Investigating the Expression and the Activity Patterns of Proteasomal Subunits in Livers with HBV infection and HBV-Derived HCC

doi:10.21203/rs.3.rs-4996009/v1

Download PDF

Research Article

Investigating the Expression and the Activity Patterns of Proteasomal Subunits in Livers with HBV infection and HBV-Derived HCC

https://doi.org/10.21203/rs.3.rs-4996009/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background & Aims:

Hepatocellular Carcinoma (HCC) is the most prevalent types of liver cancer worldwide, with chronic infection of Hepatitis B Virus (HBV) being a major risk factor. The ubiquitin-proteasome system plays a critical role in protein degradation, cellular homeostasis, and cell cycle regulation. Dysregulation of proteasomal activity has been implicated in various cancers, including HCC. However, the specific expression patterns of proteasomal subunits in HBV infection and HBV-induced HCC remain poorly understood. Additionally, it is not known whether the mRNA expression of proteasome subunits correlates with the activity.

Methods & Results:

To fill this knowledge gap, we analyzed the proteasomal subunit mRNA expression levels in a liver-humanized mouse model after HBV infection. We found that the chymotrypsin-like activity (β5) subunit of the proteasome (PSMB5) was overexpressed after HBV infection. β5-deficient cells showed lower cell surface MHC I levels and increased accumulation of ubiquitinated proteins indicating an expression-function correlation. Similar to the mRNA expression data, protein levels of β5 subunit was higher in HBV-infected patient livers, and the infected liver tissue showed higher chymotrypsin-like proteolytic activity. The Protein Atlas data analysis also indicated that higher mRNA expression of β5 is associated with poor prognosis in HCC.

Conclusions

In summary, HBV infection increases both protein levels and the proteolytic activity of proteasomes in infected livers. The dynamics of protein degradation by proteasomes in HBV infected livers with HCC is of great importance to be able to develop better treatment strategies.

Gastroenterology & Hepatology

Hepatitis B virus

proteasome

chymotrypsin-like activity

hepatocellular carcinoma

Ubiquitin proteasomal system (UPS) is the main degradation pathway for redundant and non-naïve proteins. UPS consists of the central proteolytic complex 26S proteasome and complex enzymatic machinery that catalyze the attachment of ubiquitin chains to target proteins to be degraded [1]. The catalytic core of the 26S proteasome is called the 20S proteasome, and its three different β subunits can hydrolyze peptide substrates with chymotrypsin-like β5, trypsin-like β2 and caspase-like β1 activities [2]. The 19S proteasome is referred to as the regulatory particle and it is responsible for the deubiquitination and unfolding of the target proteins and leading them to the catalytic part of the proteasome. Proteolytic degradation by the 26S proteasome is ubiquitination- and ATP- dependent while 20S proteasome is able to degrade proteins without the need of ubiquitination and ATP. Mainly oxidized proteins are rapidly degraded by the 20S proteasome [3]. In addition to protein degradation, UPS is involved in many essential cellular pathways such as cell signaling, regulation of the cell cycle, cell differentiation, immune response and neuronal activity [4–6]. An inducible form of the constitutive proteasome, immunoproteasome, plays a critical role in immunity by antigen processing and presentation to major histocompatibility complex (MHC) class I molecules to cytotoxic T lymphocytes [7]. Today several diseases such as cancers, neurodegenerative diseases and immune system-related disorders are known to be caused by malfunction of UPS components [8].

HBV is a small, enveloped DNA virus that attacks the liver and establishes a lifelong chronic infection. The tolerogenic properties of the liver and the non-cytopathic nature of HBV make it difficult to completely clear the virus by the host immune system [9, 10]. The WHO estimates 1.2 million new infections each year and 254 million people were estimated to be living with chronic HBV (CHB) infection in 2022. In 2022, 1.1 million deaths were ascribed to HBV and HBV-related liver complications such as hepatocellular carcinoma (HCC) [11]. HCC is the most common liver malignancy and the chance of developing HCC is 10-25-fold higher in chronically HBV infected patients [11–13]. HBV replication and release heavily depends on host factors and HBV regulates cellular pathways selectively. One of these altered pathways is the proteasomal system. It has been demonstrated by several research groups that HBV proteins are selectively degraded by UPS and HBV is capable of escaping innate immune recognition via altering UPS targets [14–16]. However, a systematic approach to study HBV- and HBV-induced HCC-dependent changes in the expression and activity of proteasomal subunits are still missing [17, 18]. Thus, the current study aims to fill this knowledge gap using highly relevant models like HBV infected, liver-humanized mouse models [19, 20] and also HBV-infected HCC and non-HCC patient liver and blood samples.

Herein, we report that HBV infection results in an increase in chymotrypsin-like β5 (PSMB5) subunit levels in the human primary hepatocytes of a liver-humanized mouse model. PSMB5 gene-deficient THP-1 cells showed that PSMB5 levels affect the cell surface MHC I levels, and also intracellular ubiquitinated protein levels. Our major findings are that both liver tissue and serum samples of HBV infected and HBV-induced HCC patients have higher levels of PSMB5 which is supported by lower ubiquitinated and carbonylated protein levels. These results points to a higher protein turnover signature which might be an innate immune response escape mechanism by the persistent HBV infection.

Patients and sample collection

The liver tissues and the serum samples were obtained from 10 non-viral HCC, 10 chronic HBV patients and 10 HBV-induced HCC patients who underwent liver biopsy or transplantation surgery at Koc University hospital and Istanbul Medipol Hospital from 2015 to 2021. The diagnosis of HCC was confirmed by histopathologic examination. Liver tissues were immediately frozen in liquid nitrogen. Then liver tissues and the plasma samples were kept at -80°C until further experiments. Patients who received chemotherapy or radiotherapy prior to surgery were not included to the study. 2 chronic HBV and 1 HBV-induced HCC patients were not included in the analysis due to coinfections with HCV or HDV. 1 HBV-HCC and 1 non-HBV-HCC patient were not included in the study because the resection material IHC staining showed less than 30% tumor tissue. For comparison, serum samples from 10 healthy donors who did not have apparent liver disease (healthy control) were included as controls. For group demographics, please see Table-1. This study was approved by the Ethics Committee of Marmara University (Protocol number 09.2018.552) and Koç University (2015.053.IRB1.014, 2017.139.IRB2.048, 2016.024.IRB2.005). The written informed consent was obtained from all study participants.

Preparation of liver tissue lysates

Liver lysates were prepared using a lysis buffer containing 250 mM sucrose 25 mM HEPES, 10 mM MgCl2, 1 mM EDTA and 1.6 mM DTT with sample homogenization beads in a tissue homogenizer (Bullet Blender, Next Advance). The homogenates were centrifuged at 13400 g for 30 minutes. Immediately afterwards, assays were performed with the supernatant. The protein concentrations of the lysates were measured using a protein assay kit (Bio-Rad) according to the manufacturer's protocol.

Proteasome activity

The chymotrypsin-like activity (β5) of the proteasome was measured with the fluorogenic substrate Suc-Leu-Leu-Val-Tyl-4-methylcoumaryl-7-amide (Suc-LLVY-AMC). 10 µL lysates were incubated in 225 mM Tris, 45 mM KCl, 7.5 mM MgCl2, 7.5 mM C₄H₆MgO₄ and 1 mM DTT (total volume of reaction mixture: 110 µL) for 10 mins at room temperature. Then, 10 µL of 20 mM Suc-LLVY-AMC (Sigma) was added to the mixture and incubated for 30 mins at 37°C. The fluorescence intensity of the free AMC was measured at 360 nm excitation and 460 nm emission with a microplate reader (Enspire, Perkin-Elmer). The proteasome activity calculation was made with a free AMC standard curve and results were normalized to the protein concentration and time.

Protein levels of ubiquitin, protein carbonyl and proteasome β1, β2 and β5 subunits

Ubiquitin, protein carbonyl and proteasome β1, β2 and β5 subunits protein levels were determined using commercial ELISA kits from serum and tissue lysates. Proteasome β5 kit was obtained from MyBioSource and all other kits were obtained from Bioassay Technology Laboratory. Assays were carried out according to the manufacturers' protocols. The results were normalized to the protein concentration for the liver tissue lysates.

Mouse origin, transplantation and infection

Urokinase-type plasminogen activator (uPA)/NOD/Shi-scid/IL2Rγnull(NOG) mice were kindly provided by the Central Institute for Experimental Animals (Kawasaki, Japan) [21]. Mice were bred at the Central Animal Facility of the Erasmus Medical Center. Zygosity of mice was determined as described previously [22]. Mice were co-housed with a maximum of 4 mice per individually ventilated cage and were fed normal chow ad libitum. Mice were anesthetized and transplanted via intra-splenic injection with 0.5-2 x 10⁶ commercially available cryopreserved human hepatocytes (Lonza, Basel, Switzerland and Corning, Corning, NY, USA). Graft uptake was determined by human albumin in mouse serum using an ELISA with cross-adsorbed human albumin antibody (Bethyl laboratories, Montgomery, Tx, USA, [23]). The study protocol was approved by the animal ethics committee of the Erasmus Medical Center (DEC nr 141-12-11).

Eight weeks after transplantation, successfully engrafted human-liver chimeric mice were inoculated intravenously (i.v.) with 200 µl patient serum containing HBV gtA (7.7 log IU/ml). After viral inoculation, mice were housed individually. HBV viral load was measured in mouse serum and liver using a dual target approach, using primers and probes targeting preS-gen, as described before [24, 25], and the X gene (HBV XJfwd12 5’-ggtctgtgccaagtgtttgst-3’, HBVXJprobe 5’-FAM-acgcaacccccactggctggg-BHQ1-3’, HBV XJrev12, 5’-tycgcagtatggatcgsc-3’).

Immunohistochemistry Staining

Transplanted mouse livers were fixed in 4% formaldehyde solution (Merck-Millipore) and standard hematoxylin and eosin (H&E) staining was performed, and mouse anti-human mitochondria antibody (Merck) used to visualize transplanted human hepatocytes. To visualize the detected antigens, 3,3′-diaminobenzidine (DAB; Dako, Copenhagen, Denmark) was added as a substrate, and slides were counterstained with hematoxylin.

Cells

THP-1 (ATCC, TIN-202) cell line was grown in RPMI-1640 (Gibco) supplemented with 10% FBS (Hyclone), 1% NEAA (Gibco), 1% HEPES (Gibco) and 1% Antibiotic-Antimycotic (Gibco). For CRISPR-Cas9 targeting, cells were passed into 6 well plates (5-6x10⁵ cells/well) before spin infection. Antibiotic selection for CRISPR-Cas9 knockout cells was done for seven days in media containing 10 µg/mL blasticidin (Invivogen) and cells were grown in a 10% CO2 atmosphere at 37°C.

Plasmids

The plasmid used to target human PSMB5 gene (Human PSMB5 #117073) and the LentiCRISPRv2 plus blasticidin selection plasmid (#83480) were acquired from Addgene and the unmodified plasmid is the same as the “empty vector (EV)” plasmid. Heat transformed bacteria was grown overnight at 37°C on LB + Ampicillin (100 µg/mL) agar plates. Plasmids were isolated (Clontech) from individual colonies and sequenced (Genewiz-Azenta) using the primer hU6-F: 5’-GAGGGCCTATTTCCCATGATT-3’ to confirm sgRNA insertions. Following CRISPR-Cas9 knockout targeting, sgRNAs and target genomic DNA sequences were checked for high indel efficiencies in transduced cells by ICE CRISPR Analysis Tool (Synthego).

RNA Extraction and real time qPCR

Liver tissue was collected in RNAlater (Qiagen) and the cell lines were processed immediately after collection. RNA was extracted using RNeasy mini kit (Qiagen) and the samples were treated with DNAse-I enzyme to prevent genomic DNA contamination (RNase-Free DNase Set, Qiagen). cDNA was generated using the RNA to cDNA Ecodry Premix (Takara) according to the manufacturer’s protocol. Human specific gene expression was measured using a primer/SYBR green quantitative PCR method. Primer combinations are purchased from IDT and listed in Table-2. Expression of target genes was normalized to the expression of GAPDH using the formula 2-ΔCt, ΔCt = Cttarget-CtGADPH. cDNA from non-chimeric mouse livers was used as control to test cross-reactivity of housekeeping and target genes.

Western blotting

Cell lysates were prepared in RIPA buffer with protease inhibitor (Pierce), and protein concentrations were determined by BCA assay (Pierce). 30µg of denatured samples were run on 10% reducing gels (Genscript). After transfer, PVDF membranes (Millipore) were blocked with TBS-Tween 1x + 5% milk and then blotted with rabbit anti-human PSMB5 (BML-PW8895-0025, Enzo), rabbit anti-ubiquitin (07-375, Sigma Aldrich) in TBS-Tween 1x + 2% milk overnight at 4°C. The following day, membranes were washed 3x with TBS-Tween 1x, goat-anti-rabbit HRP (Millipore) was added for 1hr at RT, membranes were washed 3x, and HRP substrate (Millipore) was added. Following exposure, membranes were stripped (Millipore), blocked, and re-blotted with mouse anti-β-actin (Santa Cruz sc-47778) in TBS-Tween 1x + 2% milk overnight at 4°C. The following day, membranes were prepared as above.

Cell surface staining using flow cytometry analysis

Cells were stained with Zombie Violet fixable viability kit (Biolegend) to gate out the dead cells. Where indicated, human cells were stained for surface MHC class I (W6/32 hybridoma supernatant) followed by a donkey-anti-mouse Alexa 647 (Life Technologies). Geometric MFI values were shown for illustrations and FlowJo™ Software was used for data interpretation and data visualization.

Comparative gene expression analysis

Gene expression profiles of HCC samples were obtained from The Cancer Genome Atlas (TCGA, https://www.cancer.gov/tcga). Samples were analyzed by disease status (i.e. HCC or non-HCC) and HBV status (i.e. positive or negative). Data screening ended with 15 HBV-positive HCC, 226 HBV-negative HCC and 28 HBV-negative non-HCC (healthy) samples. The FPKM-normalized gene expression values were used for comparative analyses.

Statistical analysis

The results are given as the mean ± standard deviation of the mean (SD). Statistical analysis was made with GraphPad Prism 7 software and the differences between the groups were evaluated with the Mann-Whitney test and the statistical significance criterion was p < 0.05.

Higher levels of proteasomal subunit expression in HCC is associated with a poorer survival rate

The roles and expression of proteasomes in cancer prognosis have been variable in different cancers type. To investigate whether differential expression of proteasomal subunits potentially has consequences in HCC survival, we analyzed The Human Protein Atlas mRNA expression database [26]. Remarkably, there were significant negative correlations between the 5-year survival of HCC patients and that of virtually all of the 26S proteasome units (Table-3). In other words, HCC cases with low proteasomal subunit mRNA expression had better chances of 5-year survival (Figure-1A). These data are consistent with the strategy of proteasome targeting as a cancer therapy for the treatment of multiple myeloma (MM) and mantle cell lymphoma (MCL) [27, 28] and several other studies on the treatment of solid tumors [29–31].

HBV infection of liver-humanized mouse results in increase in PSMB5 transcript levels

To investigate proteasomal subunit dynamics in HBV-infected liver conditions, we used a human-liver chimeric mice model (Figure-1B-E). Successfully transplanted uPA-NOG mice were infected with patient serum containing HBV gtA. Livers of infected and non-infected human-liver chimeric mice were collected for further analysis 12 weeks after infection. When the expression of mRNAs coding for the human 26S proteasome subunits was analyzed by qPCR, we found around 2-fold elevations in the transcripts of PSMB5 and PSMB9 (Figure-1F).

Because the proteasomal subunit coded by PSMB5 gene, β-type 5 or chymotrypsin-like proteolytic activity subunit, is drugable and frequently targeted by proteasome inhibitors, we tested the roles of proteasomal subunit PSMB5 in vitro by generating a PSMB5-deficient cell line, THP-1. As mentioned earlier, UPS is not only the primary protein degradation machinery but also responsible for the peptide preparation for antigen presentation [32]. As a result, cells with deficient- chymotrypsin-like β5 unit, PSMB5, accumulated ubiquitinated proteins (Figure-2B) and MHC I cell surface expression was decreased (KO MFI GMFI: 7.06E + 03 vs wt/empty vector (EV) MHC I GMFI: 1.96E + 04, Figure-2C). This decrease is possibly due to depleted antigen pool [33] because mRNA expression levels of the antigen presentation components were only slightly decreased in comparison to the wild type THP-1 cells except ERAP1 (Figure-2D). Similarly, high PSMB5 expressing HBV-negative and –positive HCC tissues showed similar mRNA expression level of APC components and both HBV-negative and –positive tumor had significantly higher expression levels in comparison to HBV-healthy tissue (Figure-2E).

In summary, HBV infection results in an increase in PSMB5 expression levels and higher mRNA expression of PSMB5 was shown to be associated with poor survival in HCC cases. Because expression levels of PSMB5 affects protein turnover rate and antigen presentation, this might point to a role of PSMB5 in carcinogenesis.

HBV infected patient livers have higher chymotrypsin-like proteolytic activity.

In addition to being associated with poor survival in HCC, PSMB5 mRNA expression levels are higher in tumor tissues in comparison to the counterpart healthy tissues with an exemption of Acute Myeloid Leukemia ([34], Figure-3A). This led us to question whether this increase in transcript levels is associated with an increased activity of PSMB5, and whether this increase is affected by the HBV infection status of patients.

Proteasome subunit β-type 5 protein levels of fresh liver tissues and serum samples of HBV, non-viral HCC and HBV-positive HCC patients are measured using an ELISA method. HBV infected HCC and non-HCC liver samples had higher protein levels of PSMB5 and this was also observed in the serum samples (Figure-3B). Higher protein levels in PSMB5 is reflected by the chymotrypsin-like proteolytic activity of proteasomes as well; chronic HBV infected livers had higher levels of proteasome activity in comparison to livers with HCC (Figure-3C). HBV infected non-HCC livers had significantly lower levels of tissue ubiquitin and protein carbonylation (Figure-4A and − 4B) as a result of higher proteasome activity. Similar to the HBV-infected, human liver chimeric mouse model mRNA expression data, protein levels of PSMB1 and PSMB2 subunits are similar between the groups (Figure-4C and 4D).

In summary, HBV infected livers have higher levels of PSMB5 protein levels and show higher proteolytic activity. On the other hand, protein levels of PSMB1 and PSMB2 remain unchanged.

The proteasome is a complex protein structure responsible for degrading redundant or damaged proteins by proteolysis, a chemical reaction that breaks peptide bonds. Proteasome activity is crucial in regulating various cellular processes, including the cell cycle, apoptosis, and stress responses and imbalanced protein homeostasis is common among neurodegenerative, cardiovascular diseases and disorders of the immune system and cancer [35]. The crucial roles of the proteasome in the maintenance of the cellular homeostasis made them unique drugable targets in cancer treatment. Different proteasome inhibitors are currently approved for the treatment of different hematological malignancies and phase studies examining their effectiveness on different types of solid cancer are ongoing [43]. In the context of HCC, tumor cells often exhibit increased expression of proteasomal subunits (Table 3, Fig. 1A & 2A). This heightened activity may help cancer cells degrade misfolded or damaged proteins that could otherwise induce cell death. However, the direct role of functional abnormalities of the proteasomes in HCC progression and the contribution of different underlying etiologies are still unknown. Thus, the current study aims to fill this knowledge gap by studying the effects of HBV infection on normal primary hepatocytes and patient livers with and without HCC.

The studies to define HBV and UPS interaction mainly focused on HBx protein which is known to have an important role in HBV related HCC [36]. Because HBx is degraded by the proteasomes using ubiquitin-dependent and –independent pathways [37] and also HBV viral proteins are targeted by UPS degradation, proteasomes, especially immune proteasomes, are thought to facilitate the HBV replication in acute and chronic diseases [15, 37–40]. Our results showed that proteasome β1 and β2 subunit protein levels were highest in the liver tissues of the HCC patients. In contrast, β5 subunit activity and the protein levels were higher in HBV infected patient livers and serum samples. As it is known from the early genetic studies, the β5 subunit activity, chymotrypsin-like activity, of the proteasome is the most crucial in protein turnover [41]. In terms of serum levels of β5 subunit protein, control patients and HCC patients did not show any differences. This suggests that HBV infection has a more profound effect on the proteasome β5 subunit level and activity than having HCC. We were able to show that HCC increases protein ubiquitination and carbonylation in the patient liver samples and higher β5 subunit activity and protein level resulted in lower levels of ubiquitinated and carbonylated protein accumulation. This data suggest that HBV infection leads to an increased protein turnover and degradation ratio in infected hepatocytes. In an early study, Hu et al. (1999) determined a modest decrease in the proteasome’s β5 and β2 activities in the HBx expressing HepG2 cells. However, our findings suggest that HBV infection caused higher β5 activity in HBV infected primary hepatocytes and patients livers [42]. This difference might be related due to the peculiarities of the HBx-expression models or HepG2 cells.

In order to understand the functional importance of the relationship between HBV infections, HBV related HCC and UPS, there is a great need for systematic studies. Although there are many studies investigating the compounds that are targeting inhibition of UPS components in the treatment of HCC, studies that will investigate the clinical efficacy of these compounds are still needed [44]. Our major findings are that both liver tissue and blood samples of HBV infected and HBV-induced HCC patients have higher levels of PSMB5 which point to a higher protein turnover signature that might result in an innate immune response escape mechanism leading to persistent HBV infection and HCC development. If so, treating HBV in addition to HCC treatment may provide better response and survival in HBV-induced HCC patients. We believe that, understanding the dynamics of protein degradation by proteasomes in HBV infected HCC livers is of great importance to be able to improve treatment strategies.

HBV

Hepatitis B virus

HCC

Hepatocellular carcinoma

PSMB5

Proteasome 20S Subunit Beta 5

UPS

Ubiquitin proteasomal system

MHC

Major histocompatibility complex

CHB

Chronic hepatitis B

APC

Antigen presentation complex

sgRNA

Single guide RNA

uPA-NOG

urokinase-type plasminogen activator- NOD/Shi-scid IL2Rγ^null mouse

Author Contribution Statement

ATJ, GS, AB, FE and BKY designed study. ATJ, GS and SAE performed the experiments. MZ, YY, MD, BY and FE had performed the resection surgeries and biopsy material collection. MZ and FE collected patient information and demographics. KYA performed TCGA expression analysis. BKY and AB provided funding. ATJ, GS, AB and BKY analyzed the data and wrote the paper. All authors had seen and reviewed the final version of the paper.

Declaration of Competing Interest

The authors declared that they have no conflict of interest in this work.

Ethics approval and consent to participate

The study was approved by the Ethics Committee of Marmara University (Protocol number 09.2018.552) and Koç University (2015.053.IRB1.014, 2017.139.IRB2.048, 2016.024.IRB2.005). The written informed consent was obtained from all patients. The study protocol was approved by the animal ethics committee of the Erasmus Medical Center (DEC nr 141-12-11).

Consent for publication

All authors agreed on the final version of the article and submission to Journal of Liver International.

Availability of data and material

All figures and tables are cited within the manuscript accordingly. Reference links are available for all cited articles.

Acknowledgements & Funding

This study was supported by Marmara University Research Fund (BAPKO) with the Project Number SAG-B-130319-0089. The animal studies at Erasmus MC was supported by SLO.

Jung T, Catalgol B, Grune T (2009) The proteasomal system. Mol Aspects Med 30(4):191–296
Groll M et al (1997) Structure of 20S proteasome from yeast at 2.4 angstrom resolution. Nature 386(6624):463–471
Breusing N, Grune T (2008) Regulation of proteasome-mediated protein degradation during oxidative stress and aging. Biol Chem 389(3):203–209
Tanaka K (1995) Molecular biology of proteasomes. Mol Biol Rep 21(1):21–26
Ramachandran KV et al (2018) Activity-Dependent Degradation of the Nascentome by the Neuronal Membrane Proteasome. Mol Cell 71(1):169–177e6
Kammerl IE, Meiners S (2016) Proteasome function shapes innate and adaptive immune responses. Am J Physiol Lung Cell Mol Physiol 311(2):L328–L336
Vasuri F et al (2010) Studies on immunoproteasome in human liver. Part I: absence in fetuses, presence in normal subjects, and increased levels in chronic active hepatitis and cirrhosis. Biochem Biophys Res Commun 397(2):301–306
Summers ME (2019) Ubiquitin Proteasome System - Current Insights into Mechanism Cellular Regulation and Disease.
Cui F et al (2023) Global reporting of progress towards elimination of hepatitis B and hepatitis C. Lancet Gastroenterol Hepatol 8(4):332–342
Osmani Z, Boonstra A (2023) Recent Insights into the Role of B Cells in Chronic Hepatitis B and C Infections. Pathogens, 12(6)
WHO, Hepatitis B (2024) 9 April 2024 2024]; https://www.who.int/news-room/fact-sheets/detail/hepatitis-b
Kremsdorf D et al (2006) Hepatitis B virus-related hepatocellular carcinoma: paradigms for viral-related human carcinogenesis. Oncogene 25(27):3823–3833
Tsukuda S, Watashi K (2020) Hepatitis B virus biology and life cycle. Antiviral Res 182:104925
Kong F et al (2019) The interaction of hepatitis B virus with the ubiquitin proteasome system in viral replication and associated pathogenesis. Virol J 16(1):73
Vasuri F et al (2010) Studies on immunoproteasome in human liver. Part I: Absence in fetuses, presence in normal subjects, and increased levels in chronic active hepatitis and cirrhosis. Biochem Biophys Res Commun 397(2):301–306
Robek MD et al (2007) Role of immunoproteasome catalytic subunits in the immune response to hepatitis B virus. J Virol 81(2):483–491
Zhang ZS et al (2000) Structural and functional characterization of interaction between hepatitis B virus X protein and the proteasome complex. J Biol Chem 275(20):15157–15165
Bandi P et al (2010) Bortezomib inhibits hepatitis B virus replication in transgenic mice. Antimicrob Agents Chemother 54(2):749–756
Sari G et al (2019) Hepatitis E Virus Shows More Genomic Alterations in Cell Culture than In Vivo. Pathogens, 8(4)
Sari G et al (2021) Treatment induced clearance of hepatitis E viruses by interferon-lambda in liver-humanized mice. Liver Int 41(12):2866–2873
Suemizu H et al (2008) Establishment of a humanized model of liver using NOD/Shi-scid IL2Rgnull mice. Biochem Biophys Res Commun 377(1):248–252
van de Garde MDB et al (2016) Hepatitis E Virus (HEV) Genotype 3 Infection of Human Liver Chimeric Mice as a Model for Chronic HEV Infection. J Virol 90(9):4394–4401
Vanwolleghem T et al (2010) Factors determining successful engraftment of hepatocytes and susceptibility to hepatitis B and C virus infection in uPA-SCID mice. J Hepatol 53(3):468–476
Pas SD, Niesters HG (2002) Detection of HBV DNA using real time analysis. J Clin Virol 25(1):93–94
Pas SD et al (2000) Development of a quantitative real-time detection assay for hepatitis B virus DNA and comparison with two commercial assays. J Clin Microbiol 38(8):2897–2901
Cancer Genome Atlas Research Network (2017) Electronic address, w.b.e. and N. Cancer Genome Atlas Research, Comprehensive and Integrative Genomic Characterization of Hepatocellular Carcinoma. Cell 169(7):1327–1341e23
Leonardo-Sousa C et al (2022) Revisiting Proteasome Inhibitors: Molecular Underpinnings of Their Development, Mechanisms of Resistance and Strategies to Overcome Anti-Cancer Drug Resistance. Molecules, 27(7)
Sari G et al (2018) Proteasome Inhibitors in Cancer Therapy and their Relation to Redox Regulation. Curr Pharm Des 24(44):5252–5267
Roeten MSF, Cloos J, Jansen G (2018) Positioning of proteasome inhibitors in therapy of solid malignancies. Cancer Chemother Pharmacol 81(2):227–243
Weyburne ES et al (2017) Inhibition of the Proteasome β2 Site Sensitizes Triple-Negative Breast Cancer Cells to β5 Inhibitors and Suppresses Nrf1 Activation. Cell Chem Biology 24(2):218–230
Van Stiphout CM, Luu AK, Viloria-Petit AM (2022) Proteasome Inhibitors and Their Potential Applicability in Osteosarcoma Treatment. Cancers, 14(19)
Rana PS, Ignatz-Hoover JJ, Driscoll JJ (2023) Targeting Proteasomes and the MHC Class I Antigen Presentation Machinery to Treat Cancer, Infections and Age-Related Diseases. Cancers (Basel), 15(23).
Sari G, Rock KL (2023) Tumor immune evasion through loss of MHC class-I antigen presentation. Curr Opin Immunol 83:102329
Tang Z et al (2017) GEPIA: a web server for cancer and normal gene expression profiling and interactive analyses. Nucleic Acids Res 45(W1):W98–W102
Schmidt M, Finley D (2014) Regulation of proteasome activity in health and disease. Biochim Biophys Acta 1843(1):13–25
Levrero M, Zucman-Rossi J (2016) Mechanisms of HBV-induced hepatocellular carcinoma. J Hepatol 64:S84–S101
Kim JH et al (2008) Ubiquitin-dependent and -independent proteasomal degradation of hepatitis B virus X protein. Biochem Biophys Res Commun 366(4):1036–1042
Robek MD et al (2007) Role of immunoproteasome catalytic subunits in the immune response to hepatitis B virus. J Virol 81(2):483–491
Qian GH et al (2012) NIRF, a novel ubiquitin ligase, interacts with hepatitis B virus core protein and promotes its degradation. Biotechnol Lett 34(1):29–36
Braun S et al (2007) Proteasomal degradation of core protein variants from chronic hepatitis B patients. J Med Virol 79(9):1312–1321
Goldberg AL (2007) Functions of the proteasome: from protein degradation and immune surveillance to cancer therapy. Biochem Soc Trans 35:12–17
Hu ZY et al (1999) Hepatitis B virus X protein is both a substrate and a potential inhibitor of the proteasome complex. J Virol 73(9):7231–7240
Manasanch EE, Orlowski RZ (2017) Proteasome inhibitors in cancer therapy. Nat Reviews Clin Oncol 14(7):417–433
Chen YJ, Wu H, Shen XZ (2016) The ubiquitin-proteasome system and its potential application in hepatocellular carcinoma therapy. Cancer Lett 379(2):245–252

Table-1: Patient and healthy control demographics.

Characteristics	HBV (n=8)	Non-HBV+HCC (n=8)	HBV+HCC (n=8)	Healthy Controls (n=10)
Male/Female n (%)	6/2 (75.0) / (25.0)	6/2 (75.0) / (25.0)	8/0 (100.0 / 0.0)	5/5 (50.00/50.00)
Age (±)	52.4 ± 7.5	53.8 ± 19.3	61.8 ± 6.0	47.6 ±9.6
Cirrhosis? n (%)	Yes 8 (100.0)	Yes 4 (75.00)	Yes 5 (62.5)	NA
ALT(±)	31.3 ± 30.3	39.1 ± 39.9	31.6 ± 7.3	20.8± 4.05
Ethnicity n(%)	White 8 (100.0)	White 8 (100.0)	White 8 (100.0)	White 10 (100.00)
Fibrosis Parameters
FIB-4 Index(±)	6.8 ± 3.9	5.4 ± 2.2	3.9 ± 2.8	NA
ISHAK Score (%)	6 (100)	NA	NA	NA
Fibrosis Stage n (%)^*				NA
F0-2	NA	1 (12.5)
F3	NA	1 (12.5)	1 (12.5)
F4	NA	4 (50.0)	5 (62.5)
Data presented as mean ± SD. Categorical variables are given as frequencies (percentages). *In the HCC and HBV+HCC cohorts, two patients had missing data on their fibrosis stage. Abbreviations: ALT, Alanine transaminase; FIB-4, Fibrosis-4; HBV, Hepatitis B virus; HCC, Hepatocellular carcinoma; NA, Not applicable

Table-2: Primer combinations used for qPCR.

Target	Sequence	Target	Sequence
PSMA1-F	ATACTTTCGGCAGCACCTCC	PSMB10-R	CTGCGGTCCAGTCAGGTCTA
PSMA1-R	AGACCAACTGTGGCTGAACC	PSMB11-F	CGTGGCTATCGCTACGACAT
PSMA2-F	GTGCTTTGGCTCTTCGGGTA	PSMB11_R	TGACACATGCTCCCATCCAC
PSMA2-R	GCTTTAATTCCCACGGACGG	PSMC2-F	ACAGCCTTTACAGGTTGCCA
PSMA3-F	GGCTGCAGTTTCATGTTAGGG	PSMC2_R	CTATCCACGCCCACTCTCATC
PSMA3-R	GATGGCACAGCCCCAATAAC	PSMC3_F	ATTGGGGGTTTGGACAAGCA
PSMA5-F	GTACGACAGGGGCGTGAATA	PSMC3_R	ATCAGCACCCCTTTTGGAGG
PSMA5-R	GCACACACCCTCTGATGTCT	PSMC4_F	TCTGGAGGCTGTGGATCAGA
PSMB1-F	CCCTTTGCAGCTGCGATTTT	PSMC4_R	AGTGCATTGCTGTGCTTGTG
PSMB1-R	GGGCTATCCCGCGTATGAAT	PSMC5_F	AGAGAAGATGGCGCTTGACG
PSMB2-F	CTCATCGGTATCCAAGGCCC	PSMC5_R	CTCCGGAGGTTTTGGCTCTT
PSMB2-R	GTCTCCAGCCTCTCCAACAC	PSMC6_F	AACACAAGGAGATCGACGGC
PSMB5-F	GCTACCGGTGAACCAGCG	PSMC6_R	CGATCTGCCCAACACTCTGTA
PSMB5-R	CAACTATGACTCCATGGCGGA	PSMD1_F	ATGGGAGGATGGAAGAGGCT
PSMB8-F	GCTCCTGGCTGACTTCTAGT	PSMD1_R	AACATGTAGCAGGCGTCGAA
PSMB8-R	TGAACGTTCCTTTCTCCGTCC	PSMD2_F	CATGACTTCAGTGCCCAAGC
PSMB9-F	GGCGTTGTGATGGGTTCTGA	PSMD2_R	CGGAGATGATGTCAGCAGCA
PSMB9-R	AGAGAGTGCACAGTAGATGCG	PSMD3_F	GCGAATCAAAGCCATCCAGC
PSMB10-F	AGCTACACGCGTTATCTACGG	PSMD3_R	CAGCTCCACCACGATGAGAA

Table-3: The correlation betweenproteasomal subunit mRNA expression and patient survival in liver cancer using The Human Protein Atlas and Kaplan-Meier Analysis.

Gene Name	5-year survival of high expressers (%)	5-year survival of low expressers (%)	p-value^$
PSMA1	36	56	0.000038
PSMA2	32	56	0.00013
PSMA3	37	57	0.002
PSMA5	42	57	0.00023
PSMA6	44	49	0.075
PSMA7	32	59	0.000025
PSMB1	39	51	0.024
PSMB2	31	56	0.00000035
PSMB3	43	59	0.055
PSMB4	39	55	0.00075
PSMB5	31	57	0.000029
PSMB6	43	52	0.27
PSMB7	44	50	0.02
PSMB8	34	55	0.078
PSMB9	40	56	0.057
PSMB10	50	43	0.072
PSMC1	42	53	0.012
PSMC2	41	51	0.021
PSMC5	43	52	0.0083
PSMC6	38	51	0.0031
PSMD1	19	58	8.6E-12
PSMD2	32	53	0.00000066
PSMD3	43	51	0.0057

$ Low-rank p value for Kaplan-Meirer plot showing results from analysis of correlation between mRNA expression level and patient survival.

The authors declare no competing interests.

Download PDF

Version 1

posted

You are reading this latest preprint version

Investigating the Expression and the Activity Patterns of Proteasomal Subunits in Livers with HBV infection and HBV-Derived HCC

Status:

Version 1

Abstract

Background & Aims:

Methods & Results:

Conclusions

Figures

Background & Aims

Methods

Patients and sample collection

Preparation of liver tissue lysates

Proteasome activity

Protein levels of ubiquitin, protein carbonyl and proteasome β1, β2 and β5 subunits

Mouse origin, transplantation and infection

Immunohistochemistry Staining

Cells

Plasmids

RNA Extraction and real time qPCR

Western blotting

Cell surface staining using flow cytometry analysis

Comparative gene expression analysis

Statistical analysis

Results

Higher levels of proteasomal subunit expression in HCC is associated with a poorer survival rate

HBV infection of liver-humanized mouse results in increase in PSMB5 transcript levels

Discussion

Abbreviations

Declarations

References

Tables

Additional Declarations

Status:

Version 1