Animal maintenance
All experimental procedures were approved by the Animal Ethics Committee of Jinan University. Immature female wild-type C57BL/6J mice (n = 60, four weeks old, 13 ± 1 g) were purchased from the Centre for Experimental Animals (Shandong, China). The animals were group-housed under standard laboratory conditions (room temperature: 22.5 ± 2.5 °C; relative humidity: 45.0 ± 2.0%; 12 h light/dark cycle with lights on at 8:00 am). Tap water and food pellets were provided ad libitum. The mice were kept for one week to acclimatize to the conditions and weighed daily during adaptive feeding and modeling.
Female mice were initially divided into (PCOS) model (n = 45) and control groups (n = 15). For modeling, the model group were given a high-fat diet (HFD: 60% fat content, China) [30] and subcutaneously injected with 0.6 mg/kg/day dehydroepiandrosterone (DHEA: Coolober Technology Co., Ltd., Beijing, China) [31] dissolved in 0.2 mL soy oil for 21 consecutive days. The control group were given a standard diet (SD:12 mm; Breeding Food, China) and subcutaneously injected with the same dose of 0.9% sodium chloride. After modeling, three mice in each group were randomly selected to verify successful modeling by the trends of body weight, serum testosterone level, and ovarian tissue section.
Exogenous APN treatment in early pregnancy
After successful modeling, the model group (n = 39, three mice dead, three mice sacrificed) were randomly divided into two groups: maternal-PCOS group (n = 20; 0.9% sodium chloride, s.c.) and maternal-PCOS+APN group (n = 19; APN, 10 mg/kg/day, s.c.) [32]. The control group was recorded as maternal-control group (n = 10, two mice dead, three mice sacrificed; 0.9% sodium chloride, s.c.). Female mice received 10 IU pregnant mare serum gonadotropin (PMSG: ProSpec, Inc., Israel) and were injected with 10 IU human chorionic gonadotropin (HCG: LIVZON, Inc., China) 48 h later. Females of the different groups were randomly mated with untreated C57BL/6J wild-type males (8 weeks old, 25 ± 2 g). Mice with vaginal plug were recorded at day 0 of pregnancy.
Adiponectin (APN: gAcrp30, murine recombinant, BioVision, USA) was dissolved in Tris solution (1 mL, 5 mM, pH 7.6), and this stock solution was used to prepare an APN solution with a concentration of 0.1 mg/mL. APN injection with this solution began on day three after pregnancy, and treatment of the maternal-PCOS+APN group was continued for 11 days. After completion of the injection, three female mice in each group were randomly selected to obtain blood samples for the detection of the levels of serum androgen and adiponectin.
The pregnancy rate was quantified per treatment and pairing throughout the observation process. Pregnant mice were assigned to the corresponding groups at the time of weaning (Figure 1). The standard diet was given to all mice during breeding, lactation, and growth of the young stock. The nutritional profile of the standard diet was the following: protein 20%, fat 4%, fiber 5%, ash 8%, moisture 10%, nitrogen-free extract 50%; calories: 3.78 kcal/g.
Figure 1. Schematic representation of the different experimental groups: offspring-control group (n = 6; maternal-control group offspring, SD); offspring-PCOS group (n = 6; maternal-PCOS group offspring, SD); offspring-PCOS+APN group (n = 6; maternal-PCOS+APN group offspring, SD).
Phenotypic indices and vaginal cytology
Bodyweight (BW) and food intake of offspring mice were monitored daily from weaning (3 weeks old) to slaughter (13 weeks old). In adulthood (8 weeks old), vaginal smears were performed daily for 20 consecutive days (4–5 cycles) [33]. The estrous cycle of offspring mice was monitored by vaginal smears and assessed by optical microscopy.
I.p. glucose tolerance test (IPGTT) and i.p. insulin tolerance test (IPITT)
IPGTTs were performed of non-fasted offspring mice (8 weeks old), and their food was removed 16 h before the experiment. One week after IPGTT, IPITTs were performed of mice that were fasted for 6 h. Tests were performed by i.p. injecting mice with either glucose or insulin, as previously described (IPGTT: 10% glucose, 0.5 g/kg BW; IPITT: insulin 2 U/kg BW). The blood glucose concentration of tail vein blood was measured with a glucose monitoring kit (Johnson, USA) at 0, 15, 30, 60, 90, and 120 min after glucose or insulin injection.
Tissue and blood sample collection
At the end of the experiment, all offspring mice (13 weeks old) were anesthetized, blood samples were obtained by eyeball enucleation, and food was removed overnight for a maximum of 8 h (water was unlimited) before slaughter. The serum was immediately separated and stored at –20 °C for subsequent analyses. After collection of blood samples, the bilateral ovaries of the mice were rapidly removed, and some of the fresh ovarian tissue samples were rapidly frozen at –80 ℃ for biochemical analysis. The other part of the ovaries were fixed in 4% paraformaldehyde solution. After embedding in paraffin, the ovaries were cut into 5-μm thick sections and stained with hematoxylin-eosin (H&E), and the tissue structure was observed by electron microscopy.
Biochemical analyses and serum hormone measurements
Fasting blood glucose (FBG), total cholesterol (TC), triglycerides (TG), HDL cholesterol (HDL-C), and LDL cholesterol (LDL-C) levels in the serum were measured using an autoanalyzer (BS-5800M, Mindray, China). The homeostasis model assessment-insulin resistance (HOMA-IR) index was calculated as previously described [34]. Serum insulin (INS), adiponectin (APN), and testosterone (T) concentrations were measured using an ELISA kit (CUSABIO, Wuhan, China) according to the manufacturer’s instructions.
RNA extraction and real-time PCR
Total RNA was extracted from the ovarian tissue of offspring mice with the TRIzol reagent (Invitrogen) to synthesize first-strand cDNAs by using the EasyScript TM First-strand cDNA Synthesis SuperMix (TransGen Biotech, China). Quantitative real‐time PCR (qRT‐PCR) was performed to determine the total cDNA with a 7500 real‐time PCR system (Applied Biosystems, USA). The qRT‐PCR was performed using a ImProm-IITM Reverse Transcription System (Promega, USA). Specific primers for amplification of specific genes were purchased from Sangon Biotech (Shanghai, China), as listed in Table 1. Expression levels were determined by the 2‐ΔΔCt method, normalized to GAPDH, and indicated as the ratio with respect to the control.
RT‐PCR primer sequences
Primer name
|
Nucleotide sequence (5′‐3′)
|
AKT- forward
|
CAAGGCCCAACACCTTTATC
|
AKT- reverse
|
ACGATGACCTCCTTCTTGAG
|
AMPK- forward
|
TGTAGAGCAATCAAGCAGTT
|
AMPK- reverse
|
TCCTTTGGCAAGATCGATAG
|
PI3K- forward
|
GGGCAGTTAAGAAGCACAATG
|
PI3K- reverse
|
GCAGGAGAGTCTTTCCAATG
|
GAPDH- forward
|
GGCCTCCAAGGAGTAAGAAA
|
GAPDH- reverse
|
GCCCCTCCTGTTATTATGG
|
Western blotting
Protein was extracted from ovarian tissue of offspring mice. Total protein concentrations were measured using a BCA protein assay kit (Solarbio, China). Equal amounts of proteins (15 μg) were resolved by SDS‐PAGE and then electrophoretically transferred to PVDF membranes. Subsequently, the membrane was blocked with 5% BSA (Solarbio, China) for 2 h and probed with different primary antibodies at 4 °C overnight. The main primary antibodies were phospho-AMPKα (Thr172; CST, USA), phospho-PI3 kinase p85(Tyr458)/p55(Tyr199) antibody (CST, USA), phospho-Akt (Ser473) antibody (CST, USA), phospho-Fox03a (Ser253) antibody (CST, USA), caspase-3 antibody (CST, USA), and Fox03a antibody (Abcam, UK). After thoroughly washing three times with TBST for 5 min each time, HRP‐linked secondary antibody (CST, USA) was used to detect the primary antibodies, followed by an additional 1-h incubation at room temperature. At last, bands were visualized using an Amersham Imager 600 (GE, USA), and band intensities were analyzed using the computer Image J 6.0 software (National Institutes of Health, USA).
Statistical analyses
All data were expressed as the mean ± SD and analyzed using the GraphPad Prism 8.0 (GraphPad Software, Inc., USA) and SPSS 25.0 (SPSS, Inc., Chicago, IL, USA). The Wilcoxon rank-sum test was used to compare two independent samples of the original data, and the Kruskal-Wallis test was used for non-normally distributed data. Multiple-group comparisons were evaluated by one-way ANOVA with post-hoc testing. Tests were performed within the 95% confidence interval, and the significance level was set at p < 0.05.