Bacteria collection and degumming of kenaf bast
Humus samples (50g) were collected from Sanya, China. Water samples (100 ml) were collected from a conventional retting pond (50 cm away from the water surface) in Xiaoshan, Zhejiang, China. Soil samples (50g) were collected from continuous cropping soil of Kenaf in Xiaoshan. Soil and humus samples were diluted into 100 ml bacteria free water (autoclave at 121℃ for 20 minutes), filtered and then mixed with the above water samples.
Kenaf bast was collected from Xianghongma No. 1 plants in Changsha, China. The samples were cut into pieces (3 cm) and then immersed into bacteria mixture (10 g : 5 ml) with supplementation of 100 ml bacteria free water. For the degumming of kenaf bast, samples were maintained on an orbital shaker at 30ºC, pH7.0, for 30 min. Then the fermentation liquid samples were collected at 0, 40, 110, 150 and 190 h post degumming and used for further analysis. Each experiment was done in triplicates.
Determination of kenaf bast weight loss rate and viable count of bacteria
The weight loss rate of the kenaf bast samples in each condition was calculated according to the following formula: weight loss rate (%) = [initial weight (10 g)-final weight (g) of kenaf bast]/initial weight (10 g) of kenaf bast ×100%. Total viable count was quantified traditionally using the colony-forming units (CFUs) after incubation on nutrient broth solid media (pH7.0) for 0-190 h.
DNA extraction and 16S and 18S ribosomal RNA gene sequencing
DNA extraction was performed using a PowerSoil™ DNA Isolation Kit (MOBIO laboratories, San Diego, Carlsbad, California, USA). The concentration and purity of the DNA was measured by agarose gel electrophoresis. The 16S ribosomal DNA (rDNA) gene V3-V4 region of the bacteria was amplified by PCR with bar coded primers (343F: 5'- TACGGRAGGCAGCAG -3' and 798R: 5'- AGGGTATCTAATCCT-3'), using FastPfu Polymerase (TransStart, Beijing, China). The PCR primers for the 18S rDNA of fungus were NS1: 5'- GTAGTCATATGCTTGTCTC -3' and NS8: 5'- TCCGCAGGTTCACCTACGGA -3'. Reaction parameters were: 95ºC for 5 min, followed by 30 cycles of 95ºC 30 s, 52ºC 45 s (16S) or 1 min (18S), 72ºC 1 min, and the final step of 72ºC for 10 min. The amplicons of 16S and 18S rDNA were purified by an AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, California, USA). After repeating the above steps (amplification and purification), the concentration of final purified amplicons was detected by Qubit 2.0 (Thermo Fisher Scientific, Walthan, Massachusetts, USA). At the end, the samples were pooled and subjected to an Illumina MiSeq Instrument (Illumina, San Diego, California, USA) with 350 bp paired-end sequencing.
Data processing
Raw data from different samples were identified based on the unique barcode. The primer sequences were removed and data were trimmed using U-Search software [31]. FLASH v1.2.7 software (http://ccb.jhu.edu/software/FLASH) was used for merging paired-end reads and the counting of reads [32]. The chimeric sequences were removed using UCHIME (http://www.drive5.com/usearch/index.html) [33]. Sequences were clustered into OTUs by QIIME (v1.8.0, http://qiime.org/) [34] according to the minimal 97% similarity. Through matching to the Silva database (https://www.arb-silva.de/) [35], the taxonomic information for each OTU was obtained. Alpha and beta diversities were analyzed to determine differences among groups in terms of species complexity by QIIME (v1.8.0) software.
Protein extraction, digestion, and iTRAQ labeling
Fermentation liquid samples (30 ml) were collected at 0h, 40h, 110h and 150h, and then centrifuged at 1500 g for 10 min in an Eppendorf centrifuge (Eppendorf, San Diego, California, USA). The supernatants were collected and filtered through a 0.22 μm membrane. Samples were then diluted into precooled TCA/acetone (1:9) solutions (1: 4 v/v) and then stored at -20℃ overnight. Pellets were collected by centrifugation (Sigma Aldrich, Schnelldorf, Germany) at 17000g for 30min, followed by washing with precooled acetone (90%) for three times. The precipitate was air-dried and then dissolved in sodium dodecyl sulfonate lysate supplementing (Beyotime, Shanghai, China) with protease inhibitor cocktail (P8340, Sigma, USA) on a homogenizer (Hai Shu Ke Sheng, Ningbo, Zhejiang, China). The crude precipitates were collected by centrifugation at 12000g for 10min at 4℃ (Sigma Aldrich, Schnelldorf, Germany). The supernatant was selected after sonication by centrifugation (12000g for 15min) for twice. Finally, the supernatant was stored at -80℃ for further use. The concentration of protein was measured using BCA method [37], with BCA Protein Assay Kit (Thermo Scientific Dionex, San Jose, USA ). The integrity of the extracted protein was detected by SDS-PAGE [38].
The quantified samples were then digested according to the filter aided sample preparation procedure as previously described [39]. In brief, 100μg of protein was precipitated by precooled acetone (1:5 v/v) at -20℃ for 1 h, centrifuged at 16000 g for 10min at 4℃, and vacuum freeze-dried. Protein precipitation was prepared using an iTRAQ kit (Applied Biosystems, Carlsbad, California, USA) following the manufacturer’s instructions. The marked samples were then mixed, dried and then subjected to separation and identification.
2D-LC-MS/MS analysis
The freeze-dried sample was dissolved in 110 μL of the mobile phase A solution. Peptide separation was performed on an Agilent 1200 HPLC (Agilent Technologies, Foster City, California, USA) with the Narrow-Bore column (2.1 mm×150 mm×5 μm), analytical guard column (4.6×12.5mm, 5-Micron), flow rate of 0.3 ml/min, at 210 nm and 280 nm. Reverse phase chromatographic analyses were performed using Nano-RPLC Buffer A (Applied Biosystems), PepMap100C18 column (75μm×20mm, 3μm, NanoViper; Thermo Scientific Dionex, San Jose, USA) with the mobile phase B increased from 5% to 35% in 70 min. The Q Exactive Orbitrap mass spectrometer (Thermo Fisher Scientific, Bremen, Germany; nano-electrospray ionization, 1.6kV, 250℃) was used for data-dependent acquisition according to the previously reported method [40].
Protein identification and quantification
The raw proteomics data in the format of .raw was aligned to UniProt database (https://www.uniprot.org/) using Maxquant 1.5.1.0 (Version 1.5.1.0; Thermo Fisher Scientific). Proteins and peptides with fold discovery rate <0.01 were retained as for further identification of differentially expressed peptides/proteins (DEPs). The significant different proteins between groups were identified with the threshold of T-test p value ≤0.05 and fold change (FC)≥1.2.
Bioinformatics analysis
For annotation of the DEPs, Gene Ontology (GO, http://www.geneontology.org) and Kyoto Encyclopedia of Genes and Genomes (KEGG, http://www.genome.jp/kegg/) databases were used for the gene functions prediction. The GO classifications of molecular function, biological process and cellular component and the pathways significantly related to these DEPs were identified with the criteria of p <0.05.
Statistical analysis
Data were expressed as the mean ± standard deviation. The SPSS 22.0 software was employed for the statistical analysis. One-way ANOVA test was performed to analyze the differences. Comparison of differences between groups was detected using t-test. The p-value < 0.05 was considered as significantly difference.