Aeromonas Hydrophila Infection Activates Death Receptor Apoptosis Pathway in the RBCs of Grass Carp (Ctenopharyngodon idellus)

doi:10.21203/rs.3.rs-49940/v1

Download PDF

Research

Aeromonas Hydrophila Infection Activates Death Receptor Apoptosis Pathway in the RBCs of Grass Carp (Ctenopharyngodon idellus)

https://doi.org/10.21203/rs.3.rs-49940/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: Fish blood contains RBCs (Red blood cells) as the major cells. Unlike the absence of nucleus in mammalian RBC, fish RBC contains a nucleus. Previous researches have indicated that fish RBCs have a significant function in immune responses. However, the mechanism underlying the immune responses against bacterial infection of teleost RBCs remains enigmatic. To decipher the mechanisms, after the infection of A. hydrophila, transcriptomic profiling of grass carp RBCs was analyzed.

Results: Outcomes demonstrated that there were 2144 altogether DEGs (Differently Expressed Genes) between the A. hydrophila non-disease groups, which includes 817 up-regulated and 1327 down-regulated DEGs. Differently Expressed Genes were allocated to 45 GO terms, including 20 natural procedure terms, 14 cell related element, and 11 terms related to molecular functions. Likewise, the expression levels of cytokines by Quantitative Reverse Transcription Polymerase Chain Reaction showed that they (e.g. CCL4, CCL11, CCL20, IL-4, IL-12, and IFNα) were significantly increased after A. hydrophila infection, which was identical to the expression patterns of transcriptomic data. The infection could cause the apoptosis of RBCs which was confirmed by annexin V/PI assay. To further elucidate the apoptosis pathway, the expression levels of genes by mRNA included in cellular apoptosis were monitored. The outcomes indicated that the expressions of mRNA of p53, Fas, Leucine-rich repeats, death domain-containing (LRDD) and caspase 8 were all significantly increased, respectively.

Conclusions: Our results support the notion that A. hydrophila infection could activate Fas-related death receptor apoptosis pathway in grass carp RBCs, which will reveal another insight on the mechanisms underlying the antibacterial immunity of teleost fish RBCs.

Animal Science

Ctenopharyngodon idellus

Aeromonas hydrophila

Red blood cells

Transcriptome

Apoptosis

Death receptor pathway

Ctenopharyngodon idellus is a significant cultured clean water fish around the world. The worldwide production of grass carp achieved approximately 5.5 Million tons in 2018 which is only after tilapia and becoming the second most cultured fish in the world [1]. The fast growth of high-density grass carp farming along with aquatic environmental deterioration has led to outbreaks of serious bacterial diseases, such as A. hydrophila infection disease [2]. The typical symptoms of A. hydrophila infection in grass carp are normally sepsis with systemic hemorrhage. The infection of A. hydrophila can cause high mortality, leading to devastating economic loss in the grass carp aquaculture industry [3].

Unlike RBCs of mammals, red blood cells of matured fish have a nucleus with organelles present in the cytoplasm [4]. Even though the principle function of red blood cell is the gas exchange, numerous other biological functions for red blood cells which nuclei are associated with immune responses have been recently uncovered [5, 6]. Nucleated RBCs can thus modulate leukocyte activity, respond to different pattern recognition receptors (PRRs), including peptidoglycan recognition protein (PGRP) receptor families [7], Toll-like receptors (TLRs) [8], and then release cytokines [9–11]. Therefore, fish RBCs are excellent models for exploring the immunity features of nucleated RBCs.

To promote functional genomics researches, NGS (Next-Generation Sequencing) also called high-throughput sequencing technology is frequently utilized, which includes new gene discovery, global gene expression, and SNP (single-nucleotide polymorphism) [12, 13]. By the quick advancement of high-throughput sequencing technologies, it provides valuable information for understanding host-pathogen interactions, including gene expression and immune responses [14]. By using high-throughput sequencing technologies, it have been reported that numerous of conserved and novel genes involved in innate and adaptive immunities during viral and bacterial infections in many fishes such as Oncorhynchus mykiss [15], Oncorhynchus nerka [16], Schizothorax Prenanti [17], Oreochromis niloticus [18], Carassius Auratus [19], Hybrid Sturgeon [20], Common Carp [21], and Ctenopharyngodon idellus [22]. Research on transcriptomic and proteomic of O. mykiss has indicated that RBCs possessing nucleus support many functions of immunity, e.g. cytokine expression, leukocyte activation, and antigen presentation [6]. Furthermore, NGS has been applied to distinguish the expression profile of the WBCs and RBCs of Oreochromis niloticus (Nile tilapia), and the results showed that suggested in response to poly (I:C) stimulation, RBCs expressed several immune genes [23].

Together, this information affirms the idea that fish RBCs have a considerable role in innate immunity. In our previous researches, we have reported that RBCs of grass carp showed antibacterial activity which is related to the generation of ROS and phagocytosis [24]. However, the underlying mechanism remains enigmatic. To decipher the mechanism, transcriptomic profiling of grass carp RBCs after A. hydrophila infection was analyzed in this research. The DEGs (differentially expressed genes) between the grass carp RBCs infected with or without A. hydrophila were determined. The differentially expressed genes were linked with numerous functional categories and immune signaling pathways which were important to antibacterial immunity, such as CCR interaction (cytokine-cytokine receptor interaction), Toll-like receptor signaling pathways (TLR signaling pathways) and TNF signaling pathways. Furthermore, transcriptomic profiling and qRT-PCR revealed that A. hydrophila infection could up-regulate the expressions of some cytokine genes and activate the Fas-related death receptor apoptosis pathway.

Experimental fish

A place supplied grass carp which weighs around 100-250 grams were situated in city of Guangzhou, province of Guangdong, China. These were kept at the temperature of 25-26 °C in a continuous flow water network for around 15 days so as they could acclimate to the laboratory conditions before the experiments were carried out.

Isolation and purification of RBCs

RBCs of grass carp were obtained from the peripheral blood as explained already with minor changes [25]. Briefly, heparinized syringes were used to draw peripheral blood from the caudal vein which is combined with 0.7% buffer saline solution (0.7 g NaCl in 100 ml H₂O) containing heparin sodium (0.1 mg/ml). The purification of red blood cells was done by two consecutive density-gradient centrifugations in 34% and 51% Percoll (Pharmacia Fine Chemicals, Uppsala, Sweden) at 500 g for 35 minutes at 4°C. The RBCs were gathered and washed three times in a 0.7% buffer saline solution, and then resuspended in an L-15 medium (Invitrogen, USA) supplemented with 100 µg/ml streptomycin (Sigma, USA) and, 10% fetal bovine serum (FBS), 100 U/ml penicillin, and at a density of 10⁶cells/ml at 28 °C. All grass carp tests were done in careful observance with the guidance of the Ministry of Science and Technology of China 2006 and affirmed by the Zhongkai University of Agriculture and Engineering’s Animal Ethics Committee.

Infection of RBCs with A. hydrophila

A.hydrophila was maintained and cultured according to our routine laboratory protocols [24]. Subsequently, the experimental RBCs (1 × 10⁶ cells/ml) from 6 fish were divided into control and the infected groups. The RBCs in the infected group were incubated at a 1:10 ratio with A. hydrophila for 12 hours under constant rotation at 28°C, whereas the RBCs in the control group were incubated with the similar amount of PBS. After 12 hr treatment, three equal specimens were combined as biological replicas.

Extraction, RNA-Seq library construction, and sequencing of RNA

Complete RNAs were removed from the A. hydrophila-infected and non-infected RBCs using RNAiso plus made in Takara, Japan as indicated by the maker’s procedure. Subsequently, the characteristics and amount of the complete RNA were identified utilizing Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA), and Nano Drop 2000 (Thermo Scientific), respectively. The libraries were built using the TruSeq™ RNA Sample Prep Kit (Illumina, San Diego, CA, USA) according to the maker’s directions. Afterward, the three RNA-Seq libraries were carried out with 150/125 bp paired-end sequencing on the BGISEQ-500 platform (BGI, Shenzhen, China) as per the last record [26].

Sequence filtering, gene annotation, and de novo assembly

The transcriptomic test was performed by the strategy described before head [27]. The generated raw sequencing readings were firstly clean up by eliminating adaptor sequences and reduced quality sequences (over 20% of the basic qualities were below than 10) using the tool FASTX, which is utilized to decrease data clamor and clean raw readings. The informational collection of the source of rRNA arrangements was acquired from general rRNA databases. The remaining clean readings were planned to a C. idellus reference genome utilizing HISAT. After mapping of genome, StringTie were utilized to rebuild transcripts, and with genome annotation information, the coding capability of those latest transcripts predicted utilizing CPC and the novel transcripts were identified using the Cuffcompare tool. Gene expression abundance was evaluated utilizing the RPKM (readings-per kilobase per million mapped reads) method. All reference genes were performed with a sequence based on the NCBI nr (non-redundant) protein with an E-value threshold of 10−5 and the Uniprot database. Subsequently, all differential expressed genes (DEGs) were mapped to the GO terms data for functional annotation, the KOG, KEGG for pathway-enrichment analysis.

DEGs, KEGG, and GO enrichment analysis

Based on the obtained levels of gene expression, DEGs between A. hydrophila non-infected and infected groups were utilized with criteria with a FC (fold change) of gene expression > 2.0 (complete value of the log2 Ratio ≥ 1) and FDR (False Discovery Rate) ≤ 0.001. To know more about the DEGs and pathways responding to the infection of A. hydrophila, functional groups and pathways encompassing the DEGs were plot to terms in the KEGG and GO databases with the Blast2 GO pipeline and KEGG enrichment analysis utilizing KOBAS software, respectively.

hydrophila infection and immune genes expression

Six cytokines genes (CCL4, CCL11, CCL20, IL4, IL12, and IFNα) were analyzed by qRT-PCR to further validate RNA-seq data. The reverse transcription reaction was in a total volume of 20 μl, which contains 10 μl AceQ® qPCR SYBR® Green Master Mix (Vazyme, Nanjing, China), 1 μl cDNA, 7 μl DEPC treated water, and 1 μl of each particular primer (list in Table 1). The quantitative real-time PCR cycling conditions were as stated: 95 °C for 3 minutes, further at 95 °C for 15 seconds of 40 cycles, for 30 seconds at 60 °C, for 20 seconds at 72 °C, and finally for 5 minutes at 4 °C [28]. All reactions of each gene in each sample were carried out in triplicate. Meanwhile, an analysis of melting curve was performed to identify the nature of target. The relative expression ratio of the β-actin gene versus the target genes was calculated using the 2^-∆∆CTmethod [29], and all the information was provided in terms of relative mRNA expression.

Examination of apoptosis in A. hydrophila-infected RBCs

The RBCs (1 × 10⁶ cells/ml) were separated into two different groups; infected and control. The RBCs in the infected group were incubated with A. hydrophila at a ratio of 1:10 for 6, 12, and 24 h under constant rotation at 28 °C, respectively. The control group was incubated with the equal proportion of PBS. After 6, 12, and 24 h of infection, a kit called the Alexa Fluor® 488 annexin V/Dead Cell Apoptosis Kit (Invitrogen, USA) was utilized to test the apoptosis of RBCs as stated earlier [30]. After staining, the RBCs were viewed by fluorescence microscopy (Leica DMI8, Germany). Furthermore, to additionally explain the mechanism of apoptosis, some apoptosis pathway-related genes; including p53, Fas, LRDD, and caspase 8 were determined by qRT-PCR. All primers were shown in Table 1.

Statistical evaluation

Statistical evaluation was carried out by utilizing SPSS software version 17.0. Whole formation was depicted as a mean ± SD (standard deviation) at least 3 separate tests. The statistical importance of the information was evaluated by ANOVA (one-way analysis of variance), and GraphPad Prism 7 was used to draw figures [31]. The difference was considered important when P < 0.05 (*).

Transcriptomic sequencing and de novo assembly analysis

The cDNA libraries from the RBCs of grass carp with and without infection of A. hydrophila were ranked on the BGISEQ-500 platform. For each sample, 82.47% of the readings were effectively mapped to the genome of grass carp. The total de novo assembly readings from the library yielded total transcripts of 21,753 known genes and 1262 novel genes comparing to the control groups (Fig. 1B). The unigene size distribution is indicated in Fig. 1 (A), and the most plentiful unigenes were grouped in a cluster of ≥ 3000 bp in length. Levels of gene expression were standardized to FPKM, a total of 20,765, and 18,612 contigs were detected from the control and A. hydrophila-challenged groups, respectively, with 18,501 common contigs in both (Fig. 1C). The unigene size distribution of the transcription factors (TF) family is indicated in Fig. 2, and the more common unigenes of TF were agglomerated in a ZF-C2H2 cluster.

Functional Explanation Of The Degs

To identify the profile of gene expression of the RBCs after A. hydrophila infection for 12 h, DEG libraries were built from the control and infected groups. The outcomes indicated that there were 2144 DEGs between the infected and control groups, including 817 up-regulated genes and 1327 down-regulated genes. As appeared in Fig. 3, these DEGs were characterized into three classes: cellular component, molecular function, and biological process. Between the up-regulated genes in the natural procedure, the most beneficial subclasses were “cellular process”, trailed by “biological regulation” and “metabolic process”. In the elements of cells, “the cell”, “organelle” and “membrane” were the majority of the 3 improved subclasses. Whereas, in the class of molecular functions, “binding” was the more beneficial subclass, followed by “catalytic activity” and “molecular function regulator” (Fig. 3A). Between the GO analyses of down-regulated genes in the biological procedure, the more beneficial subclass was the “cellular process”. The “cell” was the most enrichment subclass in the cellular component. However, “binding” had the most improved number in the class of molecular function (Fig. 3B).

Furthermore, to additionally comprehend the roles of the DEGs and the signaling pathways involved in A. hydrophila infection, DEGs in RBCs with A. hydrophila infection were visualized by a volcano plot. The blue-colored plots show important down-regulated genes, the red-colored plots show important up-regulated genes, and the gray plots represent no important changed genes (Fig. 4A). Correspondingly, the MA plot exhibited that the differential articulation designs were not because of the expression genes number (Fig. 4B).

Analysis Of Kegg Enrichment Pathways

The top 20 KEGG enrichment pathways were observed in A. hydrophila group. As shown in Fig. 5, there are 523 DEGs that are closely involved in antibacterial immune response, with the largest pathway of Herpes simplex infection (57 DEGs), followed by CCR interaction (55 DEGs), Hepatitis B 38 DEGs, and Toll-like receptor signaling pathway (38 DEGs). Intriguingly, between these antibacterial pathways, three KEGG pathways directly associated with bacterial invasion performed further hierarchical clustering: CCR interaction (cytokine-cytokine receptor interaction), TNF signaling pathway, and TLR receptor signaling pathway (Toll-like signaling pathway) (Fig. 6).

Detection Of Immune-related Degs

To confirm the immune-related DEGs, six cytokines (CCL4, CCL11, CCL20, IL4, IL12, and IFN-α) were analyzed by qRT-PCR after the RBCs were challenged by A. hydrophila at multiple time points (6, 12 and 24 h). Compare with the control group, the expressions of all six cytokine genes were all considerably up-regulated at 24 hr after the A. hydrophila infection. However, the expressions of CCL20 and IL-4 were already significantly up-regulated both at 12 h after the infection (Fig. 7).

A. hydrophila infection induced apoptosis in RBCs

Annexin V/PI apoptosis kit was used to test the apoptosis triggered by A. hydrophila infection. Indicated in Fig. 8, the green signal indicates early apoptosis; the red signal represents late apoptosis. The outcomes demonstrated that only few apoptotic cells were seen at 6, 12, and 24 h in the control groups. However, there were many apoptotic cells observed in the infected RBCs at 6, 12, and 24 h, with stronger red signal present at 12 and 24 hours, showing that prolonged infection may cause more severe programmed cell death (Fig. 8). To further address the apoptosis pathway, RNA-seq data were subjected to analyzed. The outcomes demonstrated that A. hydrophila infection could up-regulated the expressions of p53, Fas, LRDD, and caspase 8. The expressions of these 4 genes were further measured by qRT-PCR. As shown in Fig. 9, the mRNA expression of Fas was importantly up-regulated from 6 to 24 h post-infection, whereas the levels of mRNA of p53, LRDD, and caspase 8 were also increased from 12 to 24 h. Since these 4 genes were closely related with the death receptor apoptosis pathway, indicating that A. hydrophila infection can trigger Fas related death receptor apoptosis pathway. The potential mechanism was proposed in Fig. 10.

For a long time, red blood cells have been portrayed as inactive onlookers as opposed to members in immune responses. Advances over the recent years have revealed that RBCs appear to play an unusual role in antimicrobial immunity. In our previous study, we have reported that RBCs of grass carp showed antibacterial activity which is related to reactive oxygen species and phagocytosis generation [24]. However, the underlying mechanisms remain enigmatic. To further decipher the mechanism of antimicrobial immunity, transcriptomic profilings of grass carp RBCs infected with or without A. hydrophila were compared and analyzed. A sum of 2144 DEGs among the control and A. hydrophila groups were recognized including 817 up-regulated and 1327 down-regulated genes. Furthermore, in pathway-enrichment analysis, the main 20 KEGG enrichment pathways were obtained by A. hydrophila infection, 523 DEGs were closely involved in the antibacterial immune response.

In the transcriptomic analysis of human red blood cells, the different stages of development (reticulocytes, erythroblasts, and mature) characterization of mammalian RBCs showed a series of expressed genes linked with the immune defense [32]. Recently, some researches have explained the transcriptomic analysis of blood cells in teleost. An enormous number of genes engaged in immune response and apoptosis are differentially expressed in the O. mykiss of RBCs challenged at different temperatures [33]. After infected with piscine orthoreovirus in Salmo salar RBCs, the cells showed a major phenotypic change and were found to activate innate antiviral immunity [34]. Also, when the irresistible salmon anemia virus contaminated the RBCs of Atlantic salmon, RBCs would release cytokines to modulate leukocyte activity [11, 35]. A family of low molecular weight proteins-Cytokines is secreted by activated immune-related cells, which are induced by several pathogens such as bacteria, viruses and parasites [36]. Cytokines could be majorly grouped into ILs (interleukins), TNFs (tumor necrosis factors), chemokines, and IFNs (interferons) [37]. Cytokines play significant function in host defense and inflammation [38–40]. In this report, by the analysis of KEGG enrichment pathways, we observed that TNF signaling pathways and cytokine-cytokine receptor interaction were activated after the A. hydrophila infection in grass carp RBCs. The qRT-PCR results also showed that the mRNA levels of 6 cytokines (CCL4, CCL11, CCL20, IL4, IL12, and IFN-α) were all significantly up-regulated after RBCs were challenged by A. hydrophila. These results indicated that the RBCs can also perform antibacterial functions by releasing a series of cytokines, which share a similar function with leukocyte. However, the details of the regulation of these cytokines need to be further elucidated.

Programmed cell death or apoptosis has a broad range of physiological functions, including fighting against the infection [41]. Apoptosis mainly occurs as three distinct pathways: endoplasmic reticulum pathway, death receptor pathway, and mitochondrial pathway [42]. For death receptor pathway, external factors can activate a member of this family on the cell membrane (for example; Fas), resulting in a series of activations of proteins, including caspase 8 and caspase 3, and ultimately results in cellular apoptosis [43]. The mitochondrial pathway is triggered by mitochondrial membrane potential changes under the action of foreign factors, resulting in releasing C cytochrome, afterwards triggers caspase 3 and caspase 9, resulting in programmed cell death [44]. For the endoplasmic reticulum pathway, the imbalance of calcium ion concentration in the endoplasmic reticulum led to the triggering of caspase 12, which then triggers the caspase 3 and 9, and initiation of cell death [45]. Here, our result showed that the A. hydrophila infection could significantly induce cellular apoptosis in grass carp RBCs after determined by an annexin V/PI apoptosis kit. To further address the apoptosis pathway, RNA-seq data were subjected to analysis. The outcomes indicated that A. hydrophila infection could up-regulated four gene’s expressions (P53, Fas, LRDD, and caspase 8) which were closely related with the death receptor apoptosis pathway, indicating that A. hydrophila infection could activate Fas-related death receptor apoptosis pathway. Interestingly, the Fas and caspase 9 genes of apoptosis-related pathways were the most over-expressed in RBCs of rock bream infected with a megalocytivirus [46].

Based on the previous study in mammals [47], it tempts us to speculate that A. hydrophila infection might activate p53, subsequently activates the Fas trimerizing, which in turn results in the specialized adaptor protein’s recruitment and cause oligomerization of caspase to activate 8. Thereafter, the oligomerized caspase 8 directly splits and caspase to become active 3, which eventually leads to the cell death (Fig. 10). However, the detailed mechanism needs to be elucidated in the future. It does not escape our notice, we also observe that after A. hydrophila infection, the expression of caspase 9 was also up-regulated (data not show), showing that A. hydrophila infection may likewise enact and may contains other cellular apoptosis pathways in grass carp RBCs after bacterial infection, however, the exact mechanisms remain to be further researched.

To summarize, we have shown that the RBCs of grass carp can produce immunological reactions to A. hydrophila infection. These reactions were characterized by the up-regulation of cytokines and activation of the death receptor apoptosis pathway. These findings give new bits of knowledge into a further comprehension of the system of anti-A. hydrophila immunity in grass carp and add to mitigating an economically significant bacterial infection influencing aquaculture of grass carp.

RBCs

Red blood cells; DEGs:differently expressed genes; LRDD:Leucine-rich repeats and death domain containing; PRRs:pattern recognition receptors; PGRP:peptidoglycan recognition protein; TLRs:Toll-like receptors; SNP:single-nucleotide polymorphism; NGS:next-generation sequencing; WBCs:white blood cells;

CCR

cytokine-cytokine receptor; qRT-PCR:quantitative real-time PCR; FBS:fetal bovine serum; RPKM:readings-per-kilobase-per-million-mapped-reads; nr:non-redundant; GO:Gene Ontology; FC:fold change; FDR:False Discovery Rate; SD:standard deviation; TF:transcription factors; ILs:interleukins; TNFs:tumor necrosis factors; IFNs:interferons; CCL:CC chemokines.

Ethics approval and consent to participate

All grass carp tests were done in careful observance with the guidance of the Ministry of Science and Technology of China 2006 and affirmed by the Zhongkai University of Agriculture and Engineering’s Animal Ethics Committee.

Consent for publication

Not applicable.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Competing interests

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Funding

This work was jointly supported by the National Natural Science Foundation of China (31902409, 31872606, 31572657, U1701233); Foundation of Guangdong Provincial Marine and Fisheries Bureau (GDME-2018C006, D21822202); Foundation of China-ASEAN Maritime Cooperation (CAMC-2018F); Guangdong Provincial Special Fund For Modern Agriculture Industry Technology Innovation Teams (2019KJ141). JL was supported by the Pearl River Scholarship from Guangdong Province.

Authors’ contributions

Li Lin, Zhendong Qin conceived and designed the project; Zhijie Lu, Minxuan Yang participated in data analysis and figure preparation; Zhijie Lu, Minxuan Yang prepared the manuscript; Kai Zhang, Fanbin Zhan, Fenglin Li, Fei Shi, revised the manuscript; Yanan Li, Lijuan Zhao, Jun Li participated in discussions and provided suggestions.

Acknowledgements

Not applicable.

Authors’ information

¹Guangdong Provincial Water Environment and Aquatic Products Security Engineering Technology Research Center, Guangzhou Key Laboratory of Aquatic Animal Diseases and Waterfowl Breeding, College of Animal Sciences and Technology, Zhongkai University of Agriculture and Engineering, Guangzhou, Guangdong Province, 510222. ²School of Biological Sciences, Lake Superior State University, Sault Ste. Marie, MI, 49783, USA

Shen Y, Wang L, Fu J, Xu X, Li J. Population structure, demographic history and local adaptation of the grass carp. BMC Genom. 2019;20(1):467.
Xu XY, Shen YB, Fu JJ, Liu F, Li JL. Characterization of MMP-9 gene from grass carp (Ctenopharyngodon idella): An Aeromonas hydrophila-inducible factor in grass carp immune system. Fish Shellfish Immunol. 2013;35(3):801–7.
Dang Y, Meng X, Wang S, Li L, Zhang M, Hu M, Xu X, Shen Y, Lv L, Wang R, et al. Mannose-binding lectin and its roles in immune responses in grass carp (Ctenopharyngodon idella) against Aeromonas hydrophila. Fish Shellfish Immunol. 2018;72:367–76.
Glomski CA, Tamburlin J, Chainani M. The phylogenetic odyssey of the erythrocyte. III. Fish, the lower vertebrate experience. Histology Histopathology. 1992;7(3):501–28.
Ivan N, Mar OVMD, Spindler KR. Nucleated red blood cells: Immune cell mediators of the antiviral response. PLoS pathogens. 2018;14(4):e1006910.
Puente-Marin S, Nombela I, Ciordia S, Mena MC, Chico V, Coll J. MDM. O-V: In Silico Functional Networks Identified in Fish Nucleated Red Blood Cells by Means of Transcriptomic and Proteomic Profiling. Genes. 2018;9(4):202–13.
Passantino L, Altamura M, Cianciotta A, Patruno R, Tafaro A, Jirillo E. Fish immunology. i. binding and engulfment of candida albicans by erythrocytes of rainbow trout (salmo gairdneri richardson). Journal of Immunopharmacology. 2002;24(4):665–78.
Rodriguez MF, Wiens GD, Purcell MK, Palti Y. Characterization of Toll-like receptor 3 gene in rainbow trout (Oncorhynchus mykiss). Immunogenetics. 2005;57(7):510–9.
Nombela I, Puente-Marin S, Chico V, Villena AJ, Ortega-Villaizan MDM. Identification of diverse defense mechanisms in rainbow trout red blood cells in response to halted replication of VHS virus. F1000research 2018, 6:1958.
Nombela I, Carrion A, Puente-Marin S, Chico V, Mercado L, Perez L. Infectious pancreatic necrosis virus triggers antiviral immune response in rainbow trout red blood cells, despite not being infective. F1000research 2017, 6:1968.
Workenhe ST, Kibenge MJ, Wright GM, Wadowska DW. Infectious salmon anaemia virus replication and induction of alpha interferon in Atlantic salmon erythrocytes. Virology Journal. 2008;5(1):36.
Huang Y, Huang X, Yan Y, Cai J, Qin Q. Transcriptome analysis of orange-spotted grouper (Epinephelus coioides) spleen in response to Singapore grouper iridovirus. Bmc Genomics. 2011;12(1):556.
José M, Blanca J, Cañizares, Ziarsolo P, Esteras C, Mir G, Nuez F. Melon Transcriptome Characterization: Simple Sequence Repeats and Single Nucleotide Polymorphisms Discovery for High Throughput Genotyping across the Species. Plant Genome. 2011;4(2):118–31.
Ozsolak F, Milos PM. RNA sequencing: advances, challenges and opportunities. Nat Rev Genet. 2010;12(2):87–98.
Long M, Zhao J, Li T, Tafalla C, Zhang Q, Wang X. Transcriptomic and proteomic analyses of splenic immune mechanisms of rainbow trout (Oncorhynchus mykiss) infected by Aeromonas salmonicida subsp. salmonicida. Journal of proteomics. 2015;122(3):41–54.
Polinski MP, Bradshaw JC, Inkpen SM, Richard J, Johnson SC. De novo assembly of Sockeye salmon kidney transcriptomes reveal a limited early response to piscine reovirus with or without infectious hematopoietic necrosis virus superinfection. Bmc Genomics. 2016;17(1):848.
Ye H, Xiao S, Wang X, Wang Z, Zhang Z, Zhu C, Hu B, Lv C, Zheng S, Luo H. Characterization of Spleen Transcriptome of Schizothorax prenanti during Aeromonas hydrophila Infection. Mar Biotechnol. 2018;20(2):246–56.
Zhu J, Li C, Ao Q, Tan Y, Luo Y, Guo Y, Lan G, Jiang H, Gan X. Trancriptomic profiling revealed the signatures of acute immune response in tilapia (Oreochromis niloticus) following Streptococcus iniae challenge. Fish Shellfish Immunol. 2015;46(2):346–53.
Wang R, Hu X, Lü A, Liu R, Sun J, Sung YY, Song Y. Transcriptome analysis in the skin of Carassius auratus challenged with Aeromonas hydrophila. Fish Shellfish Immunol. 2019;94:510–6.
Jiang N, Fan Y, Zhou Y, Wang W, Ma J, Zeng L. Transcriptome analysis of Aeromonas hydrophila infected hybrid sturgeon (Huso dauricus × Acipenser schrenckii). Scientific reports. 2018;8(1):17925.
Jiang Y, Feng S, Zhang S, Liu H, Feng J, Mu X, Sun X, Xu P. Transcriptome signatures in common carp spleen in response to Aeromonas hydrophila infection. Fish Shellfish Immunol. 2016;57:41–8.
Li G, Zhao Y, Wang J, Liu B, Sun X, Guo S, Feng J. Transcriptome profiling of developing spleen tissue and discovery of immune-related genes in grass carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 2016;60:400–10.
Shen Y, Wang D, Zhao J, Chen X. Fish red blood cells express immune genes and responses. Aquaculture Fisheries. 2018;3(1):14–21.
Qin Z, Sarath Babu Vijayaraman, Lin H, Dai Y, Zhao L, Xie J, Lin W, Wu Z, Li J, Lin L. Antibacterial activity of erythrocyte from grass carp (Ctenopharyngodon idella) is associated with phagocytosis and reactive oxygen species generation. Fish Shellfish Immunol. 2019;92:331–40.
Liu L, Zhou Y, Zhao X, Wang H, Wang L, Yuan G, Asim M, Wang W, Zeng L, Liu X. Oligochitosan stimulated phagocytic activity of macrophages from blunt snout bream (Megalobrama amblycephala) associated with respiratory burst coupled with nitric oxide production. Developmental Comparative Immunology. 2014;47(1):17–24.
Quan S, Zhou G, Cai Y, Fan Y, Zhu X. Transcriptome analysis of stem development in the tumourous stem mustard Brassica juncea var. tumida Tsen et Lee by RNA sequencing. BMC Plant Biology 2012.
Qin Z, Babu VS, Wan Q, Zhou M, Liang R, Muhammad A, Zhao L, Li J, Lan J, Lin L. Transcriptome analysis of Pacific white shrimp (Litopenaeus vannamei) challenged by Vibrio parahaemolyticus reveals unique immune-related genes. Fish Shellfish Immunol. 2018;77:164–74.
Lu Z, Yang G, Qin Z, Shen H, Zhang M, Shi F, Li J, Sarath Babu V, Lin L. Glutamate related osmoregulation of guanine nucleotide-binding protein G (I) α2 from giant freshwater prawn (Macrobrachium rosenbergii) during molting and salinity stress. Aquaculture. 2020;521:735000.
Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative C(T) method. Nature protocols. 2008;3(6):1101–8.
Fadok Va, Voelker DR, Campbell Pa, Cohen JJ, Bratton DL, Henson PM. Exposure of phosphatidylserine on the surface of apoptotic lymphocytes triggers specific recognition and removal by macrophages. Journal of immunology (Baltimore Md: 1950). 1992;148(7):2207–16.
Lu Z, Qin Z, Sarath Babu V, Ye C, Su G, Li J, Yang G, Shen H, Pan G, Lin L. Expression and functional characterization of glutamine synthetase from giant freshwater prawn (Macrobrachium rosenbergii) under osmotic stress. Aquaculture Research 2019.
Goh SH, Josleyn M, Lee YT, Danner RL, Gherman RB, Cam MC, Miller JL. The human reticulocyte transcriptome. Physiol Genom. 2007;30(2):172–8.
Lewis JM, Hori TS, Rise ML, Walsh PJ, Currie S. Transcriptome responses to heat stress in the nucleated red blood cells of the rainbow trout (Oncorhynchus mykiss). Physiol Genom. 2010;42(3):361–73.
Dahle MK, Wessel Ø, Timmerhaus G, Nyman IB, Jørgensen SM, Rimstad E, Krasnov A. Transcriptome analyses of Atlantic salmon (Salmo salar L.) erythrocytes infected with piscine orthoreovirus (PRV). Fish Shellfish Immunol. 2015;45(2):780–90.
Passantino L, Massaro MA, Jirillo F, Di Modugno D, Ribaud MR, Di Modugno G, Passantino GF, Jirillo E. Antigenically Activated Avian Erythrocytes Release Cytokine-Like Factors: A Conserved Phylogenetic Function Discovered in Fish. Immunopharmacology Immunotoxicology. 2007;29(1):141–52.
Salazar-Mather TP, Hokeness KL. Cytokine and Chemokine Networks: Pathways to Antiviral Defense. Curr Top Microbiol Immunol. 2006;303(1):29–46.
Savan R, Sakai M. Genomics of fish cytokines. Comparative Biochemistry Physiology Part D Genomics Proteomics. 2006;1(1):89–101.
Alejo A, Tafalla C. Chemokines in teleost fish species. Dev Comp Immunol. 2011;35(12):1215–22.
Robertsen BR. The interferon system of teleost fish. Fish Shellfish Immunol. 2006;20(2):172–91.
Secombes CJ, Wang T, Bird S. The interleukins of fish. Developmental Comparative Immunology. 2011;35(12):1336–45.
Rathmell JC, Thompson, Craig B. Pathways of apoptosis in lymphocyte development, homeostasis. and disease Cell. 2002;109(2):97–107.
Kroemer G, Galluzzi L, Brenner C. Mitochondrial membrane permeabilization in cell death. Physiological reviews. 2007;87(1):99–163.
Locksley RM, Killeen N, Lenardo MJ. The TNF and TNF receptor superfamilies: Integrating mammalian biology. Cell. 2001;104(4):487–501.
Brenner D, Mak TW. Mitochondrial cell death effectors. Curr Opin Cell Biol. 2009;21(6):871–7.
Skaar EP, Humayun M, Bae T, Debord KL, Schneewind O. Iron-source preference of Staphylococcus aureus infections. Science. 2004;305(5690):1626–8.
Myung-Hwa. Jung, Verónica, Chico, Sergio, Ciordia, Maria, Carmen, Mena, Sung-Ju: The Megalocytivirus RBIV Induces Apoptosis and MHC Class I Presentation in Rock Bream (Oplegnathus fasciatus) Red Blood Cells. Frontiers in immunology. 2019;10(4):160.
Fuchs Y, Steller H. Programmed Cell Death in Animal Development and Disease. Cell. 2011;147(4):742–58.

Table 1

List of primers used for RT-qPCR.

Gene name	Forward primer (5'-3')	Reverse primer (5'-3')
CCL4	TGCTGTTTCTCCTATACGGATCG	TTTCTGGATGAGCTTCTGTACCC
CCL11	CTAGAGTTGGAGTGACATGCTGT	AGCAGTACTTGTCCTTCTCTGTG
CCL20	CTTCAACCTGCCTTTGTCTCAAG	CGGAGCAAAAAGACAATCCTCTG
IL4	CTCTTGGCACTGACATTTGTAGC	GGTTATGTAGGGTCTGGTTCACA
IL12	GCACTCACGGTACTGTCCTAAAT	CTAACGACTGTTTTGGTGAGCTC
IFN	GATAAGCAACGAGTCTTTGAGCC	GAATTCATGTGCTCTCTGGCATC
Fas	CATGTTCCTCTTCATCCCCAGAA	TGGAAGACAGTGAGGAAAAGGAG
Caspase8	GTTTCTGTGCATGGACCTGATTC	CAGCTCTCTTTCCACTTCCTCTT
p53	CCAGACCTGAACAAGCTCTTTTG	GAGCCAATCCATCAGTATCAGGT
LRDD	GTTCTACCAGAGGATTTGGCAGA	GAGCTGGGTCATTTTTCGATAGC
β-actin	ACCCACACCGTGCCCATCTA	CGGACAATTTCTCTTTCGGCTG

Download PDF

Version 1

posted

You are reading this latest preprint version

Aeromonas Hydrophila Infection Activates Death Receptor Apoptosis Pathway in the RBCs of Grass Carp (Ctenopharyngodon idellus)

Status:

Version 1

Abstract

Figures

Background

Materials And Methods

Results

Transcriptomic sequencing and de novo assembly analysis

Functional Explanation Of The Degs

Analysis Of Kegg Enrichment Pathways

Detection Of Immune-related Degs

Discussion

Conclusions

Abbreviations

Declarations

References

Tables

Status:

Version 1