Background: A major cause of disease-related death in nasopharyngeal carcinoma (NPC) is the development of distant metastasis (DM) despite combination chemo-radiotherapy. We have previously identified and validated a four micro-RNA (miRNA) signature which was prognostic for DM. In this study, characterization of a key component of this signature, miR-34c, revealed its role in chemotherapy resistance. Methods: 246 NPC patient biopsies samples were subject to comprehensive miRNA profiling and immunohistochemistry (IHC). Two human normal nasopharyngeal cell lines (immortalized; NP69 and NP460), as well as the NPC cell line C666-1, were used to generate pre-miR-34c (gain of function) and anti-miR-34c (loss of function) cells. Signaling pathways were assessed using quantitative real-time PCR (qRT-PCR) and Western blot. Cell viability was measured using the ATP lite assay. Results: MiR-34c was downregulated in NPC patient samples, and confirmed in vitro to directly target SOX4, a master regulator of epithelial-to-mesenchymal transition (EMT). MiR-34c downregulation triggered EMT-representative changes in NP69 and NP460; Snail, ZEB1, CDH2, and SOX2 were upregulated, while Claudin-1 and CDH1 were downregulated. Phenotypically, inhibition of miR-34c led to cisplatin resistance, whereas miR-34c over-expression sensitized NPC cells to cisplatin. TGFβ1 decreased miR-34c and increased SOX4 expression in vitro. The TGFβ receptor 1 inhibitor SB431542 reduced SOX4 expression and increased cisplatin sensitivity. Finally, immunohistochemistry revealed that in chemotherapy-treated NPC patients, lower SOX4 expression was associated with improved overall survival. Conclusion: Taken together, miR-34c downregulation correlates with higher incidence of DM; miR-34c also increases SOX4 expression which leads to cisplatin resistance. In association, TGFβ1 represses miR-34c expression, and inhibition of the TGFβ1 pathway is one strategy to restore cisplatin sensitivity in NPC.
Research article
MiR-34c Downregulation Leads to SOX4 Overexpression and Cisplatin Resistance in Nasopharyngeal Carcinoma
https://doi.org/10.21203/rs.2.14313/v1
This work is licensed under a CC BY 4.0 License
Journal Publication
published 26 Jun, 2020
You are reading this older preprint version
Nasopharyngeal carcinoma (NPC) patients presenting with locally advanced disease have a very modest overall survival (OS) rate: approximately 65% after 5 years [1-3]. Despite the use of intensity-modulated radiation therapy for this Epstein-Barr virus (EBV)-associated malignancy, 20-30% of NPC patients will still succumb to distant metastasis (DM) [4]. Therapeutic options for such NPC patients are limited, and a primary clinical challenge is resistance to chemo-radiation [5].Concurrent chemotherapy (cisplatin/5-fluorouracil) with radiation therapy (RT) modestly improve OS, but can cause significant toxicity and death [4, 6-10].
Our group previously completed a global miRNA NPC patient sample profiling, discovering and validating a four-miRNA prognostic signature for DM (low miR-34c, low miR-140, high miR-154, and high miR-449b) [11]. A subsequent study demonstrated that elevated levels of miR-449b was significantly associated with poor OS in patients receiving concurrent chemo-radiotherapy [12]. MiR-449b overexpression in NPC was found to decrease transforming growth factor beta-induced (TGFBI), leading to an increase in transforming growth factor beta 1 (TGFβ1), TGFβ pathway activation, and cisplatin resistance [12].
TGFβ1 is a secreted protein involved in the regulation of many cellular mechanisms, such as metastasis formation, chemo-resistance, epithelial-to-mesenchymal transition (EMT) [13, 14], and more recently, microRNA (miRNA) expression [15, 16]. This latter process occurs via TGFβ1-mediated Smad activation; Smads bind to miRNA promotor regions that contain Smad-binding elements, and also to the Drosha complex [17]. Conversely, numerous miRNAs have been shown to negatively regulate TGFβ pathways [18].
TGFβ1 mediates the overexpression of SOX4, a member of the SOX (SRY-related HMG-box) family of transcription factors, which are known to be involved in developmental pathologies and cancer [19-22]. SOX4 dysregulation is involved in a myriad of cellular phenomena, such as cell cycle, apoptosis, response to chemo-radiation, metastasis development, and EMT [19, 23-27]. It is highly expressed in prostate [28], glioma [29], gastric [30], and breast cancers [27, 31], and its elevated expression in turn has been associated with worse survival in prostate [32], gastric [30, 33], colon [34], and NPC [35]. In several other malignancies though, the opposite has been observed, suggesting context-dependency [36, 37].
Another component of the four miRNA DM signature is miR-34c downregulation [11]. Other groups have corroborated miR-34c down-regulation in NPC [38, 39], as well as in several other cancers [40-43]. MiR-34c is a member of the miR-34 family, which is composed of three pro-apoptotic members: miR-34a, miR-34b, and miR-34c [44]. While extensive research has been conducted on miR-34a [45], identifying its role in chemo-sensitivity [46, 47], prevention of metastasis formation [48-51], and reverting EMT [52, 53], little is known regarding miR-34c.
In this current study, the biological mechanisms, underpinnings, and effects of miR-34c downregulation were investigated. The data suggest that this downregulation is caused by TGFβ1, which leads to SOX4 disinhibition, which in turn, promotes EMT and cisplatin resistance in NPC.
Patient Samples
Approval was obtained from the Princess Margaret Cancer Centre (PMCC) Institutional Research Ethics Board. Diagnostic formalin-fixed paraffin-embedded (FFPE) blocks were obtained from NPC patients treated at the PMCC between 1993 to 2009, as previously described [11]. RNA was isolated using the Recover All Total Nucleic Acid Isolation Kit for FFPE (Ambion, Austin, TX, USA). Total RNA (200 ng) was assayed using the nCounter Human miRNA Assay v1.0 (Nanostring; 734 unique human and viral miRNAs). FFPE blocks from patients who did not have NPC (n=17) were used for normal nasopharyngeal epithelial tissues.
Cell Culture, Transfection, and Infection
The EBV-positive NPC cell line C666-1, the human normal nasopharyngeal cell lines NP69 (SV40-immortalized) and NP460 (hTert-immortalized), and HEK293T cells (used for virus purification and functional analysis), were cultured as previously described [12]. Mycoplasma and STR analyses were also performed [12].
Polyplus-transfection JetPRIME (Graffenstaden, France) was used for C666-1, NP69, NP460, and HEK293T transfections, according to manufacturer’s specifications. C666-1, NP69, and NP460 cells were transfected with pre-miR-34c or pre-miR negative control (20 nM; Ambion, Austin, TX, USA). Lentiviral infection was used to generated stable cell lines as previously described[12]. pLV-miRNA-34c (Biosettia, San Diego, CA, USA), pLV-miR-34c-lockers (Biosettia, San Diego, CA, USA), and their respective control vectors were used.
SB431542 (#S1067, SelleckChem, Houston, TX, USA), a TGFβ receptor I (TGFβR1, also known as ALK5) inhibitor, was used as indicated. Human TGFβ1 (#8915; Cell Signaling, Danvers, MA, USA) was used where indicated, after overnight starvation in Minimum Essential Media (MEM) supplemented with 0.5% FBS.
Quantitative Real-Time PCR (qRT-PCR)
The Total RNA Purification Kit (Norgen Biotek, Thorold, ON, Canada) was used for RNA isolation. Reverse-transcription of total RNA (1 μg) was performed using the iScript cDNA Synthesis Kit (BioRad, Hercules, CA, USA). qRT-PCR utilized SYBR Green (Roche, Basel, Switzerland) and the primers listed in Table 1. mRNA expression was normalized to the average expression of two housekeeping genes (β-actin and GAPDH, as in [12]). MicroRNA levels were assessed using the TaqMan MicroRNA Assay (Applied Biosystem, Foster City, CA, USA). RNU44 and RNU48 were used to normalize miR-34c expression. The 2-ΔΔ Ct method was used to calculate relative expression [54].
Western Blot
Immunoprecipitation buffer (150 mM NaCl, 5 mM EDTA, 50 mM Hepes pH 7.6, 1-2% Nonidet P-40; with protease inhibitor cocktail, Roche), was used for protein extraction. Electrophoresis was performed with a Bolt 4-20% Gel (Life Technologies, Carlsbad, CA, USA).
The Epithelial-Mesenchymal Transition Antibody Sampler Kit (Cell Signaling; #9782; 1/1 000 each), anti-TGFβ1 (Cell Signaling; #3711; 1/1 000), and anti-β-actin (Sigma: 1/5 000) antibodies were used. The SuperSignal West Femto ECL (Pierce, #34095, Thermo Scientific, Waltham, MA, USA) was used for ZEB1, CDH1 and ZO-1 detection. Otherwise, the Pierce ECL (#32209) was used.
RNA-Sequencing (RNA-Seq) and Data Analysis
RNA was isolated (200 ng/sample), processed (Ribo-Zero Gold rRNA Removal Kit (Illumina, San Diego, CA, USA)), and sequenced as previously described [11]. Library preparation was performed using the TruSeq Stranded Total RNA Sample Prep Kit (Illumina, San Diego, CA, USA). Sequencing used the Illumina HiSeq 2000 to >100 million paired-end 100 bp reads. STAR (v2.4.2a) was used to align the reads [55], and RSEM (v1.2.21) was used to summarize expression values [56].
Luciferase Reporter Assay for MiR-34c/SOX4 Target Activity
miR-34c was predicted to target the wild-type (WT) 3’-untranslated region (3’UTR) of SOX4 in silico. This region was inserted into the pMIR-REPORT vector (Ambion). JetPRIME was used to reverse transfect HEK293T cells with pre-miR-control or pre-miR-34c. After one day, JetPRIME was used to co-transfect pRL-SV Renilla vector (Promega, Madison, WI, USA) with either pMIR-SOX4 3’UTR WT (CTAGTGCTCAGCTCAAGTTCACTGCCTGTCAGAT) or pMIR-SOX4 3’UTR Mutant (CTAGTGCTCAGCTCAAGTTTCTGTAAAGTCAGAT). One day later, the Dual-Luciferase Reporter Assay (Promega) was used to measure luciferase activity.
Cell Viability Assays
Cells were seeded in 96-well plates (2,000 cells/well). After one day, they were exposed to increasing concentrations of cisplatin (CDDP) for 72 h as indicated. Then, the ATPlite 1 Step Luminescence Assay System (PerkinElmer, Waltham, MA, USA) was used.
Immunohistochemistry (IHC)
Sections from FFPE blocks were subject to IHC using microwave antigen retrieval. Citric acid (0.01 M, pH 6.0) and the LSAB+ System-HRP (Dako, Les Ulis, France) were used. Rabbit polyclonal anti-SOX4 (PA5-41442, lot#SB2344261A, Invitrogen: 1/40) antibody was used, but omitted for negative control staining. Positive nuclear SOX4 localization was detected by light microscopy. The percentage of positive tumor cells was quantified by evaluating a total of at least 300 tumor cells from the three most densely staining fields (magnification ×400). A final score was calculated as the product of percentage of positive tumor cell and staining intensity (0=negative; 1=weak; 2=moderate; 3=strong) as previously described [57]. All scoring was performed blinded to any knowledge of clinical or pathological parameters. Every section was scored at least twice.
Statistical Analyses
All experiments were performed at least three times. In order to maintain independence between replicates, new frozen batches of cells were used each time. Data are presented as the mean + SEM. GraphPad Prism (GraphPad Software, San Diego, CA, USA) was used for statistical analyses. Inter-group statistical significance was determined using the ANOVA test, with the Bonferroni post-test (if applicable), or the Mann-Whitney U test (socscistatistics.com).
MiR-34c is Downregulated by TGFβ1
In order to investigate the role of miR-34c downregulation in the validated prognostic signature for NPC DM [11], we first confirmed that miR-34c expression was significantly decreased in NPC diagnostic FFPE samples compared to normal NP tissue using RNA-seq (Figure 1A). Next, cell line models were assessed for miR-34c expression, corroborating that the EBV-positive NPC cell line C666-1 exhibited significantly lower levels of miR-34c compared to the two normal (immortalized) nasopharyngeal cell lines NP69 and NP460 (Figure 1B), consistent with the clinical observations.
We had previously demonstrated that miR-449b overexpression, another component of the validated prognostic DM signature [11], led to TGFBI mRNA degradation and subsequent TGFβ1 accumulation [12]. Given that TGFβ1 plays an important role in NPC progression [52, 58-63], and in the regulation of miRNAs, particularly miR-34a, [51], we sought to measure TGFβ1 in these cell lines. Indeed, C666-1 cells (which have low miR-449b [12]) expressed higher levels of active TGFβ1 compared to either NP69 or NP460 cells (both of which have higher miR-449b expression [12]) (Figure 1C). We therefore hypothesized that TGFβ1 could regulate miR-34c in these cells. Treatment with recombinant TGFβ1 significantly reduced miR-34c expression in both NP69 and NP460 cells (Figure 1D and E). Conversely, a TGFβ Receptor 1 (TGFBR1) inhibitor (SB431542) increased miR-34c expression in C666-1 cells (Additional File 1: Figure S1A).
In order to confirm the association between increased miR-449b, increased TGFβ1, and decreased miR34c, NP69 cells stably expressing pre-miR-449b were compared to NP69 cells stably expressing miR-control or anti-miR-34c. NP69-pre-miR-449b cells expressed higher levels of active TGFβ1 protein compared to NP69-miR-control or NP69-anti-miR-34c cells (Figure 1F, top), associated with a correspondingly lower expression of miR-34c compared to NP69-miR-control (Figure 1F, bottom). Taken together, these data support the hypothesis that TGFβ1 decreases miR-34c expression, although the mechanism of regulation remains unknown.
MiR-34c Directly Downregulates SOX4
In order to identify miR-34c target candidates, 17 genes at the intersection between computationally predicted targets and genes upregulated in patient NPC samples [64] were examined (Figure 2A). Using qRT-PCR, 6 of the 17 genes were found to be upregulated in C666-1 (low miR-34c) compared to NP69 and NP460 cells (high miR-34c) (Additional File 1: Figure S1B and C). These genes were then assessed for response to transient miR-34c overexpression (pre-miR-34c transfection) (Figure 2B for the 6 genes; Additional File 2: Figure S2A for the remainder of the 17 genes), and TGFβ pathway inhibition using SB431542 (a TGFBR1 inhibitor, which also upregulates miR-34c) (Figure 2C for the 6 genes; Additional File 2: Figure S2B for the remainder of the 17 genes) in C666-1 cells. As can be seen in Figure 2B and C, elevated miR-34c conditions consistently and significantly downregulated ARID5A, BIK, and SOX4. Interestingly, BAX and PML were consistently and significantly upregulated (Additional File 2: Figure S2A and B), suggesting that they were not direct targets of miR-34c, but possibly further downstream or altered via a more complex mechanism.
Next, the expression of the potential miR-34c targets was determined using qRT-PCR on NP69 and NP460 cells transiently transfected with pre-miR-34c (Additional File 2: Figure S2C and D), as well as on NP69, NP460, and C666-1 cells stably expressing pre-miR-34c and anti-miR-34c (Additional File 2: Figure S2E, F, G, H, I and J). Together, these data show that only SOX4 was both significantly and inversely related to miR-34c in all tested cellular models. SOX4 is potentially important in the tumorigenesis of a number of different cancers (Review in [65]), including NPC [35, 66]. It is also known to be regulated by TGFβ1 [19], although its relationship with miR-34c remains to be investigated. Thus, we proceeded to interrogate the TGFβ pathway, miR-34c, and SOX4.
First, significant pre-miR-34c-mediated direct inhibition of SOX4 expression was confirmed using a luciferase reporter assay (Figure 2D). The data were corroborated in NP69 cells, wherein TGFβ1 treatment significantly increased SOX4 expression, which was abrogated with miR-34c overexpression (Figure 2E). Furthermore, RNA sequencing performed on 53 diagnostic NPC biopsy samples revealed that patients with higher than median SOX4 transcript levels experienced a lower 10-year distant relapse free survival (DRFS) compared to those with lower levels (p=0.063) (Figure 2F). Taken together, these data suggest that elevated TGFβ1 (via miR-449b upregulation (Figure 1F) and consequent TGFBI degradation [12]) leads to the downregulation of miR-34c, which directly upregulates SOX4 overexpression, leading to an inferior 10-year DRFS.
MiR-34c Regulates the SOX2-EMT Axis
SOX4 has been characterized as a master regulator of EMT [25, 27], notably by upregulating SOX2 [19-22], a well-known mediator of tumor initiation and cancer stem cell maintenance [67-69]. We therefore hypothesized that miR-34c could affect EMT via SOX4 and SOX2. First, SOX2 was confirmed to be highly expressed in C666-1 cells (low miR-34c; high SOX4) compared to NP69 and NP460 cells (high miR-34c; low SOX4) (Figure 3A). NP69 cells stably expressing SOX4 had a significant increase in SOX2 expression (Additional File 3: Figure S3A), corroborating previous reports [19-22]. Moreover, downregulation of miR-34c, in both NP69 and NP460 anti-miR-34c stable cell lines, led to the significant upregulation of SOX2 (Figure 3B and C). The overexpression of miR-34c in C666-1 correspondingly decreased SOX2 transcript levels (Additional File 3: Figure S3B).
The expression of well-known EMT markers were then investigated. NP69 anti-miR-34c stable cells overexpressed SNAI1 (Snail), ZEB1, and CDH2, while under-expressing CLDN1 (Claudin-1), ZO-1, and CDH1 (Figure 3D). Similar results were observed in NP460 anti-miR-34c stable cells (Figure 3E), supporting the role of miR-34c downregulation in the promotion of EMT in normal nasopharyngeal cell lines. C666-1 cells were not amenable to this gene expression analysis (ZEB1, CDH2, and CLDN1 are not expressed). However, TGFBR1 inhibition using SB431542 decreased SOX2 transcript expression in C666-1 cells (Figure 3F). Taken together, the data show that high levels of TGFβ1 downregulate miR-34c, which directly leads to SOX4 overexpression and consequent SOX2 upregulation, promoting EMT in nasopharyngeal cells.
TGFBR1 Inhibition Sensitizes C666-1 Cells to Cisplatin
Our group previously demonstrated that miR-449b overexpression was associated with EMT and cisplatin sensitivity in NPC [12]; EMT being a well-described mediator of chemo-resistance [70]. In this current study, miR-34c was found to be downregulated by TGFβ1 (Figure 1), leading to EMT. Consequently, the potential involvement of miR-34c in cisplatin resistance was examined. Downregulation of miR-34c using anti-miR-34c significantly increased resistance to cisplatin in NP69, NP460, and C666-1 stable cell lines (Figure 4A and B, Additional File 3: Figure S3C). Conversely, overexpression of miR-34c using pre-miR-34c increased cisplatin sensitivity in NP69, NP460, and C666-1 stable cell lines (Additional File 3: Figure S3D and E, Figure 4C). Additionally, SB431542 treatment caused cytotoxicity in C666-1 cells in a dose-dependent manner in vitro (Additional File 3: Figure S3F). The combination of SB431542 and cisplatin had an additive effect on the cell death of C666-1 cells (Figure 4D). Finally, IHC performed on NPC biopsy samples from patients treated with chemo-radiation (n=25) demonstrated that lower SOX4 nuclear immunostaining was associated with a superior 10-year OS compared to patients with high SOX4 immunostaining (p= 0.031; Figure 4E, and Additional File 3: Figure S3G). These data all support a role for the TGFβ1-miR34c-SOX4-SOX2 pathway in mediating cisplatin sensitivity in NPC.
In summary, miR-34c acts as a switch controlling EMT and chemo-resistance in NPC. With TGFβ1 stimulation, miR-34c is repressed, directly leading to an increase in SOX4, which consequently upregulates SOX2, causing EMT and cisplatin resistance in NPC (Figure 4F).
This study revealed a novel role of miR-34c in EMT and chemo-resistance in NPC. Downregulation of miR-34c, caused by miR-449b overexpression and consequent TGFβ1 activity, resulted in SOX4 and SOX2 overexpression, which triggered EMT and subsequent cisplatin resistance (Figure 4F). Concordantly, miR-34c overexpression sensitized nasopharyngeal cells to cisplatin; a phenotype corroborated in other cancer types [71-74].
In NPC, miR-34c downregulation has been previously reported by several groups [11, 38, 39], but its mechanism of action has never been determined. This study elucidated a clear signaling pathway and also provides data suggesting a myriad of other miR-34c effects. For example, our data showed that miR-34c overexpression increased a number of well-known pro-apoptotic genes, such as BAX [75] and PML [76]. Other miR-34 family members have been shown to be pro-apoptotic [44], with a liposome containing a miR-34a mimic (MRX34) being developed and evaluated clinically as a therapeutic agent [77]. Interestingly, the inhibition of PML nuclear bodies by the EBV protein EBNA1 has been described to contribute to tumorigenesis in NPC cells [78, 79]. MiR-34c has also been reported to suppress tumorigenesis through MET inhibition [38]. These and other miR-34c relationships remain to be further investigated in NPC.
There has been increasing evidence to support a primary role for TGFβ pathway activation in NPC [12, 52, 58, 60-62]. This current study demonstrated that miR-34c can be downregulated by TGFβ1, and that miR-449b overexpression can cause these effects. Correspondingly, miR-449b upregulation and miR-34c downregulation were components of the four miRNA prognostic signature for DM in NPC [11]. Cellular models mimicking these miRNA dysregulations display mesenchymal features and resistance to cisplatin, which are known contributors to disease recurrence and metastasis [12, 80, 81]. Furthermore, in C666-1 cells, TGFβ pathway inhibition produced a similar gene expression profile to transient miR-34c overexpression (i.e. NOTCH1, TGIF2, BAX, and PML), suggesting a close relationship between TGFβ1 and miR-34c pathways. The relationship between these pathways and chemotherapy should be a potential avenue of investigation for future translational studies.
This study elucidates the novel role of miR-34c in EMT and cisplatin resistance. TGFβ1 negatively regulates miR-34c, which in turn increases the expression of SOX4 and SOX2, triggering EMT and cisplatin resistance (Figure 4F). Correspondingly, miR-34c overexpression and TGFβ pathway inhibition leads to cisplatin sensitivity in NPC, highlighting a potential therapeutic strategy in this complex disease.
3’UTR=3’ untranslated region
CDDP=cisplatin
CDH1=E-cadherin
CDH2=N-cadherin
CLDN1=CLAUDIN-1
DM=distant metastasis
DMEM= Dulbecco Modified Eagle Media
DRFS=distant relapse-free survival
EBV=Epstein-Barr virus
EMT=epithelial-to-mesenchymal transition
FBS=fetal bovine serum
FFPE=formalin-fixed and paraffin-embedded
IHC=immunohistochemistry
MEM=Minimum Essential Media
miRNA=microRNA
NPC=nasopharyngeal carcinoma
OS=overall survival
qRT-PCR= quantitative real-time PCR
RT=radiation therapy
SOX=SRY-related HMG-box
TGFβ1=transforming growth factor beta 1
TGFBI=transforming growth factor beta-induced
WCL= Whole Cell Lysate
WT=wild type
ZEB1=zinc finger E-box binding homeobox 1
Acknowledgment
Not applicable.
Competing Interest
The authors have no conflict of interest to disclose.
Funding
This research was funded by: 1. The Canadian Institutes for Health Research (#PJT – 153289); 2. The Peter and Shelagh Godsoe Chair in Radiation Medicine; 3. The Mariano Elia Chair in Head & Neck Cancer Research; 4. The Campbell Family Institute for Cancer Research; 5. The Ministry of Health and Long-Term Care; and 6. The Princess Margaret Cancer Centre Head & Neck Translational Program, with philanthropic funds from the Wharton Family, Joe’s Team, and Gordon Tozer. Additional funding from the Health & Medical Research Fund (Hong Kong; #04151726) and the Research Grant Council (Hong Kong; C7027-16G).
The funding bodies did not influence the design, collection, analysis, or interpretation of the study. The funding bodies did not influence the writing of the manuscript.
Authors' contributions
P.-A.B. and F.-F.L. designed experiments; P.-A.B., M.T., J.H.L., W.S., and V.P. performed experiments; J.P.B. performed bioinformatic analysis; S.W.T supplied wild-type human normal nasopharyngeal cell lines and data. P.-A.B., M.T., J.H.L., J.P.B., W.S., V.P., K.W.Y., and F.-F.L. analyzed the data; P.-A.B., K.W.Y. and F.-F.L. wrote the manuscript. All authors read and approved the manuscript.
Ethics approval and consent to participate
This study was approved by the Institutional Research Ethics Board at the Princess Margaret Cancer Centre.
Availability of data and materials
The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.
Consent for publication
Not applicable.
- Raab-Traub N: Epstein-Barr virus and nasopharyngeal carcinoma. Semin Cancer Biol 1992, 3(5):297-307.
- Raab-Traub N: Epstein-Barr virus in the pathogenesis of NPC. Semin Cancer Biol 2002, 12(6):431-441.
- Lee AW, Tung SY, Chan AT, Chappell R, Fu YT, Lu TX, Tan T, Chua DT, O'Sullivan B, Tung R et al: A randomized trial on addition of concurrent-adjuvant chemotherapy and/or accelerated fractionation for locally-advanced nasopharyngeal carcinoma. Radiother Oncol 2011, 98(1):15-22.
- Lee AW, Tung SY, Ngan RK, Chappell R, Chua DT, Lu TX, Siu L, Tan T, Chan LK, Ng WT et al: Factors contributing to the efficacy of concurrent-adjuvant chemotherapy for locoregionally advanced nasopharyngeal carcinoma: combined analyses of NPC-9901 and NPC-9902 Trials. Eur J Cancer 2011, 47(5):656-666.
- Lee AW, Ma BB, Ng WT, Chan AT: Management of Nasopharyngeal Carcinoma: Current Practice and Future Perspective. J Clin Oncol 2015, 33(29):3356-3364.
- Blanchard P, Lee A, Marguet S, Leclercq J, Ng WT, Ma J, Chan AT, Huang PY, Benhamou E, Zhu G et al: Chemotherapy and radiotherapy in nasopharyngeal carcinoma: an update of the MAC-NPC meta-analysis. Lancet Oncol 2015, 16(6):645-655.
- Lee AW, Tung SY, Chua DT, Ngan RK, Chappell R, Tung R, Siu L, Ng WT, Sze WK, Au GK et al: Randomized trial of radiotherapy plus concurrent-adjuvant chemotherapy vs radiotherapy alone for regionally advanced nasopharyngeal carcinoma. J Natl Cancer Inst 2010, 102(15):1188-1198.
- Frikha M, Auperin A, Tao Y, Elloumi F, Toumi N, Blanchard P, Lang P, Sun S, Racadot S, Thariat J et al: A randomized trial of induction docetaxel-cisplatin-5FU followed by concomitant cisplatin-RT versus concomitant cisplatin-RT in nasopharyngeal carcinoma (GORTEC 2006-02). Ann Oncol 2018, 29(3):731-736.
- Lee AW, Ng WT, Chan YH, Sze H, Chan C, Lam TH: The battle against nasopharyngeal cancer. Radiother Oncol 2012, 104(3):272-278.
- Lee AW, Ng WT, Chan LL, Hung WM, Chan CC, Sze HC, Chan OS, Chang AT, Yeung RM: Evolution of treatment for nasopharyngeal cancer--success and setback in the intensity-modulated radiotherapy era. Radiother Oncol 2014, 110(3):377-384.
- Bruce JP, Hui AB, Shi W, Perez-Ordonez B, Weinreb I, Xu W, Haibe-Kains B, Waggott DM, Boutros PC, O'Sullivan B et al: Identification of a microRNA signature associated with risk of distant metastasis in nasopharyngeal carcinoma. Oncotarget 2015, 6(6):4537-4550.
- Bissey PA, Law JH, Bruce JP, Shi W, Renoult A, Chua MLK, Yip KW, Liu FF: Dysregulation of the MiR-449b target TGFBI alters the TGFβ pathway to induce cisplatin resistance in nasopharyngeal carcinoma. Oncogenesis 2018, 7(5):40.
- Massagué J, Xi Q: TGF-β control of stem cell differentiation genes. FEBS Lett 2012, 586(14):1953-1958.
- Oshimori N, Oristian D, Fuchs E: TGF-β promotes heterogeneity and drug resistance in squamous cell carcinoma. Cell 2015, 160(5):963-976.
- Guo L, Zhang Y, Zhang L, Huang F, Li J, Wang S: MicroRNAs, TGF-β signaling, and the inflammatory microenvironment in cancer. Tumour Biol 2016, 37(1):115-125.
- Chen W, Zhou S, Mao L, Zhang H, Sun D, Zhang J, Li J, Tang JH: Crosstalk between TGF-β signaling and miRNAs in breast cancer metastasis. Tumour Biol 2016, 37(8):10011-10019.
- Hata A, Davis BN: Control of microRNA biogenesis by TGFbeta signaling pathway-A novel role of Smads in the nucleus. Cytokine Growth Factor Rev 2009, 20(5-6):517-521.
- Suzuki HI: MicroRNA Control of TGF-β Signaling. Int J Mol Sci 2018, 19(7).
- Ikushima H, Todo T, Ino Y, Takahashi M, Miyazawa K, Miyazono K: Autocrine TGF-beta signaling maintains tumorigenicity of glioma-initiating cells through Sry-related HMG-box factors. Cell Stem Cell 2009, 5(5):504-514.
- Ikushima H, Todo T, Ino Y, Takahashi M, Saito N, Miyazawa K, Miyazono K: Glioma-initiating cells retain their tumorigenicity through integration of the Sox axis and Oct4 protein. J Biol Chem 2011, 286(48):41434-41441.
- Weina K, Wu H, Knappe N, Orouji E, Novak D, Bernhardt M, Hüser L, Larribère L, Umansky V, Gebhardt C et al: TGF-β induces SOX2 expression in a time-dependent manner in human melanoma cells. Pigment Cell Melanoma Res 2016, 29(4):453-458.
- Liu Z, Kuang W, Zhou Q, Zhang Y: TGF-β1 secreted by M2 phenotype macrophages enhances the stemness and migration of glioma cells via the SMAD2/3 signalling pathway. Int J Mol Med 2018, 42(6):3395-3403.
- Bilir B, Osunkoya AO, Wiles WG, Sannigrahi S, Lefebvre V, Metzger D, Spyropoulos DD, Martin WD, Moreno CS: SOX4 Is Essential for Prostate Tumorigenesis Initiated by PTEN Ablation. Cancer Res 2016, 76(5):1112-1121.
- Sun R, Jiang B, Qi H, Zhang X, Yang J, Duan J, Li Y, Li G: SOX4 contributes to the progression of cervical cancer and the resistance to the chemotherapeutic drug through ABCG2. Cell Death Dis 2015, 6:e1990.
- Tiwari N, Tiwari VK, Waldmeier L, Balwierz PJ, Arnold P, Pachkov M, Meyer-Schaller N, Schübeler D, van Nimwegen E, Christofori G: Sox4 is a master regulator of epithelial-mesenchymal transition by controlling Ezh2 expression and epigenetic reprogramming. Cancer Cell 2013, 23(6):768-783.
- Yoon TM, Kim SA, Cho WS, Lee DH, Lee JK, Park YL, Lee KH, Lee JH, Kweon SS, Chung IJ et al: SOX4 expression is associated with treatment failure and chemoradioresistance in oral squamous cell carcinoma. BMC Cancer 2015, 15:888.
- Zhang J, Liang Q, Lei Y, Yao M, Li L, Gao X, Feng J, Zhang Y, Gao H, Liu DX et al: SOX4 induces epithelial-mesenchymal transition and contributes to breast cancer progression. Cancer Res 2012, 72(17):4597-4608.
- Liu P, Ramachandran S, Ali Seyed M, Scharer CD, Laycock N, Dalton WB, Williams H, Karanam S, Datta MW, Jaye DL et al: Sex-determining region Y box 4 is a transforming oncogene in human prostate cancer cells. Cancer Res 2006, 66(8):4011-4019.
- Han W, Hu P, Wu F, Wang S, Hu Y, Li S, Jiang T, Qiang B, Peng X: FHL3 links cell growth and self-renewal by modulating SOX4 in glioma. Cell Death Differ 2018.
- Yuan X, Wang S, Liu M, Lu Z, Zhan Y, Wang W, Xu AM: Histological and Pathological Assessment of miR-204 and SOX4 Levels in Gastric Cancer Patients. Biomed Res Int 2017, 2017:6894675.
- Mehta GA, Parker JS, Silva GO, Hoadley KA, Perou CM, Gatza ML: Amplification of SOX4 promotes PI3K/Akt signaling in human breast cancer. Breast Cancer Res Treat 2017, 162(3):439-450.
- Wang L, Zhang J, Yang X, Chang YW, Qi M, Zhou Z, Han B: SOX4 is associated with poor prognosis in prostate cancer and promotes epithelial-mesenchymal transition in vitro. Prostate Cancer Prostatic Dis 2013, 16(4):301-307.
- Fang CL, Hseu YC, Lin YF, Hung ST, Tai C, Uen YH, Lin KY: Clinical and prognostic association of transcription factor SOX4 in gastric cancer. PLoS One 2012, 7(12):e52804.
- Lin CM, Fang CL, Hseu YC, Chen CL, Wang JW, Hsu SL, Tu MD, Hung ST, Tai C, Uen YH et al: Clinical and Prognostic Implications of Transcription Factor SOX4 in Patients with Colon Cancer. PLoS One 2013, 8(6):e67128.
- Shi S, Cao X, Gu M, You B, Shan Y, You Y: Upregulated Expression of SOX4 Is Associated with Tumor Growth and Metastasis in Nasopharyngeal Carcinoma. Dis Markers 2015, 2015:658141.
- Vervoort SJ, van Boxtel R, Coffer PJ: The role of SRY-related HMG box transcription factor 4 (SOX4) in tumorigenesis and metastasis: friend or foe? Oncogene 2013, 32(29):3397-3409.
- Vervoort SJ, de Jong OG, Roukens MG, Frederiks CL, Vermeulen JF, Lourenço AR, Bella L, Vidakovic AT, Sandoval JL, Moelans C et al: Global transcriptional analysis identifies a novel role for SOX4 in tumor-induced angiogenesis. Elife 2018, 7.
- Li YQ, Ren XY, He QM, Xu YF, Tang XR, Sun Y, Zeng MS, Kang TB, Liu N, Ma J: MiR-34c suppresses tumor growth and metastasis in nasopharyngeal carcinoma by targeting MET. Cell Death Dis 2015, 6:e1618.
- Wang F, Lu J, Peng X, Wang J, Liu X, Chen X, Jiang Y, Li X, Zhang B: Integrated analysis of microRNA regulatory network in nasopharyngeal carcinoma with deep sequencing. J Exp Clin Cancer Res 2016, 35:17.
- Hagman Z, Larne O, Edsjö A, Bjartell A, Ehrnström RA, Ulmert D, Lilja H, Ceder Y: miR-34c is downregulated in prostate cancer and exerts tumor suppressive functions. Int J Cancer 2010, 127(12):2768-2776.
- Sousa LO, Sobral LM, Matsumoto CS, Saggioro FP, López RV, Panepucci RA, Curti C, Silva WA, Greene LJ, Leopoldino AM: Lymph node or perineural invasion is associated with low miR-15a, miR-34c and miR-199b levels in head and neck squamous cell carcinoma. BBA Clin 2016, 6:159-164.
- Wang Z, Chen Z, Gao Y, Li N, Li B, Tan F, Tan X, Lu N, Sun Y, Sun J et al: DNA hypermethylation of microRNA-34b/c has prognostic value for stage Ⅰ non-small cell lung cancer. Cancer Biol Ther 2011, 11(5):490-496.
- Yang DQ, Zhou JD, Wang YX, Deng ZQ, Yang J, Yao DM, Qian Z, Yang L, Lin J, Qian J: Low miR-34c expression is associated with poor outcome in de novo acute myeloid leukemia. Int J Lab Hematol 2017, 39(1):42-50.
- Misso G, Di Martino MT, De Rosa G, Farooqi AA, Lombardi A, Campani V, Zarone MR, Gullà A, Tagliaferri P, Tassone P et al: Mir-34: a new weapon against cancer? Mol Ther Nucleic Acids 2014, 3:e194.
- Lacombe J, Zenhausern F: Emergence of miR-34a in radiation therapy. Crit Rev Oncol Hematol 2017, 109:69-78.
- Wen D, Peng Y, Lin F, Singh RK, Mahato RI: Micellar Delivery of miR-34a Modulator Rubone and Paclitaxel in Resistant Prostate Cancer. Cancer Res 2017, 77(12):3244-3254.
- Zhang Q, Zhuang J, Deng Y, Yang L, Cao W, Chen W, Lin T, Lv X, Yu H, Xue Y et al: miR34a/GOLPH3 Axis abrogates Urothelial Bladder Cancer Chemoresistance via Reduced Cancer Stemness. Theranostics 2017, 7(19):4777-4790.
- Adams BD, Wali VB, Cheng CJ, Inukai S, Booth CJ, Agarwal S, Rimm DL, Győrffy B, Santarpia L, Pusztai L et al: miR-34a Silences c-SRC to Attenuate Tumor Growth in Triple-Negative Breast Cancer. Cancer Res 2016, 76(4):927-939.
- Bayraktar R, Ivan C, Bayraktar E, Kanlikilicer P, Kabil NN, Kahraman N, Mokhlis HA, Karakas D, Rodriguez-Aguayo C, Arslan A et al: Dual Suppressive Effect of miR-34a on the FOXM1/eEF2-Kinase Axis Regulates Triple-Negative Breast Cancer Growth and Invasion. Clin Cancer Res 2018, 24(17):4225-4241.
- Liu C, Kelnar K, Liu B, Chen X, Calhoun-Davis T, Li H, Patrawala L, Yan H, Jeter C, Honorio S et al: The microRNA miR-34a inhibits prostate cancer stem cells and metastasis by directly repressing CD44. Nat Med 2011, 17(2):211-215.
- Yang P, Li QJ, Feng Y, Zhang Y, Markowitz GJ, Ning S, Deng Y, Zhao J, Jiang S, Yuan Y et al: TGF-β-miR-34a-CCL22 signaling-induced Treg cell recruitment promotes venous metastases of HBV-positive hepatocellular carcinoma. Cancer Cell 2012, 22(3):291-303.
- Huang G, Du MY, Zhu H, Zhang N, Lu ZW, Qian LX, Zhang W, Tian X, He X, Yin L: MiRNA-34a reversed TGF-β-induced epithelial-mesenchymal transition via suppression of SMAD4 in NPC cells. Biomed Pharmacother 2018, 106:217-224.
- Lin X, Lin BW, Chen XL, Zhang BL, Xiao XJ, Shi JS, Lin JD, Chen X: PAI-1/PIAS3/Stat3/miR-34a forms a positive feedback loop to promote EMT-mediated metastasis through Stat3 signaling in Non-small cell lung cancer. Biochem Biophys Res Commun 2017, 493(4):1464-1470.
- Livak KJ, Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25(4):402-408.
- Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, Batut P, Chaisson M, Gingeras TR: STAR: ultrafast universal RNA-seq aligner. Bioinformatics 2013, 29(1):15-21.
- Li B, Dewey CN: RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinformatics 2011, 12:323.
- Shi W, Pataki I, MacMillan C, Pintilie M, Payne D, O'Sullivan B, Cummings BJ, Warde P, Liu FF: Molecular pathology parameters in human nasopharyngeal carcinoma. Cancer 2002, 94(7):1997-2006.
- Cao S, Cui Y, Xiao H, Mai M, Wang C, Xie S, Yang J, Wu S, Li J, Song L et al: Upregulation of flotillin-1 promotes invasion and metastasis by activating TGF-β signaling in nasopharyngeal carcinoma. Oncotarget 2016, 7(4):4252-4264.
- Tan EL, Selvaratnam G, Kananathan R, Sam CK: Quantification of Epstein-Barr virus DNA load, interleukin-6, interleukin-10, transforming growth factor-beta1 and stem cell factor in plasma of patients with nasopharyngeal carcinoma. BMC Cancer 2006, 6:227.
- Velapasamy S, Dawson CW, Young LS, Paterson IC, Yap LF: The Dynamic Roles of TGF-β Signalling in EBV-Associated Cancers. Cancers (Basel) 2018, 10(8).
- Xu J, Menezes J, Prasad U, Ahmad A: Elevated serum levels of transforming growth factor beta1 in Epstein-Barr virus-associated nasopharyngeal carcinoma patients. Int J Cancer 1999, 84(4):396-399.
- Zhao L, Lin L, Pan C, Shi M, Liao Y, Bin J, Liao W: Flotillin-2 promotes nasopharyngeal carcinoma metastasis and is necessary for the epithelial-mesenchymal transition induced by transforming growth factor-β. Oncotarget 2015, 6(12):9781-9793.
- Zou G, Ren B, Liu Y, Fu Y, Chen P, Li X, Luo S, He J, Gao G, Zeng Z et al: Inhibin B suppresses anoikis resistance and migration through the transforming growth factor-β signaling pathway in nasopharyngeal carcinoma. Cancer Sci 2018, 109(11):3416-3427.
- Shi W, Bastianutto C, Li A, Perez-Ordonez B, Ng R, Chow KY, Zhang W, Jurisica I, Lo KW, Bayley A et al: Multiple dysregulated pathways in nasopharyngeal carcinoma revealed by gene expression profiling. Int J Cancer 2006, 119(10):2467-2475.
- Chen J, Ju HL, Yuan XY, Wang TJ, Lai BQ: SOX4 is a potential prognostic factor in human cancers: a systematic review and meta-analysis. Clin Transl Oncol 2016, 18(1):65-72.
- Jiang C, Wang H, Zhou L, Jiang T, Xu Y, Xia L: MicroRNA-212 inhibits the metastasis of nasopharyngeal carcinoma by targeting SOX4. Oncol Rep 2017, 38(1):82-88.
- Boumahdi S, Driessens G, Lapouge G, Rorive S, Nassar D, Le Mercier M, Delatte B, Caauwe A, Lenglez S, Nkusi E et al: SOX2 controls tumour initiation and cancer stem-cell functions in squamous-cell carcinoma. Nature 2014, 511(7508):246-250.
- Favaro R, Appolloni I, Pellegatta S, Sanga AB, Pagella P, Gambini E, Pisati F, Ottolenghi S, Foti M, Finocchiaro G et al: Sox2 is required to maintain cancer stem cells in a mouse model of high-grade oligodendroglioma. Cancer Res 2014, 74(6):1833-1844.
- Kim BR, Coyaud E, Laurent EMN, St-Germain J, Van de Laar E, Tsao MS, Raught B, Moghal N: Identification of the SOX2 Interactome by BioID Reveals EP300 as a Mediator of SOX2-dependent Squamous Differentiation and Lung Squamous Cell Carcinoma Growth. Mol Cell Proteomics 2017, 16(10):1864-1888.
- Singh A, Settleman J: EMT, cancer stem cells and drug resistance: an emerging axis of evil in the war on cancer. Oncogene 2010, 29(34):4741-4751.
- Hu Y, Yang Q, Wang L, Wang S, Sun F, Xu D, Jiang J: Knockdown of the oncogene lncRNA NEAT1 restores the availability of miR-34c and improves the sensitivity to cisplatin in osteosarcoma. Biosci Rep 2018, 38(3):BSR20180375.
- Xiao S, Li Y, Pan Q, Ye M, He S, Tian Q, Xue M: MiR-34c/SOX9 axis regulates the chemoresistance of ovarian cancer cell to cisplatin-based chemotherapy. J Cell Biochem 2018.
- Tung SL, Huang WC, Hsu FC, Yang ZP, Jang TH, Chang JW, Chuang CM, Lai CR, Wang LH: miRNA-34c-5p inhibits amphiregulin-induced ovarian cancer stemness and drug resistance via downregulation of the AREG-EGFR-ERK pathway. Oncogenesis 2017, 6(5):e326.
- Wu H, Huang M, Lu M, Zhu W, Shu Y, Cao P, Liu P: Regulation of microtubule-associated protein tau (MAPT) by miR-34c-5p determines the chemosensitivity of gastric cancer to paclitaxel. Cancer Chemother Pharmacol 2013, 71(5):1159-1171.
- Korsmeyer SJ, Wei MC, Saito M, Weiler S, Oh KJ, Schlesinger PH: Pro-apoptotic cascade activates BID, which oligomerizes BAK or BAX into pores that result in the release of cytochrome c. Cell Death Differ 2000, 7(12):1166-1173.
- Pinton P, Giorgi C, Pandolfi PP: The role of PML in the control of apoptotic cell fate: a new key player at ER-mitochondria sites. Cell Death Differ 2011, 18(9):1450-1456.
- Beg MS, Brenner AJ, Sachdev J, Borad M, Kang YK, Stoudemire J, Smith S, Bader AG, Kim S, Hong DS: Phase I study of MRX34, a liposomal miR-34a mimic, administered twice weekly in patients with advanced solid tumors. Invest New Drugs 2017, 35(2):180-188.
- Sivachandran N, Sarkari F, Frappier L: Epstein-Barr nuclear antigen 1 contributes to nasopharyngeal carcinoma through disruption of PML nuclear bodies. PLoS Pathog 2008, 4(10):e1000170.
- Sivachandran N, Cao JY, Frappier L: Epstein-Barr virus nuclear antigen 1 Hijacks the host kinase CK2 to disrupt PML nuclear bodies. J Virol 2010, 84(21):11113-11123.
- Ghosh RD, Ghuwalewala S, Das P, Mandloi S, Alam SK, Chakraborty J, Sarkar S, Chakrabarti S, Panda CK, Roychoudhury S: MicroRNA profiling of cisplatin-resistant oral squamous cell carcinoma cell lines enriched with cancer-stem-cell-like and epithelial-mesenchymal transition-type features. Sci Rep 2016, 6:23932.
- Yang CX, Sedhom W, Song J, Lu SL: The Role of MicroRNAs in Recurrence and Metastasis of Head and Neck Squamous Cell Carcinoma. Cancers (Basel) 2019, 11(3):385.
