performed with default settings in the confidence view to focus on high-confidence interactions. The resulting protein-protein interaction network was subsequently imported into Cytoscape software (version 3.0) for further analysis and visualization customization, as described in the Results section.
Downstream Gene Analysis of Identified Transcription Factors
To identify potential downstream target genes regulated by the transcription factors identified through phosphoproteomics in T. annulata (TA)-infected bovine cells, we employed three resources: ENCODE, ChEA, and MotifMap4 databases. These databases catalog experimentally validated downstream genes associated with human transcription factors (TFs) based on techniques like ChIP-seq experiments. The downstream target genes identified from the databases were compared to our RNA-seq data. We focused on DEGs exhibiting a fold change threshold of -1.5 (downregulated upon BPQ treatment) potentially indicative of TF activity. Gene Ontology (GO) enrichment analysis was then performed using DAVID to identify biological processes and pathways potentially regulated by these TFs and their downstream targets.
RNAseq
Control and treated bovine cells infected with parasites (BPQ at 200 ng/ml for 96 hr) were lysed using TRIzol reagent, followed by phase separation with chloroform and centrifugation. The RNA-containing supernatant was purified using a RNeasy mini kit with on-column DNase I treatment. RNA concentration and purity were assessed using a Nanodrop spectrophotometer and Tapestation system. RNA concentration was further quantified using the Qubit RNA HS assay kit. Illumina-compatible RNA sequencing libraries were prepared from 500 ng of total RNA using the NEBNext® Ultra™ II Directional RNA Library Prep Kit according to the manufacturer's instructions. Briefly, the protocol involved mRNA isolation, fragmentation, priming, cDNA synthesis, purification, end-repair, adapter ligation, indexing PCR, and final library purification. Quality control steps included library quantification using a Qubit fluorometer and fragment size analysis using an Agilent TapeStation. Libraries were sequenced on a NovaSeq 6000 platform with 150 bp paired-end reads. Raw sequencing data underwent quality assessment with FastQC, followed by adapter sequence and low-quality base trimming using TrimGalore. Alignments were performed against the Bos taurus (host) and T. annulata (pathogen) reference genomes using Hisat2 and Bowtie2, respectively. FeatureCounts tool was employed to quantify transcript abundance, and DESeq software was used to identify differentially expressed genes based on a log2 fold-change cut-off of +/- 1. Differentially expressed genes were categorized as upregulated, downregulated, or neutrally regulated.
RNA Extraction and Quantitative Real-Time PCR (qPCR):
Total RNA was isolated from the cells using the commercially available Quick-RNA Microprep Kit (Zymogen), adhering to the manufacturer's instructions. One microgram (1 µg) of the purified RNA was then reverse transcribed into complementary DNA (cDNA) using the PrimeScript 1st Strand cDNA Synthesis Kit (DSS Takara). qPCR analysis was performed using the TB Green Premix Ex Taq II (RNaseH Plus) kit (DSS Takara), following the manufacturer's established protocol. This analysis quantified the relative expression levels of the genes. The housekeeping gene HPRT was employed for the normalization of the data. The specific primer sequences utilized for RT-qPCR are detailed: FOSL2 Forward GAGCCTTTCAAACCAGAGGGA FOSL2 reverse ATGGGCTGGACATGGAAGTG, HPRT For: TGGACAGGACCGAACGGCT and HPRT Rev: TAATCCAACAGGTCGGCAAG
Immunofluorescence Assay (IFA)
Cells (5 x 10^5) infected with the target agent were cultured for 48 hours in media supplemented with either 10 µM U0126 or 200 ng/ml BPQ. A control group received no drug treatment. Following incubation, cells were harvested, washed with phosphate-buffered saline (PBS, 1X), and fixed with 4% paraformaldehyde for 15 minutes at 37°C. Cells were then permeabilized with 0.1% Triton X-100 and blocked with 2% bovine serum albumin (BSA) in PBS for 1 hour at room temperature. Primary antibodies (detailed in the Materials section with specific dilutions) were incubated overnight at 4°C. Unbound primary antibodies were removed by thorough washes with PBS containing 0.05% Tween-20. Subsequently, secondary antibody incubation (details in Materials section) was performed for 1 hour at room temperature. Following further washes, cells were stained with DAPI for nuclear visualization. Finally, samples were mounted and imaged using a Zeiss Airyscan super-resolution microscope with a 100x objective. Image processing and quantification were performed using ZEN 3.3 software (Black Edition or Blue Edition) depending on the specific analysis requirements.
SDS-PAGE and Western Blotting
Following treatment, cells cultured in six-well plates were washed with ice-cold PBS to remove residual media components. Cells were then lysed in RIPA buffer (radioimmunoprecipitation assay buffer) containing protease and phosphatase inhibitors (compositions detailed in the Materials section) on ice for a designated time period (e.g., 15 minutes) to ensure complete protein extraction. Cell lysates were collected by scraping and clarified by centrifugation at high speed (e.g., 12,000 x g) at 4°C for a specified duration (e.g., 15 minutes) to remove insoluble debris. Protein concentration in the clarified lysates was quantified using a bicinchoninic acid (BCA) assay kit (detailed in the Materials section) according to the manufacturer's instructions. Lysate aliquots containing equal amounts of protein were then prepared for SDS-PAGE and Western blotting. Samples were prepared for SDS-PAGE by heat denaturation at 95°C for 10 minutes in loading buffer containing reducing agents (e.g., β-mercaptoethanol) to disrupt protein disulfide bonds and ensure linear protein structure. Resolved proteins were then electrotransferred from the polyacrylamide gel to PVDF membranes using a semi-dry or wet transfer system according to the manufacturer's protocol. Membranes were subsequently blocked with 5% (w/v) non-fat dry milk in TBST (Tris-buffered saline with 0.05% Tween-20) for 1 hour at room temperature to minimize non-specific antibody binding. Following blocking, membranes were incubated with primary antibodies (detailed in the Materials section with specific dilutions) overnight at 4°C. Unbound primary antibodies were removed by thorough washes with TBST. Membranes were then incubated with HRP-conjugated secondary antibodies (detailed in the Materials section) for a designated period at room temperature. Finally, protein bands were detected using enhanced chemiluminescent (ECL) reagent and visualized using a digital imaging system.
siRNA Experiments:
Commercially sourced siRNAs targeting the FOSL2 gene were acquired from Eurogentec. Two distinct siRNA sequences were utilized:
5'- (ACC-AGA-GGG-AUU-GAA-AUU-C)TT -3' (siRNA_FOSL2_1)
5'- (ACU-GCA-GAA-AGA-GAA-AGA-G)TT -3' (siRNA_FOSL2_2)
Lipofectamine 3000 transfection reagent (Invitrogen) facilitated the delivery of siRNAs into the cells, following the manufacturer's established protocol. Briefly, 3 x 10^5 cells were seeded per well of a 6-well plate. A transfection cocktail was prepared by combining 5 µg of siRNA with 125 µL of serum-free RPMI medium and 7.5 µL of Lipofectamine 3000 in a separate aliquot of 125 µL serum-free RPMI medium. Following a 15-minute incubation at room temperature, the combined solution was added to the cells in 1 mL of serum-free RPMI medium. After 6 hours, the culture medium was supplemented with FBS to achieve a final concentration of 10%. Four days post-transfection, the cells were either utilized for subsequent downstream experiments or harvested for evaluation of knockdown efficiency via qPCR analysis.
Statistical Analysis
Data are presented as either mean ± standard error of the mean (SEM) for normally distributed data or median with interquartile range (IQR) for non-normally distributed data. Normality of data was assessed using appropriate tests. Statistical comparisons were performed using unpaired t-tests for normally distributed data with equal variances, non-parametric Mann-Whitney U tests for non-normally distributed data or unequal variances, or one-way analysis of variance (ANOVA) for multiple comparisons. GraphPad Prism was used for all statistical analyses and generation of graphs. A p-value ≤ 0.05 was considered statistically significant unless otherwise specified. Specific details regarding the statistical tests used for each experiment are provided in the corresponding figure legends.
Data Availability
RNA sequencing (RNAseq) data generated in this study have been deposited in the National Center for Biotechnology Information Gene Expression Omnibus (GEO) [https://www.ncbi.nlm.nih.gov/geo/], accessible through GEO Series accession number SUB14628737. Mass spectrometry proteomics data are available through the MassIVE Consortium using the MassIVE Dataset Submission (1.3.2) workflow with the dataset identifier MSV000094978.
Material
Antibodies
Acknowledgements
The authors would like to thank the Director (NIAB) for providing all the necessary resources and for her consistent support and encouragement. We thank the fellowship programs (DBT, CSIR, UGC) for providing fellowship to the PhD students (DD, AS, VMA).
Author contributions
Most of the experiments were carried out by DD, with support from AS, VMA, VB, SR. PS and DD devised the study's idea, planned the experiments, and evaluated and interpreted the results. The manuscript was written by DD, AS, VMA, VB, SR, PS. All authors read and approved the final manuscript.
Competing interests
The authors declare no competing interests.
- Tretina, K., Gotia, H. T., Mann, D. J. & Silva, J. C. Theileria-transformed bovine leukocytes have cancer hallmarks. Trends Parasitol31, 306–314 (2015).
- Kinnaird, J. H. et al. A Bovine Lymphosarcoma Cell Line Infected with Theileria annulata Exhibits an Irreversible Reconfiguration of Host Cell Gene Expression. PLoS One8, e66833 (2013).
- Wiens, O. et al. Cell Cycle-Dependent Phosphorylation of Theileria annulata Schizont Surface Proteins. PLoS One9, e103821 (2014).
- Shiels, B. et al. Alteration of host cell phenotype by Theileria annulata and Theileria parva: mining for manipulators in the parasite genomes. Int J Parasitol36, 9–21 (2006).
- Dobbelaere, D. A. E. & Rottenberg, S. Theileria-induced leukocyte transformation. Curr Opin Microbiol6, 377–382 (2003).
- ole-MoiYoi, O. K. et al. Evidence for the induction of casein kinase II in bovine lymphocytes transformed by the intracellular protozoan parasite Theileria parva. EMBO J12, 1621–1631 (1993).
- Hunter, T. & Pawson, T. Preface. Philosophical Transactions of the Royal Society B: Biological Sciences367, 2512–2512 (2012).
- Heussler, V. T. et al. Hijacking of Host Cell IKK Signalosomes by the Transforming Parasite Theileria. Science (1979)298, 1033–1036 (2002).
- Baylis, H. Infection with Theileria annulata induces expression of matrix metalloproteinase 9 and transcription factor AP-1 in bovine leucocytes. Mol Biochem Parasitol69, 211–222 (1995).
- Dobbelaere, D. A. & Küenzi, P. The strategies of the Theileria parasite: a new twist in host–pathogen interactions. Curr Opin Immunol16, 524–530 (2004).
- Heussler, V. T. et al. The Akt/PKB pathway is constitutively activated in Theileria-transformed leucocytes, but does not directly control constitutive NF-kappaB activation. Cell Microbiol3, 537–550 (2001).
- Baumgartner, M. R. Hyperammonemia with reduced ornithine, citrulline, arginine and proline: a new inborn error caused by a mutation in the gene encoding Delta1-pyrroline-5-carboxylate synthase. Hum Mol Genet9, 2853–2858 (2000).
- Latré De Laté, P. et al.Theileria highjacks JNK2 into a complex with the macroschizont GPI (GlycosylPhosphatidylInositol)-anchored surface protein p104. Cell Microbiol21, e12973 (2019).
- Lizundia, R. et al. c-Jun NH2-Terminal Kinase/c-Jun Signaling Promotes Survival and Metastasis of B Lymphocytes Transformed by Theileria. Cancer Res66, 6105–6110 (2006).
- Lizundia, R. et al. The JNK/AP-1 pathway upregulates expression of the recycling endosome rab11a gene in B cells transformed by Theileria. Cell Microbiol9, 1936–1945 (2007).
- von Schubert, C. et al. The Transforming Parasite Theileria Co-opts Host Cell Mitotic and Central Spindles to Persist in Continuously Dividing Cells. PLoS Biol8, e1000499 (2010).
- Marsolier, J. et al. Theileria parasites secrete a prolyl isomerase to maintain host leukocyte transformation. Nature520, 378–382 (2015).
- Murthy, S. et al. Multiplex ddPCR: A Promising Diagnostic Assay for Early Detection and Drug Monitoring in Bovine Theileriosis. Pathogens12, 296 (2023).
- Dessauge, F. et al. c-Myc activation by Theileria parasites promotes survival of infected B-lymphocytes. Oncogene24, 1075–83 (2005).
- Dobbelaere, D. A. E., Fernandez, P. C. & Heussler, V. T. Theileria parva: taking control of host cell proliferation and survival mechanisms . Microreview. Cell Microbiol2, 91–99 (2000).
- Botteron, C. & Dobbelaere, D. AP-1 and ATF-2 Are Constitutively Activated via the JNK Pathway inTheileria parva-Transformed T-Cells. Biochem Biophys Res Commun246, 418–421 (1998).
- Chaussepied, M. et al. Upregulation of Jun and Fos family members and permanent JNK activity lead to constitutive AP-1 activation in Theileria-transformed leukocytes. Mol Biochem Parasitol94, 215–226 (1998).
- Fröhlich, K. et al. Data-independent acquisition: A milestone and prospect in clinical mass spectrometry-based proteomics. Molecular & Cellular Proteomics 100800 (2024) doi:10.1016/j.mcpro.2024.100800.
- ZHANG, W. & LIU, H. T. MAPK signal pathways in the regulation of cell proliferation in mammalian cells. Cell Res12, 9–18 (2002).
- Du, W., Zhou, Y., Pike, S. & Pang, Q. NPM phosphorylation stimulates Cdk1, overrides G 2 /M checkpoint and increases leukemic blasts in mice. Carcinogenesis31, 302–310 (2010).
- Shayan, P. & Ahmed, J. S. Theileria -mediated constitutive expression of the casein kinase II-α subunit in bovine lymphoblastoid cells. Parasitol Res83, 526–532 (1997).
- Marsolier, J., Perichon, M., Weitzman, J. B. & Medjkane, S. Secreted parasite Pin1 isomerase stabilizes host PKM2 to reprogram host cell metabolism. Commun Biol2, 152 (2019).
- Cho, Y.-Y. et al. Cyclin-dependent kinase-3-mediated c-Jun phosphorylation at Ser63 and Ser73 enhances cell transformation. Cancer Res69, 272–81 (2009).
- Abe, M. K., Kuo, W. L., Hershenson, M. B. & Rosner, M. R. Extracellular signal-regulated kinase 7 (ERK7), a novel ERK with a C-terminal domain that regulates its activity, its cellular localization, and cell growth. Mol Cell Biol19, 1301–12 (1999).
- Galley, Y. et al. Jun NH 2 -terminal kinase is constitutively activated in T cells transformed by the intracellular parasite Theileria parva. Proceedings of the National Academy of Sciences94, 5119–5124 (1997).
- Lang, K., Schmid, F. X. & Fischer, G. Catalysis of protein folding by prolyl isomerase. Nature329, 268–270 (1987).
- Wang, P. & Heitman, J. The cyclophilins. Genome Biol6, 226 (2005).
- Zhao, S. et al. Theileria annulata Cyclophilin1 (TaCyp1) Interacts With Host Cell MED21. Front Microbiol9, (2018).
- Jeninga, M., Quinn, J. & Petter, M. ApiAP2 Transcription Factors in Apicomplexan Parasites. Pathogens8, 47 (2019).
- Pieszko, M., Weir, W., Goodhead, I., Kinnaird, J. & Shiels, B. ApiAP2 Factors as Candidate Regulators of Stochastic Commitment to Merozoite Production in Theileria annulata. PLoS Negl Trop Dis9, e0003933 (2015).
- Mao, Y. & Chen, C. The Hap Complex in Yeasts: Structure, Assembly Mode, and Gene Regulation. Front Microbiol10, (2019).
- Dandasena, D. et al. A Real-Time PCR based assay for determining parasite to host ratio and parasitaemia in the clinical samples of Bovine Theileriosis. Sci Rep8, 15441 (2018).
- Cox, J. & Mann, M. MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification. Nat Biotechnol26, 1367–1372 (2008).
- Tyanova, S. et al. The Perseus computational platform for comprehensive analysis of (prote)omics data. Nat Methods13, 731–740 (2016).
- Metz, K. S. et al. Coral: Clear and Customizable Visualization of Human Kinome Data. Cell Syst7, 347-350.e1 (2018).
- Sherman, B. T. et al. DAVID: a web server for functional enrichment analysis and functional annotation of gene lists (2021 update). Nucleic Acids Res50, W216–W221 (2022).
- Szklarczyk, D. et al. STRING v10: protein–protein interaction networks, integrated over the tree of life. Nucleic Acids Res43, D447–D452 (2015).
Supplementary Tables are not available with this version
The authors declare no competing interests.