Clinical samples
A total of 30 pairs of breast cancer tissues and matched adjacent normal tissues were sourced from patients undergoing resection surgery at Department of Neurosurgery, Western Central Hospital of Hainan Province, from Feb 2015 to Dec 2018. All patients did not receive chemotherapy or radiation before collecting specimens. All these participants signed informed consents prior to the samples collection. The samples from resection surgery were rapidly frozen and stored in liquid nitrogen until required. This study was approved by the Ethic and Research Committees of Western Central Hospital of Hainan Province.
Cell culture
The normal breast epithelial cell line (MCF-10A) and human breast cancer cell lines (MCF-7, SKBR-3, MDA-MB-468 and MDA-MB-231) were bought from ATCC (American Type Culture Collection) and incubated in DMEM (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% FBS, 50 U/ml penicillin and 0.1 mg/ml streptomycin (Biowest). All the cell cultures were maintained at 37˚C under a humidified incubator with 5% CO2.
Constructs, synthesized oligos and transfection
shRNA (short hairpin RNA) targeting SNHG19 (sh-SNHG19), miR-299-5p mimics, inhibitors and their corresponding negative control were bought from by GeneChem (Shanghai, China). All the DNAs were inserted into pcDNA3.1. Finally, Lipofectamine 3000 (Thermo Fisher Scientific) were utilized to transfer the oligonucleotides and constructs into the MDA-MB-468 and MDA-MB-231 cells according to the manufacturer's protocol.
RNA extraction and quantitative real-time polymerase chain reaction
Total RNA from breast cancer tissues and cells was extracted using Trizol reagent (Invitrogen; Thermo Fisher Scientific, Ind.) according to the manufacturer's protocol. 2 µg RNA was reverse transcribed into cDNA using the PrimeScript RT Reagent kit (Invitrogen; Thermo Fisher Scientific, Ind.). qRT-PCR was undertaken using SYBR Green Master mix (Invitrogen; Thermo Fisher Scientific, Ind.) on ABI PRISM 7500 PCR System (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s protocol. GAPDH or U6 was used as controls and normalized the expression of mRNA and miRNA respectively. Primer sequences are provided in Table 1.
Table 1
Gene | Forward primer | Reverse primer |
SNHG19 | AACATGAGGGAATGAATGAG | TAGACCAAAACAGAAGGAAC |
MiR-299-5p | ACACTCCAGCTGGGTGGTTTACCGTCCCAC | CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGATGTATGT |
GAPDH | CAAGTCATCCATGACAACTTTG | GTCCCCACCCTGTTGCTGTAG |
U6 | CTCGCTTCGGCAGCACA | AACGCTTCACGAATTTGCGT |
Luciferase reporter assay
Mut (mutant-type) or wt (wild-type) fragments of SNHG19 containing miR-299-5p targeting site was synthesized and cloned into a dual-luciferase reporter vector (pmirGLO, GenePharma, Shanghai, China). Similarly, luciferase vectors and miR-299-5p mimics or miR-299-5p NC together with Renilla plasmid were cotransfected into MDA-MB-468 and MDA-MB-231 cells by Lipofectamine 3000. 48 h after transfection, dual-luciferase assay (Promega, Madison, WI) was adopted to examine the renilla and firefly luciferases activity following the manufacturer’s protocol, and normalized to that of renilla luciferase activity.
RNA-binding protein immunoprecipitation assay
Magna RIP RNA-Binding Protein Immunoprecipitation Kit (Millipore, Bedford, MA, USA) was used for RIP (RNA-binding protein immunoprecipitation) assay. Cells were harvested and lysed, and lysis buffer containing magnetic beads was incubated with human anti-Ago2 antibody (Abcam, Cambridge, MA, USA) to conjugate the antibody to the magnetic beads. Then, proteinase K was added to digest the protein and the immunoprecipitated RNAs were isolated using Trizol reagent and measured
RNA pull-down assay
MDA-MB-468 and MDA-MB-231 cells were transfected a biotin-labeled miR-299-5p mimic or NC. 24 h later, the cells were collected and incubated with M-280 streptavidin magnetic beads (Invitrogen; Thermo Fisher Scientific, Ind.) at 4°C for 4 h with rotation. Then, the beads were washed with lysis buffer containing proteinase K (Invitrogen; Thermo Fisher Scientific, Ind.) and 10% SDS, and the supernatants were collected. RNA was isolated and coprecipitated RNA was detected by qRT-PCR assays.
Cell proliferation assay
Cell proliferation was examined by Cell Counting Kit-8 (CCK-8) and 5-ethynyl-20-deoxyuridine assays (EdU) assays. For CCK8 assay, cells were seeded in 96-well plates at the concentration of 3000 cells/well. Then a 10 µL of Cell Counting Kit-8 (CCK-8, Dojindo, Japan) was added after 24, 48, 72, and 96 h of incubation respectively. After 2 h, the plates was washed using PBS (phosphate-buffered saline) and the absorbance was measured at 450 nm through microplate reader (ELx800; BioTek Instruments, Inc, Winooski, VT, USA). EdU kit (RiboBio, Guangzhou, China) was used to perform Edu assay in accordance with the manufacturer's protocol. Briefly, cells were placed in 96-well plates and further incubated with 50µM EdU for 4 h. The cells were washed three times using PBS, fixed in 4% paraformaldehyde and incubated with 2 mg/ml glycine, followed by Apollo reaction cocktail for 30 min. The cell nucleus was stained with Hoechst 33342 for half an hour. Finally, the cells were observed under a fluorescence microscope, and the proliferation rate was calculated.
Wound-Healing Assay
A sterile pipette tip (p200) was used to create a linear wound when cells grown to 100% confluence. Then, cells were washed with PBS and cultured with DMEM without serum at 37°C for 24 h. Images were obtained at 0 h and 24 h after scratching using an inverted microscope (magnification x200, Nikon, Japan).
Transwell Invasion Assay
Transwell invasion assays were performed to determine the cell invasion potential using transwell plates (Corning, NY) that were coated with 50 µL of Matrigel (BD Biosciences, San Jose, CA, USA). Briefly, 1ⅹ105 cells were suspended in 300 µl serum-free medium and added to the upper chamber, while 800 µl complete medium was placed to the lower chamber. After 24 h incubation, cells on the upper surface of the membrane were scraped off. Cells on the lower side of chamber were fixed with methanol and stained with 1% crystal violet. The invaded cells were counted in at least five fields under a light microscope (magnification, x200, Olympus Corp)..
Tumor xenograft experiment
MDA-MB-231 cells (2 × 106) stably transfected with lv-sh-SNHG19 or lv-sh-NC were subcutaneously injected subcutaneously into left flank of 6-week-old female nude mice (n = 5 mice per group). The tumor sizes were measured every week. After 4 weeks, the mice were euthanized, the tumor tissues were excised and weighted, and qRT-PCR was performed to determine SNHG19 and miR-299-5p expression. Animal experiments were strictly obeyed the instruction of the Institutional Animal Care and Use Committee of the Western Central Hospital of Hainan Province.
Statistical analysis
All results are presented as mean ± SD from at least three independent experiments. One-way ANOVA or two-tailed Student’s t-test or was performed for comparisons
between groups. Pearson’s coefficient correlation was used to conduct expression correlation assays. A value of P < 0.05 was considered to be statistically significant.