Chemicals and cell culture
Human PC cell lines (PANC-1 and PL-45) were purchased from Shanghai Institute of Biochemistry and Cell Biology at the Chinese Academy of Sciences (Shanghai, China). Cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM, Gibco) with 10% fetal bovine serum (FBS, Gibco) at 37 °C in a humidified incubator with 5% CO2. Cells were in the logarithmic stage of growth for experiments. Nigericin was purchased from Sigma Aldrich (#481990, USA) and stored in dimethyl sulfoxide (DMSO) at -20 °C.
Cell viability and 50% inhibiting concentration (IC50) values
PC cells (PANC-1 and PL-45) were seeded in a 96-well plate at a density of 3 × 104 cells and cultured at 37 °C for 24 h. After nigericin treatment with different concentrations (0, 0.125, 0.25, 0.5, 1, 2, 5, 10, 20 or 50 µmol/L) at 0, 4, 8, 16, 32 or 48 h, cells were cultured with 20 µl of 5 mg/ml MTT (Sigma, China) for 4 h at 37 °C, and then treated with 200 µl of DMSO for 20 minutes. The absorbance of each well was measured by a Microplate Reader (Epoch, Winooski, USA) at 490 nm. IC50 values were measured at 4, 8, 16, 32 and 48 h respectively.
Cell proliferation, colony formation and apoptosis assays
Treated cells were harvested and incubated with 100 µl of culture medium in 96-multiwell plates (3 × 103 cells per well) for 24 h at 37 °C in 5% CO2. Then cell number was evaluated using the Cell Counting Kit-8 (CCK-8, Dojindo, Japan) for different time (0, 24, 48 and 72 h). CCK-8 (10 µl) was added in each well. After 1 h incubation at 37 °C, the absorbance at 450 nm in each well was detected with plate reader. For colony formation assay, 3 × 103 cells were plated in 6-well plates in complete culture medium containing 0.3% agar on the top of 0.6% agar in the same medium. After the plates were incubated at 37˚C with 5% CO2 for 14 days, the colonies were stained with 0.1% crystal violet. The colonies were counted in 5 random fields under the inverted microscope IX71 (Olympus, Japan). Colonies containing at least 50 cells were counted. For cell apoptosis, cells were double stained with Annexin-V-PE (BD Pharmingen, San Jose, CA, USA) and propidium iodide (PI) (Sigma, St. Louis, USA) following the manufacturer’s instructions. Then cell apoptosis was determined by FACSscan flow cytometer.
Migration and invasion assays
The migration and invasion assays were performed with transwell chambers (8 µm pore size, 24-well insert, Corning Lowell, MA, USA). Cells were collected and suspended in the serum-free medium. Then 200 µl serum-free medium containing 1 × 104 cells was added to the upper chamber, while the 600 µl medium containing 10% FBS was added to the lower chamber as chemical attractant. Cells were incubated at 37˚C for 48 h, and the non-invasive cells were removed with cotton swabs. Finally, the inserted membrane was fixed in methanol for 10 min and stained with 0.1% crystal violet for 20 min, and the infiltrated cells were counted and photographed under the inverted optical microscope IX71 (Olympus, Japan). For cell invasion evaluation, the insert of the chamber was prepared by Matrigel (100 µl, BD Biosciences, USA) covering the upper surface. Other methods were similar to the migration assay. The invaded cells were also counted and photographed under the microscope.
Western blot analysis
Cells were lysed using the RIPA lysis buffer (Beyotime, Shanghai, China) supplemented with proteinase inhibitor (Solarbio). Protein concentrations were quantified using the BCA protein assay (Pierce). The cell lysate containing 30 µg proteins was heat denatured and subjected to SDS-PAGE, followed by transfer to a polyvinylidene fluoride membrane (Millipore, Bedford, MA) by semi-dry blotting. The membranes were blocked with 5% bovine serum album (BSA) at room temperature for 1 h, and then incubated with the primary and secondary antibodies and visualized with the SuperSignal West Pico Chemiluminescent HRP substrate (Thermo). The primary antibodies used in this study were raised against β-catenin (#8480, CST), p-β-catenin (#4176, CST), PRKCA (#2056, CST), GSK-3β (#9315, CST), HBP1 (sc-376831, Santa Cruz), TCF-4 (BS91324, Bioworld ), Cyclin D1 (#2922, CST), AXIN2 (ab32197, Abcam), c-Myc (ab32072, Abcam), β-actin (ab8226, Abcam) and Histone (ab1791, Abcam). Protein levels were calculated relative to β-actin and Histone.
TOP/FOP flash assay
Luciferase reporter assays of the Wnt/β-catenin signaling were performed with the TOP and FOP reporters that contained wild-type and mutated TCF/LEF DNA–binding sites, respectively. TOP/FOP-Flash was co-transfected into cells along with PRKCA (or HBP1) silence or pre-miR-374b overexpression vector. The TOP/FOP-Flash values were normalized to the Renilla reniformis (Promega) reading and the TOP/FOP ratio was measured, as previously described [13]. Experiments were performed in triplicate.
High-throughput RNA sequencing and bioinformatics analysis
PANC-1 cells were exposed to nigericin (5 µmol/L) for different time periods (0, 8, 16 or 32 h), and the high-throughput RNA sequencing was performed as previously described [27]. These mRNAs and miRNAs with statistical significance were screened with p-value less than 0.05, false discovery rate (FDR) less than 0.05 and fold change (FC) more than 2.0 (or FC more than 1.5 for miRNA analysis). The common expressed elements among 3 compared groups (0 h vs 8 h, 0 h vs 16 h, 0 h vs 32 h) were analyzed using the venn analysis. The non-supervised hierarchical clustering was used in the form of heat map to present the expression patterns of the differentially expressed cancer-related mRNAs or miRNAs. Based on the results of Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis for the common differentially expressed mRNAs, the network between KEGG pathways and their corresponding genes was used to elucidate that these pathways including the Wnt signaling pathway. The common differentially expressed miRNAs and mRNAs were subjected to the analysis and the putative targets of miRNAs were predicted by means of Targetscan (http://www.targetscan.org/). Then the miRNA-mRNA interaction network between up-regulated miRNAs and their corresponding down-regulated mRNAs (or down-regulated miRNAs and their corresponding up-regulated mRNAs) was conducted. High-throughput sequencing data reported herein had been deposited at the NCBI website (https://www.ncbi.nlm.nih.gov/Traces/study/?acc=PRJNA543685&go=go) with the accession number PRJNA543685 (SRR9107550, SRR9107551, SRR9107552 and SRR9107553).
Small interfering RNA (siRNA), miRNA regents and plasmid vector construction
The siRNAs targeting genes of PRKCA and HBP1 were designed using online siRNA programs (http://sidirect2.rnai.jp/). The Small interfering RNAs of PRKCA (Sense: AAGAAAAAGUAACAAAUUCAU; Anti-sense: GAAUUUGUUACUUUUUCUUGU) and HBP1 (Sense: UAUAUCCAGGUGAAGAUGGCA; Anti-sense: CCAUCUUCACCUGGAUAUAAC) were synthesized and obtained from Shanghai GenePharma Co., Ltd. MiR-374b-5p (or miR-374b-3p) mimic and inhibitor were also designed and synthesized from GenePharma along with the negative control (NC or anti-NC). Pre-miR-374b over-expression vector (pGCMV/EGFP/pre-miR-374b) was constructed and purchased from Genepharma (Shanghai, China), and a transfectant of the pGCMV/EGFP empty vector was used as a control. At 48 h after transfection, the transfection efficiency was estimated by observing the green fluorescent protein (GFP) signal under the inverted optical microscope IX71 (Olympus, Japan), and the PCR analysis was also used to detect the expression of pre-miR-374b in the collected cells. We also obtained stably transfected clones by blasticidin selection (Sigma, USA) for animal observation.
Quantitative real-time polymerase chain reaction (qRT-PCR)
Total RNA was extracted from PC cells using TRIzol (Invitrogen, USA) according to the manufacturer instructions, and then cDNA was generated from RNA using SuperScript III (Invitrogen). MRNAs and miRNAs expressions were evaluated using the SYBR green quantitative PCR kit (Life Technologies, USA) based on the manufacturer description. GAPDH and U6 were performed as a control internally for mRNAs and miRNAs respectively. QRT-PCR was performed on the ABI Prism 7500 Fast Sequence Detection System (Applied Biosystems). Levels of relative expression were calculated and quantified with the 2−ΔΔCt method. Primers were presented in Supplementary Table 1.
Co-Immunoprecipitation (Co-IP)
For immunoprecipitation, PANC-1 cells were treated by nigericin (1 µmol/L) or transfected with si-PRKCA or HBP1 for 48 h. Cells were washed twice with ice-cold PBS and lysed with lysis buffer containing phosphatase and protease inhibitor mixtures (Roche, Germany). Lysates were precleared for 2 h with Protein G-Dynabeads (Invitrogen) and then incubated overnight with anti-p-β-catenin (#4176, CST), anti-β-TrCP (#2056, CST), anti-HBP1 (sc-376831, Santa Cruz), anti-TCF-4 (BS91324, Bioworld ) or isotype control prebound to Protein G-Dynabeads. The resin was washed three times with ice-cold lysis buffer, resuspended in 30 µl of Laemmli sample buffer, boiled for 3 min and centrifuged at 14,000 g for 5 min. The immunoprecipitated samples were analyzed by immunoblotting under standard conditions.
Luciferase reporter assay
The full-length of PRKCA (or HBP1) 3’UTR containing the predicted wild-type or mutated miR-374b-5p (or miR-374b-3p) binding sites were amplified by PCR and cloned into the downstream of the firefly luciferase reporter gene in pMIR (Ambion, USA) vectors to generate recombinant vectors PRKCA-wt and PRKCA-mut. The constructed luciferase reporter plasmids were co-transfected with miR-374b-5p (or miR-374b-3p) mimics or inhibitors or over-expressing pre-miR-374b vectors using Lipofectamine 2000 reagent (Invitrogen). After 48 h of incubation, the firefly and Renilla luciferase activities were quantified with a dual-luciferase reporter assay (Promega, USA).
Tumor growth in nude mice
Four-week old male BALB/c-nude mice were purchased and maintained in a sterile environment (each group contained 5 mice). PANC-1 cells or that stably expressing pre-miR-374b were injected subcutaneously into the flanks of nude mice with a total volume of 200 µl. Nigericin (4 mg/kg) was injected intraperitoneally every 2 days. Mice body weights and tumor volume (TV) were measured weekly, and TV was calculated as follows: TV (mm3) = length x width2 x 0.5. Bioluminescent imaging was performed on the 28th day after injection at which mice were anaesthetized and given D-luciferin potassium salt (150 mg/kg in phosphate-buffered saline, Sciencelight, Shanghai, China). After 20 min of injection, the bioluminescence was imaged with a charge-coupled device camera (IVIS; Lumina II, PerkinElmer). Signal was displayed as photons/s/cm2/sr. Mice were killed after the bioluminescent assay and the tumor mass were removed and stored at -80 °C for the subsequent PCR analysis. The animal experiment was approved by the Animal Care and Use Committee of the First Affiliated Hospital of Soochow University.
Statistical analysis
All data analysis was performed using SPSS 21.0 software (SPSS, Inc., Chicago, IL, USA). Measurement data were presented as mean ± standard deviation (SD). Data differences between two groups were compared by the t-test, while differences among multiple groups were compared using one-way analysis of variance (ANOVA). P < 0.05 was considered statistically significant.