Cell lines
Cell lines NCI-H466 (HTB-171), NCI-H82 (HTB-175), NCI-H1299 (CRL-5803), SK-MEL-28 (HTB-72), CT26 (RL-2638), 4T1 (CRL-2539), and N1E-115 (CRL-2263) were all purchased from ATCC (Gaithersburg, MD). CT-2A-luc (SCC195) and MCC14/2 (10092303) were purchased from Millipore Sigma (Burlington, MA). Murine colon adenocarcinoma cell line MC38 was kindly donated by Prof. Joseph Glorioso from the University of Pittsburgh.
NCI-H446, NCI-H82, NCI-H1299, SK-MEL-28, MCC14/2, CT26, and 4T1 cell cultures were all maintained in RPMI-1640 medium (Gibco, Gaithersburg, MD) supplemented with 10% heat-inactivated FBS (Gibco, Gaithersburg, MD) and 1% penicillin/streptomycin (Gibco, Gaithersburg, MD). MC38, CT-2A-luc, and N1E-115 cells were cultured in DMEM medium (Gibco, Gaithersburg, MD) supplemented with 10% heat-inactivated FBS and 1% penicillin/streptomycin. All cell cultures were incubated in a humidified atmosphere with 5% CO2 at 37˚C.
IVT template design and construction
Picornaviral positive-strand sequences were obtained from NCBI (SVV-00149 (GenBank: DQ641257) and CVA2150 (Genbank: AF546702.1). Custom ribozymes were designed for the 5’ of the viral template, and 30 nucleotide poly adenosine (pA) sequences were added to the 3’ end, followed by either SapI (SVV) or BsmBI (CVA21) restriction site to generate polythymidine templates of the appropriate length after linearization. SVV IRES2 sequence corresponds to SVA/Canada/MB/NCFAD-104-1/2015 (GenBank: KY486156). The IVT templates were constructed with synthetic dsDNA fragments (IDT Geneblocks, Genscript, Piscataway, NJ) and Gibson assembly (NEBuilder HiFi DNA Assembly Master Mix, Catalog #E2621L, NEB, Ipswich, MA) following the manufacturer protocol. These constructs were sequenced end to end, linearized with either SapI (SVV) or BsmBI (CVA21) (NEB SapI # R0569L, BsmBI # R0739L, Ipswich, MA), and research-grade IVTs (NEB HiScribe T7 High Yield RNA Synthesis Kit Catalog #E2040S, Ipswich, MA) were performed to ensure viral kickoff. All viral stocks used in this work were obtained with these reverse genetics systems.
IVT and LNP formulation
Large scale IVTs (20-100 mg) were performed at Aldevron (Fargo, ND) and purified by diafiltration. In some instances, IVTs (1-50 mL) were performed internally using a heating block (Eppendorf Thermomixer, Hamburg, Germany) at 37°C for 2.5 h using a buffer containing magnesium acetate, Tris-HCl (EMD-Millipore, Danvers, MA), TCEP (EMD Millipore Danvers, MA), equimolar NTPs (Thermo Fisher Scientific, Waltham, MA), inorganic pyrophosphatase (NEB Ipswich, MA), and T7 RNAP (NEB, Ipswich, MA). DNase I (NEB, Ipswich, MA) was added at the end of the IVT for 30 minutes and quenched with EDTA (Thermo Fisher Scientific, Waltham, MA). Next, tangential flow filtration (TFF) was performed using a 100 kDa mPES membrane (Repligen, Marlborough, MA) and diafiltered using water. The TFF retentate was subsequently salt adjusted and loaded onto an Oligo-dT chromatography column (BIA Separations, Ajdovščina, Slovenia). RNA containing a pA tail was eluted using water. A final TFF step was performed as a desalting step to ensure the desired RNA concentration (1.0 mg/mL) and pH (6.5) were achieved. These RNAs were the basis for LNP generation.
LNPs were prepared by mixing appropriate volumes of lipids in ethanol with a vRNA containing aqueous phase using a NanoAssemblr (Precision NanoSystems) microfluidic device followed by downstream processing. Using a flow ratio of 3:1 aqueous:organic phase, the solutions were combined using a microfluidic chip and a total flow rate of 12 mL/min. LNPs were dialyzed against a neutral pH buffer such as 1X PBS to remove ethanol and raise the pH. The resulting LNPs were concentrated using Amicon Ultra centrifugal filter units with 100,000 Da molecular weight cut-off (Millipore, Burlington, MA). RNA encapsulation was assayed using Quant-iT RiboGreen (Thermo Fischer Scientific, Waltham, MA) and a microplate reader (SpectraMax, San Jose, CA). Hydrodynamic size and PDI of the LNPs were analyzed by dynamic light scattering using a Zetasizer Nano ZS (Malvern Panalytical, Malvern, United Kingdom).
vRNA transfection, infection and viral stock production
Viral stock production was done by vRNA transfection using Lipofectamine RNAiMax® (Thermo Fisher Scientific, Waltham, MA). Transfection reagent (1μg/ml) was added to NCI-H1299 cells seeded in a 12-well tissue culture plate at 1 x 105 cells/well. After 72 h post-transfection, supernatants were collected, centrifuged at 2000xg for 5 minutes, and filtered through a 0.45-micron filter. Filtered supernatant (100 μl) was used to infect a new 12-well plate seeded with NCI-H1299 cells. After 72 h, cells and supernatants were subjected to 3X freeze-thaw cycles, then centrifuged and filtered. Supernatant (1 mL) was then used to infect NCI-H1299 cells grown to 80% confluency in a two-chamber CellSTACK® (Corning, Corning, NY) tissue culture vessel in 250 ml of growth media. After 96 h post-infection, the cells and supernatants were 3X freeze-thawed, centrifuged, filtered, and concentrated using 100K Amicon® Ultra 15 Centrifugal Filter Units (Millipore, Burlington, MA) to a 10 ml final volume which was aliquoted and stored at -80⁰C.
Viral plaque titers and IC50 protocols
To quantify SVV infectivity by IC50 NCI-H446 cells were seeded into 96-well tissue culture plates at 1 x 104 cells/well and incubated at 37°C, 5% CO2. After 48 h, culture medium was aspirated and replaced with 10-fold serial dilutions of infectious SVV in a 100 µL volume. After 48 h, cell viability of infected or mock-treated cells was measured with CellTiter-Glo® luminescent assay (Promega, Madison, WI) using a microplate reader (Molecular Devices, SpectraMax i3X minimax imaging cytometer, San Jose, CA). Raw data was converted to percentage survival relative to mock-infected. Values were graphed in GraphPad Software Prism 9.0 and analyzed using a non-linear sigmoidal plot with variable slope (asymmetric four-point linear regression) to generate IC50 values. For each sample, at least five technical were analyzed to calculate IC50.
To quantify SVV virus titer by plaque assay, 2 x 105 MCC14/2 cells/well were seeded into 12-well tissue culture plates. After 24 h, infectious virus was 10-fold serially diluted in serum-free media. Culture media from the cells was aspirated and replaced with 300 µL/well of diluted virus for an adsorption period of 1 h at 37°C with gentle rocking. Virus samples were analyzed in technical triplicate. Post adsorption, 2 mL of pre-warmed 1% methylcellulose in media with 5% FBS was added to each well. After 48 h, wells were aspirated and stained with crystal violet solution. Discrete plaque-forming colonies were counted manually to determine titer.
To quantify CVA21 virus by plaque assay, 2 x 105 SK-MEL28 cells/well were seeded in a 24-well plate (or 2.5 x 105 NCI-H1299 cells/well in a 12 well plate). Mouse tissue homogenates were produced by resuspending pulverized frozen tissue samples in 2 μl PBS/mg of tumor. After mixing, samples were pelleted, and supernatants were recovered. Whole tissue homogenates were 10-fold serially diluted in serum-free media. After media was removed, 250 μl of the dilutions were added to each well. The plate was gently rocked at 37⁰C for 1 hr. Then, 1 ml of pre-warmed 1% methylcellulose in 5% FBS containing media was added as an overlay. Plates were incubated for 48 hr prior to adding 250 μl crystal violet stain to each well; afterwards, the overlay was removed and rocked at room temperature for 30 min. The plates were washed and allowed to dry to visualize plaques.
SVV antisera and neutralization assay
Polyclonal rabbit SVV antisera were generated against UV-inactivated SVV at Maine Biotechnology Services (Portland, ME). To measure the neutralization titer, NCI-H446 cells were seeded into 96-well tissue culture plates at 1 x 104 cells/well in complete media and incubated at 37°C, 5% CO2. After 48 hr, 1 x 107 TCID50/mL of SVV was mixed with rabbit anti-SVV sera diluted in complete media. Serial two-fold dilutions of sera from 1:20 to 1:5120 were tested. Culture media was aspirated from the cells and replaced with 100 µl of diluted SVV per well. Cells were returned to incubation at 37°C, 5% CO2, and in vitro viability assays were performed at 48 h post-infection by adding 100 µL/well of CellTiter-Glo® 2.0 reagent (Promega, Madison, WI). Total luminescence (RLU) was measured on a plate reader (Molecular Devices, SpectraMax i3X minimax imaging cytometer, San Jose, CA). Raw data were converted to percentage survival relative to mock-infected, and values were graphed in GraphPad Software Prism 9.0.
Mice, tumor models, and treatment
Studies in xenografts and syngeneic tumor models
In vivo experiments in xenograft tumor models NCI-H466, NCI-H82, NCI-H1299, and SK-MEL-28 were conducted in 8–12-week-old NU/NU nude female mice (Charles River Laboratories, Wilmington, MA). N1E-115 murine neuroblastoma tumor model was established in 8–12-week-old A/J female mice (The Jackson Laboratory, Bar Harbor, ME). For studies in 4T1 and CT26 tumor models, 8–12-week-old female BALB/c mice (Charles River Laboratories) were used. Studies using the MC38 and CT-2A-luc tumor model were conducted in 8–12-week-old female C57BL/6 mice (Charles River Laboratories). All animals had unlimited access to a sterile, pelleted rodent diet and reverse osmosis-purified water and were maintained on a 12:12-h light:dark cycle with access to environmental enrichment. All animal protocols were approved by the Oncorus Institutional Animal Care and Use Committee (IACUC) and were performed in accordance with IACUC regulations. To establish subcutaneous xenograft tumor models, 5 x 106 – 1 x 107 viable tumor cells were injected into the right flank of nude mice in 100 µl of Matrigel (Corning, Glendale, AZ):PBS (Gibco, Gaithersburg) mixture (1:1 v/v).
For the subcutaneous syngeneic N1E-115 tumor model, viable 5 x 105 N1E-115 cells were injected in 100 µl of Matrigel in PBS mixture (1:1 v/v) into the right flank of A/J mice. For the subcutaneous MC38 tumor model, viable 5 x 105 MC38 cells were injected in 100 µl of PBS into the right flank of C57BL/6 mice. Murine breast cancer (4T1) and colon carcinoma (CT26) models were established in BALB/c mice by subcutaneous injection of 1 x 106 cells in 100 µl of PBS into the right flank of the animals. Treatment was initiated when tumors reached the pre-determined volume of 150 ± 30 mm3 for human xenograft models and 100 ± 25 mm3 for syngeneic tumors. Animals were pair-matched based on tumor volume and randomly assigned to treatment arms. Synthetic-SVV was dosed intravenously at doses ranging from 0.025 to 1.0 mg/kg at weekly intervals for a total number of up to 4 doses, as explained in figure legends. For combination therapy, the anti-mPD-1 antibody (Clone RMP1-14, Bio X Cell, Lebanon, NH) was dosed intraperitoneally (IP) at a fixed dose of 200 µg/animal, every third day, for a total of 3 doses. Animals on treatment were observed daily for clinical manifestations of adverse events, body weight, and tumor volumes were recorded biweekly. Tumor volume was calculated using the following formula: V = a x b2/2, where a is longer diameter and b is shorter diameter. Mice were humanely euthanized once tumor burden reached 2000 mm3.
For the orthotopic SCLC tumor model, viable 5 x 106 NCI-H82 cells suspended in Matrigel:PBS mixture (1:1 v/v) were implanted into the left lung lobe via intra-thoracic injection. Treatment commenced 2 weeks post-orthotopic cell inoculation and consisted of 2 1.0 mg/kg IV doses of Synthetic-SVV-Neg or Synthetic-SVV administered 7 days apart. For survival analysis, mice were observed for pre-determined survival endpoints, which in the case of orthotopic lung tumors comprised of symptoms of lung disease and decreased body conditions (i.e., body weight loss exceeding 20%).
Orthotopic CT-2A-luc mouse glioma tumors were established in 11-12 weeks old female C57BL/6 mice by intracerebral injection of 5 x 104 CT-2A-luc cells suspended in 2 µl of PBS. Tumors were allowed to grow for 14 days, then mice were humanely euthanized, tumors were collected, enzymatically dissociated and immunophenotyped as described below. Immunohistochemical analysis of orthotopic tumor burden
Lungs were collected from treated animals 10 days post-second Synthetic-SVV dose and were fixed in 10% buffered formalin for 24 h, paraffin processed, and sectioned at the level of mainstem bronchi. For IHC detection of DLL3, sections were stained with rabbit antibody specific to human DLL3 (Clone E3J5R, Cell Signaling Technology, Danvers, MA), digitally scanned, and subjected to morphometric analysis using QuPath software.
Efficacy of Synthetic-SVV in mice passively immunized to SVV
Nude mice with subcutaneous NCI-H446 tumors were passively immunized to SVV by intra-peritoneal injection of 1.5 mg of rabbit SVV anti-serum. Control animals received a corresponding amount of normal rabbit serum (Normal Rabbit Serum, ImmunoReagents, Inc., Raleigh, NC). Immunization cycle was repeated twice 7 days apart. After 24 h post each adoptive serum transfer, control and passively immunized mice were intravenously treated with either 106 PFU of SVV virions or 1.0 mg/kg Synthetic virus.
Synthetic-CVA21 tolerability in hICAM1 transgenic mice
Tolerability was assessed in CVA21-permissive huICAM1 transgenic mice after a single IV dose of Synthetic-CVA21 1.0 mg/kg. Animals were observed daily for clinical symptoms of adverse events and weighed for 5 consecutive days following treatment. Tissue pathology and CVA21 replication in treated animals were evaluated at 2- and 7-days post-treatment.
Efficacy of Synthetic-SVV in SCLC PDX model
To establish the SCLC PDX model, 2 x 2 mm fragments of LU5184 SCLC tumors (Crown Bioscience, San Diego) were implanted using a sterile trocar into 6–8-week-old female NOD SCID mice (The Jackson Laboratory, Bar Harbor, ME). Treatment commenced once tumors reached a pre-determined volume of approximately 150 mm3 ± 50 mm3. Animals were pair-matched based on tumor volume and randomly assigned to treatment groups. Synthetic-SVV and Synthetic-SVV-Neg were dosed in 2 intravenous 1.0 mg/kg doses administered at weekly intervals. Animals on treatment were observed daily for clinical manifestations of adverse events, body weight, and tumor volumes were recorded biweekly. Mice were humanely euthanized once tumor burden reached 3000 mm3. For the pharmacodynamic analysis of virus replication in SCLC PDX tumors, tumor-bearing mice were treated with a single, intravenous dose of 1 mg/kg Synthetic-SVV or Synthetic-SVV-Neg. Five days post-treatment, tumors were collected and processed to evaluate negative-strand SVV RNA by RT-qPCR. Another group of mice was treated with 2 intratumor doses of 106 PFU SVV virions on Days 1 and 3. Two days post-second treatment, tumors were collected and processed to evaluate negative-strand SVV RNA by RT-qPCR.
SVV and CVA21 RNA negative-strand specific RT-qPCR
Tumor RNA extraction
Tumor samples were kept frozen during the entire procedure preceding RNA extraction using dry ice and liquid nitrogen to flash freeze. Samples were pulverized using Cp02 cryoPREP Automated Dry Pulverizer (Covaris, 500001, Covaris, Woburn, MA) for SVV- and CVA21-treated tumor samples. For SVV samples, 10 mg of pulverized sample was weighed and transferred to a 2 mL microcentrifuge tube (Sample Tube RB, QIAGEN 990381, Hilden, Germany). Buffer RLT Plus with B-mercaptoethanol (600 µL) was added to each sample and lysed. The remaining steps were performed using the QIAcube (QIAGEN, Hilden, Germany), following manufacturer’s protocol for QIAGEN RNeasy Plus Mini Kit (QIAGEN 74134) under the section for Purification of Total RNA from Animal Tissues. RNA samples were treated with DNAseI (RNAse-free) (New England Biolabs, #M0303S, Ipswich, MA) after extraction.
For CVA21 samples, 10 mg of pulverized sample was weighed and transferred to a 1.5 mL microcentrifuge tube. Lysis Buffer/Proteinase K mixture (400 µL) (RNAdvance Tissue Kit, Beckman Coulter, A32649, Pasadena, CA) was added to each sample. Samples were incubated at 37°C for at least 30 min to lyse samples completely. The remaining steps were performed using the Biomek i5 (Beckman Coulter, B87583, Pasadena, CA) following manufacturer’s protocol (RNAdvance Tissue Kit). The RNAdvance Tissue Kit includes a DNase I treatment step.
cDNA synthesis and quantitative PCR analysis
RNA samples were normalized to an equal input for cDNA synthesis. Virus negative-strand specific primers were used to synthesize cDNA. The SVV negative-strand specific primer 5’-GCGCAAATTCGTCCAAAACAACGAC-3’ and the CVA21 negative-strand specific primer 5’-AGACTACGGACTGACCATGACTC TTAGGACGCTTTTACTGAGAAC -3’ were synthesized by Integrated DNA Technologies (IDT, Coralville, Iowa). For both SVV and CVA21, cDNA synthesis was performed using SuperScript IV First-Strand Synthesis System (Invitrogen, 18091200, Carlsbad, CA) and their respective specific primers.
Quantitative PCR (qPCR) analysis was performed using TaqMan probe chemistry. qPCR reactions (20 µL) were made containing 10 µL of TaqMan Fast Advanced Master Mix (Applied Biosystems, 4444557, Foster City, CA), 1 µL of TaqMan Gene Expression Assay, FAM probe (Applied Biosystems, 4332078), 4 µL of nuclease-free water, and 5 µL of diluted cDNA. TaqMan Gene Expression Assay probes were made customized for either SVV or CVA21. SVV probe 5’-TGGAAGCCATGCTCTCCTACTTCA-3’, forward primer 5’-CGACGGCTTATACAAACCAGTTA-3’, reverse primer 5’-AGCTTCTCGAGTAGTGTTCCT-3’ and CVA21 probe 5’-TGCCTATGGTGATGACGTGATAGCT-3’, forward primer 5’- GAGAACCTACAAGGGCATAGAC-3’, and reverse primer 5’- TAGGAGACTAGCGTCAACCT-3’ were custom ordered through Applied Biosystems (ThermoFisher Scientific, Waltham, MA). qPCR parameters 95°C for 20 s followed by 40 cycles at 95°C for 1 s and 60°C for 30 s. Each qPCR assay contained technical triplicates for each standard and sample.
SVV fluorescent in-situ hybridization
Tumors were harvested at the indicated timepoints, bisected, fixed in 10% buffered formalin for 24 h at room temperature, and paraffin-embedded. RNAscope FISH of SVV negative and positive RNA strand was performed at Advanced Cell Diagnostics (ACD, Newark, CA). Standard RNAscope LS Multiplex fluorescent pretreatment conditions were used. Briefly, epitope retrieval was performed at 15 min at 95˚C, followed by protease III treatment for 15 min at 40˚C. Samples were first evaluated for quality using the positive and negative reference controls for specificity and sensitivity (ACD Catalog # 313908 and 320758, respectively). Custom SVV probes were designed for both the positive and negative strands (ACD Catalog # 819848 and 819858-C2, respectively) and were confirmed to be specific. All of the samples passed QC with positive control staining, and little to no background staining was observed. RAW data was analyzed with 3DHISTECH CaseViewer Software (3DHISTECH Ltd, Budapest, Hungary).
Immune profiling of tumors
For flow cytometry, tumors were collected on Day 14 after the first dose. Tumors were weighed and then cut into small pieces before being disaggregated into single-cell suspensions using a Miltenyi GentleMACs Octo-dissociator with heaters according to manufacturer’s instructions. A T/NK cell and a myeloid cell flow panel were performed using the following reagents and Ab clones: A LIVE/DEAD™ Fixable Red Dead Cell Stain Kit for 488 nm excitation (Invitrogen, Catalog # L32102) was used to assess the viability. Surface cell staining was performed by using BD Stain Buffer (Becton-Dickinson Catalog # 554656) with the antibodies for mouse CD45 (30-F11, Catalog # 103154), CD3e (17A2, Catalog # 100218), CD8a (53-6.7, Catalog # 100730), CD4 (RM4-5, Catalog # 100552), CD25 (PC61, Catalog # 102041) CD69 (REA937, Catalog # 130-115-461), CTLA-4 (UC10-4B9, Catalog # 106323), NKP46 (29A1.4, Catalog # 137612), KLRG1 (2F1, Catalog # 138409), CD127 (A7R34, Catalog # 135035), PD-1 (29F.1A12, Catalog # 135216), MHCII (M5/114.15.2, Catalog # 107635), Ly6C (H,1.4, Catalog # 128037), CD206 (C068C2, Catalog # 141720), CD86 (GL-1, Catalog # 105037) and PD-L1 (10F.9G2, Catalog # 124312). Foxp3/Transcription Factor Staining Buffer Set (eBioscience Catalog # 00-5523-00) was used for FOXP3 (150D, Catalog # 320008) and CTLA-4 (UC10-4B9, Catalog # 106323) intracellular staining. All antibodies were purchased from BioLegend (San Diego, USA), except CD69 Miltenyi Biotech (Bergisch Gladbach, Germany). Data were acquired on a BD LSRFortessa using BD FACSDiva software and analyzed using FlowJo software. For the T cell and NK panel, cells were first gated for time (SSC-A vs. Time), lymphocytes (SSC-A vs. FSC-A), and singlets (FSC-H vs. FSC-A). The lymphocyte gate was further analyzed for their uptake of the Live/Dead stain to determine live vs. dead cells and CD45 expression. Then, the cells were gated on CD3 vs. NKP46 to select T cells or NK cells. For the T cells, the population was gated for CD4 vs. CD8, and the CD4 T cells were further gated for CD25+ and FOXP3+ to analyze the Treg population. NK cells were gated for NKP46+ and CD3-. For the myeloid panel, cells were first gated for time (SSC-A vs. Time) then lymphocytes (SSC-A vs. FSC-A), and singlets (FSC-H vs. FSCA). The lymphocyte gate was further analyzed for their uptake of the Live/Dead stain to determine live vs. dead cells and CD45 expression. Then, macrophages were gated using SSC-A vs. CD11b+ and subsequently on MHCII+Ly6C-subset. To distinguish between M1 and M2 macrophages, we used CD206-CD86+ for M1 and CD206+CD86- for M2. Enumeration of cells per mg of tumor was calculated using 123Count eBeads (Invitrogen, Catalog # 01-1234-42, Carlsbad, CA). A fixed volume of beads with a known concentration was added to each well prior to analysis by flow cytometry. The number of beads in the gated fraction was then used to calculate cell number using the following equation:
![](data:image/jpeg;base64,/9j/4AAQSkZJRgABAQEAYABgAAD/2wBDAAIBAQIBAQICAgICAgICAwUDAwMDAwYEBAMFBwYHBwcGBwcICQsJCAgKCAcHCg0KCgsMDAwMBwkODw0MDgsMDAz/2wBDAQICAgMDAwYDAwYMCAcIDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAz/wAARCABdAkgDASIAAhEBAxEB/8QAHwAAAQUBAQEBAQEAAAAAAAAAAAECAwQFBgcICQoL/8QAtRAAAgEDAwIEAwUFBAQAAAF9AQIDAAQRBRIhMUEGE1FhByJxFDKBkaEII0KxwRVS0fAkM2JyggkKFhcYGRolJicoKSo0NTY3ODk6Q0RFRkdISUpTVFVWV1hZWmNkZWZnaGlqc3R1dnd4eXqDhIWGh4iJipKTlJWWl5iZmqKjpKWmp6ipqrKztLW2t7i5usLDxMXGx8jJytLT1NXW19jZ2uHi4+Tl5ufo6erx8vP09fb3+Pn6/8QAHwEAAwEBAQEBAQEBAQAAAAAAAAECAwQFBgcICQoL/8QAtREAAgECBAQDBAcFBAQAAQJ3AAECAxEEBSExBhJBUQdhcRMiMoEIFEKRobHBCSMzUvAVYnLRChYkNOEl8RcYGRomJygpKjU2Nzg5OkNERUZHSElKU1RVVldYWVpjZGVmZ2hpanN0dXZ3eHl6goOEhYaHiImKkpOUlZaXmJmaoqOkpaanqKmqsrO0tba3uLm6wsPExcbHyMnK0tPU1dbX2Nna4uPk5ebn6Onq8vP09fb3+Pn6/9oADAMBAAIRAxEAPwD9/KKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiq+qXkmn6ZcTxWs99LBE0iW0BQS3DAEhFLsqBm6Dcyrk8kDmvnbwp/wAFL/D3i/4L/Bbx1b+AfiRHpXxw8Rx+GtLglt9OF1o00jzqk16gvCBCVtpZN1u05CAEqCcUAfSNFFFABRRRQAUVj/EH4g6J8KPA2r+JvEuqWWieH9BtJL/UdQvJRHBZwRqWeR2PAAAJqv8AC7x//wALQ8D2WujRde0CHUVMsFrrNstreGIn5JHh3M0W9cMEk2yLnDojAqADoKKK8x+NH7UWn/BH40fCrwVeeG/FGrXPxb1W80fTtR02O1ey0u4trKW9b7X5k6TKrwQXDK0UUozCwbYWTcAenUV5j+z1+1Fp/wC0T4t+JujWXhvxRoFz8LPFUnhLUZNXjtRFqFwttBdLNatBPLuheC6t3HmeXIPMAZFYMo9OoAKKKKACiis3XvGOkeFbvS4NU1TTtNn1y8Gn6bHdXKQvqFyY5JRBCGIMknlxSvsXLbY3OMKSADSooooAKKK8i/aF/bk+Hn7L3j/w14W8WTeMW8Q+MYLm50aw0HwTrfiKa/S22mcqNOtJ+Yw6FgcEKwOMHNAHrtFcV8Av2h/B/wC0/wDDxPFPgjV/7Y0Y3U9hI8lpPZ3FrcwSGOaCe3nRJoZUdSrRyIrA9RXa0AFFFeZt+05ZR/tex/B1vDPipdTm8KSeLo9d8u1OjNbpdR2rQbhP9oW43yKQrQBCoYhztIAB6ZRRRQAUV5j+1R+1Fp/7J/hLw3rOp+G/FHiS28S+KtK8JJHoUdrJLZXGo3K2tvNKs88OYfPkiRvL3yDzVOwqHZfTqACiiigAoqpruozaRol5d29jdapPbQPLHZWrRrPdsqkiKMyukYdiNoLuq5IyyjJHN/BT436F8e/CM2r6E92n2K9m0zUbG9t2tr3SryFtsttcRNyki5B7hlZHUsjqxAOvooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooqh4q8U6d4H8L6lrWr3kGnaTo9rLfXt3O+yK1giQvJI57KqqST6CgC/RXyV+wr+1B8R/jR+2R8adB8cSQ6doMHh7wx4r8IeHns0t7zQbDUJNXh2XDbRK88iafbzyq/+okuWhHEe5/Pf+CXn7alha+FvBfh/Vo/inrlp8c/GHiy98F+KNZ1KTWtL+zw3V/dWelpdXV1Je5TSbRJQxi+zlllRZd4KUAfe9FfPXwI/4KJaP+0H4vli0j4f/Eiy8FLLqsMXju+g05fDsj6bKYbkSMl491anerBPtVvDvCMRkDNUPgr/AMFQfB3xv+I/gPRrTwl8Q9E0T4sJeSeA/FGsWFrb6V4xW1t2upGtkW5a8jVrZHmja5toVljUshbjIB9KUV8Jfsyfte2f7OPwi8U+O/EA+K/jXwz8UfjVqul+H5ZL6bWY9Asm1y38PWuJL24Hk2cl4FligiJfy7p2jhKRSFPZf2hP+CiGjfBj4f8A7QWqaZ4W8R+Kb79nfS7e/wBct7eSytobmSayF95cUs9xGP3Nq8U827a3lyKIlmkIjIB9EUV8zfDz9vfWvCv7LngXxB8Xfhv4u8KfE3xUbbSbfwjZxafcXniXU/sKXNxLp8cF/cRw2YxcMGvbiJokgYzFPlZ/Sv2Rf2qtE/bI+D//AAmOhaVruiW0Wq3+i3Njq625uLa6srqS1uE8y2mnt5VEsTgSQzSIcHDZBAAPT6K+f/BX/BQjR/id8WIND8MfD/4neIfCT65feHJvH9nptqPC9ne2Udw1yJJXuVufIR7aWH7Ulu1uZtsYlLMBXPeBv+Cr/gXx54p8JRweE/iRbeEviLc3tn4M8YTaVA2k+LprW2nunSzijne/IkgtpnheS1jScKPLZy6BgD6hor558Nf8FIvCXiH4Y6Z4kk8MeN9Nm1T4jD4Xx6NdW1mdRTVhem0kZhHcvCYI9ksrsspZYoZPkLrsrk/it/wV98GfCN/ikl78Pfi3eSfCCO3vvEEdtpVmrx6ZMjOmoqJbuPEWEbEMmy6kwTHbyAEgA+sqK+YviP8AtwePPDn/AAUb0b4N6B8H/E3ibwvD4XOva9rtld6SHt/tF3Db2c8az6jC6WqFNQE26Jp3aFfJidVZz7L+0349k+FX7NvxB8UQu8c3hvw1qWqRugyytBaySgjkc5X1H1oA+ePhb8bdb+Jnwy+NH7S9hpV14sXQrPXtM+GOg24ZjeadpXmxvJGgOTPqV/ayMGABaBLJQAQxbwTwn8Z18EfsB+L/ANoL4bfGnx58b/jJ4d+HTz65EPEt3qnhKPV74QOZ30yMtZWr6e0cp+z26xyxwGUTJI7I4+nP+CfXiDwp+yL/AMEj/gZf+NPEvhvwh4d0D4eeHjqms6xqUVhp1vPPaW4ZnnmKIokuJtq7iCzSKOpre/4exfss/wDRy3wA/wDDh6R/8kUAfGvwl+NviL4O/sq/tG/HTT/jInxK/wCES+Gswj07w9481Tx3ok+trHcypqKajcQW9pFMWEaPa6dbQx26gmRMtHj0Hwr4n+H/AIL+Pf7Dfwn0nXLW78HeBvCOqaxoN3HBK0HiG/sbW08PWf2UBMz7otT1C581RtEMZn3eVmQfRP8Aw9i/ZZ/6OW+AH/hw9I/+SKP+HsX7LP8A0ct8AP8Aw4ekf/JFAHyz+yN8YfDn7T//AAUcuZNJ+Lnib4raPrB1HxnpN74T8faidJ0LT1jitl8O+IvDjn7JZFTdB4HMa3E72snmBNjq/wBM/sgeLpvhN8dviF8ANQuLie38EW1l4k8Fy3Mpklk8OXxljjtSx5f7Fd21zbgklhB9j3EsWY7vhP8A4Kbfs3ePfFWm6FoX7QfwQ1rW9au4rDT9PsPHWl3N1f3ErhIoYoknLySO7KqqoJYkAAk15z8dbt/Bv/BaH9nm6tWIbxn8OPGui3y9mitLnQruIn1Id3x0xubnkggH1tRXH/Gv4l618K/CtvqGhfD3xh8Srua7W3fTPDdzpUF1AhR2M7NqN5aQ+WCqqQshfMi4QqGZeI+H/wC1F448ZeM9P0vUf2cPjP4Tsb2Xy5tY1XU/CUllYLgnfKtrrc85XjH7uJ25HFAHD/8ABV2fd8E/hzZXck8eg6t8XPBNjrXl/dktX16z2xyH/nk84gR+xVyDjOa5T/gof8d7LRP2rfhR8N/G/j7U/hJ8JvEGjavrusa9a66/h+XxLqFtLZw2ehQahE6TwyOtzPcFLeRJ5RbKqNt8xW9f/bk+JHwM0j4TXHgr46fEHwL4G0Px5bzW9sviHxRbaDNdmFonaW0klljbzYJHgkDxndG5ibIO2uK+F3/BUD9nbwl4HstN8R/tb/s/eKtUs1MT6qfGmjWUt4gOEeWNLop5xXG9owiM2SscYIQAHyb+2P8AF/xB8KPjX4O+CcHxL1Lw38MdN+Hya9Ya349+JuteGfEXjHUr29uFRIrm1tm1PUprGKKMGyS4tpmN3H5vmbUr2vwVrC+EP+Ch37Ovwx8Z+N9U8Va98Ofg7c6hBqGqWMkWo+LtWvZrSxa/aLaWVooLG9Mu7mP7evmPlst7P/w9i/ZZ/wCjlvgB/wCHD0j/AOSKP+HsX7LP/Ry3wA/8OHpH/wAkUAcZ/wAEaPiZpHxo/ZN1PxpYagNR1Xxz4x1/xNrJSF1Wxnu9SuHhsmYqB5ttaC1gdMlkMOGweK8z/Zr8caN+2R+1F4tm8bfFz4jeHvif4T+Jd9Z6J8PNA8VXemR6Do2k3bC3/tHTbY+VNb6jFbGZ575HSRbtYoJFymff/wDh7F+yz/0ct8AP/Dh6R/8AJFH/AA9i/ZZ/6OW+AH/hw9I/+SKAPiLwD+0L4l/aM8ceEr7R/ih42n/aR1j4vCDWPAuma/d/2V8OfCllq8kd1b6lpEUgtFR9Lts+fdxmWa4ul8mUAqVX41ftY3vwz8B/tT+FLT4p+NYtZ1T4reH/AAJbXV/4kn+3+BNPvBo1ne648u5RplvJLd3jw+SsUW6NWiAAkKfbn/D2L9ln/o5b4Af+HD0j/wCSKP8Ah7F+yz/0ct8AP/Dh6R/8kUAfL/7UPjK/1D9oD9ojxRZ+Pvi6nw3+G3wXt/E+taZp/iDUdMkudSuRfXVlbWyQtHLYtFbWSPI0KxXDm5jE0jKGVuH8XT/Df43fHf8AYwsPid8TfFOp/wBi/C+9v4/EmneONb0ifxprsa2Olo2nCxuIpLi5l+06lM09sDJLCR87wE19sf8AD2L9ln/o5b4Af+HD0j/5Io/4exfss/8ARy3wA/8ADh6R/wDJFAHS/tga34S0H4HSaF4n8YeI/CcXiN10nTP7A1eWz8Q6zc7GkSzsJI2+0yXLrGxxAwlKq53ABmHiH/BGv4iX3xq+AVrrnjXxv4p8WfF/wzaDwh41s7y9nSz0K+sZpLSSBrRHNoLx3tGuJJfnncXSPvW3lt0HpX/D2L9ln/o5b4Af+HD0j/5Io/4exfss/wDRy3wA/wDDh6R/8kUAfGH7afxv8fftDft3/E/4TS/FGz+DtpoT6ToPgeK38catpHiO4nurSKebW7TRdNgEutp51wYFEt59ljNkwkhyZDXQftpftE/D7Vf+CmWr2uu/tMD4K6l8Efhqmm6fcaddaFc63q+o61cma8t4bC9tLpp5Fh0vTWK2sKTE3KorAMQfq/8A4exfss/9HLfAD/w4ekf/ACRR/wAPYv2Wf+jlvgB/4cPSP/kigD4i8WfGr4hfsyf8E5/2YtLms9I+DmofGPU7nV/idr3irxXc+E4re5ltZ76dLrV5IbufT7vULgqdxUyLtkgSSJykidPffEfWfg18D/gP4M1/42+JbPwF8avHmtXOreNv7Y1MTaRpcMNxcWegWWraixv2FxNFFFFdu3nTx+aYCnmQ4+tv+HsX7LP/AEct8AP/AA4ekf8AyRR/w9i/ZZ/6OW+AH/hw9I/+SKAPinTP2vtU+Gf7H/xM/sj4k+OdDstT+OUfgGbXfE+qXOp33wo8OnUF02Wae6v2kMU+21up0a6d5I/7QtZJPk8vPtv/AATZm8ISft4fH+HRPEXjXXm0Ky0HQNHTxRrWoa3fJYLZjUpbxbi8eWZLa6m1QeV5jhZDayeSuyJgvtP/AA9i/ZZ/6OW+AH/hw9I/+SKP+HsX7LP/AEct8AP/AA4ekf8AyRQB5V+2r8VT8Nf+Ckvwi06fxz4+0Kw17wH4uupdK0i+lkXV54jpdtaQWenqGiub1XvJ51Z4pHTysk+UGC+T/ErxRcfs0+O/hV8Kvjh8YvGfw8+GV5oniLxpqWp3fji+h1bXtSl1RWsPDEWspML6X7Fa3TAJBMJ7j7PDtLKHWvq3/h7F+yz/ANHLfAD/AMOHpH/yRR/w9i/ZZ/6OW+AH/hw9I/8AkigD5J8AfE7xJa+FP2KfCvxi1jxDZz+J/HXiLxnbR+Iop59ZurCxW+Og6ZcFg0st6E1DTJmDgzH7FJuyyO55n41ftY3vwz8B/tT+FLT4p+NYtZ1T4reH/AltdX/iSf7f4E0+8GjWd7rjy7lGmW8kt3ePD5KxRbo1aIACQp9uf8PYv2Wf+jlvgB/4cPSP/kij/h7F+yz/ANHLfAD/AMOHpH/yRQB8v/tRePJJPj9+0R4sPxI+LFj8L/hp8GbXxNrthaeI7/SDPqFz9tubO2thG0Uli8VtZozmFY7iVrqJZZGGUdvwp8ZeN/2ZP2ofh7o3ivx78RPHPxF0T9nubWvEXh271O7mi8Zaxvt47UW+nhjBHLCbC/WW4SMOTdxGaQl1r6i/4exfss/9HLfAD/w4ekf/ACRR/wAPYv2Wf+jlvgB/4cPSP/kigD5M/wCCRPj7xn+1T8YPCHxB8Q/GzS9f12Hwxc6j4u8PeGPHGqeI9Pu7m7Fv5dveWTQW+m6FLaM7hLNI3u2wd88qxys/0P8AspTXFp/wVK/azsbeOKPRHsvBWot5WMSanLYXsVyzgH/WfZrbTgcgHasfXiuj1r/gq7+zLPo92mnftO/s7WuoPC62s1z470q4hhlKnYzxrdoXUNglQ6EgEBlzkVP2DPip8B9V1bxRpHw4+Nnw4+LnxB8U3k3i3xXd6L4m07UdS1CQiC2894LaRjFbQxi1to1xtjRIVLMxLMAfSlFfPP7V/wC3Cf2GPGf9vfEvTUt/gtqFmkMHifTLee7utF1UF8Wt7boGdo7n92lvLEp/ffunUGSNj6N+zb4y8c/ET4dtr3jzw1Z+Db7VruS503Qlm8690vTyFEEd84Yxm8OGeRYv3cZcRhpPLMrgHoFFefftE/tJ+Hv2afDOmXutRapqWoeINRTR9C0XSrcXGpa7fNHJKLe3jLKu4RxSyM8jJHHHE7u6IpYfMH7Vv/BRu7+I3/BLn4l/EX4Y3PjT4aeNtH15PBemefpNhrGpWmu/2rbWKwxQQDULW+RpphGRbeeWUyKhWVcoAfcFFfDv7Dn7SXivxb+1D47t3+K/jvx38IfAXhQTeJb74meFLHwlrWi628kcsIitUsNOuEs/saXbySXVsF3eV5Usm2UJ6b8Hv+CpPgT4v/FX/hG/7A8b+F7G68JXXjrTdf1+0tbTTtS0a3eBZLwxi4a7tEIuYnX7db2+9SxXdgigD6Vor5w+C3/BS3w78bvin4I8NWngD4o6Jb/EyyvNW8Ja1rGm2ltY69p1pEkk18sYuWuoIR59qqi5ghkc3cJVGTe6eLftG/toWv7aGqfBrwz8O7P4w6Do3iz4o6cmhePNL1D+xtI8UW2mtPd6pFEbe7W7uLSSxtbxQ09sLWbKvGzlY2AB98UVw37RX7Q3hv8AZd+Fl14u8Uy3v2CG4t7G3tbC1e7vtTvLmZILa0toEBeWeWWREVFHVsnABI8sv/8Ago5pvhPwFNqfiz4W/FzwX4gn8TQ+EtD8KapptjLrPiy/mto7pBp32a8mtpovKd2eYzrHF9nuBIyGJ8AH0ZRXynr/APwVz8EeD/hb4h8Ta34J+JmkS+B/FMHhLxdpM9jYvd+ErmY2Wya6lju3tGhI1C0ZTbzzO4kbYjmOQJ2PhX/goh4M1DT/AIuXviXSfFnw8sfgvbQ6jr0/iW0ghEljNbvcQ3UKQTTPh442IhlWO4BKq0KswBAPe6K+dtG/4KN6Pa+D/E3iHxp8Nfi58MNB0Cz068tL3xPotuo8R/2hPJb2lvYxWtxPM928yIhtJEjuEa4gDRr5i54/Xv8AgsP4P8JfCn4oeKNY+G3xb05/g/dQweJdKFlpl3dWcUlp9s8/zbe+ktAqwDc0b3CzhmSPyvMkjRwD65orwLw9/wAFAdI8V+MviV4esPAvj9tY+HPhu08WxwXMen2g8S6ddNdpby2jS3aiLe9jcDbe/ZWG0MQFYNXkHwZ/4K7atZfsL+FfjL8X/g18RPCFh4jFhefabCDTbjT10/UblEtLwFdQkkSNEubNXWYRXEjSM0VswV1jAPtyivn/AMRf8FDNC8DeBtZ1rxH4C+KfhyW28TW3hPQNK1DRI11Lxve3NvHcW/8AZcKzMZUeORtxlMXkmC5Ewi8iXZ598av+CrU3hH9kz41eN/Dnwm8ev4x+DsiaRqPhvWG0yN7XVZreOaCKSWG+eGZFS5s5H+zSyOVuo1jDybkQA+waK+VPiF+1X4+1RvgF4TvvDHxC+Enjb4n+KUtb6RtM0HWIYItNh/tC/tZxHqc4ggvraC5jiuITcSQgHcqSGLdo/Fr/AIKo+BvhN4p8TxN4Y8e694S8BazbeHvF/jPS7O0bQfC9/O8CCCZ5bmO4nZGuYRL9kgn8nfiTaQQAD6aor5S+L3/BXDwd8G9U+LllffD74sXt18GNKi8Ra3Hb6XZRfaNIb7Xv1GAz3cQ8qP7FP8kxinkHltDFMsiMfqXSdSTWdKtryISLFdRJMgddrAMARkdjz0oAsUUUUAFeN/tlfsv6r+1r4c8M+GD4j0fTPA0Wt2+oeMNEv9BbUh4wsYXWQaazi5iWGB3UGTckokVQjLsLq/slFAHyB8Ov+CUtn8Cf2hvjH4s+GWp/D34YeGPih4It/CVh4d8K/D+LS/7DuYFuDHqcksNysd1N5t3MSPIizGkCbv3Zd7nwU/4Jq698N4vBP9s/Eyz1aT4NeFbnwp8MF07wpHp8HhhZbNLJdRuonuJxe36wRrHvHkQ7JJgIF81jX1nRQB8j/Df/AIJjakNX+MOqeP8AxzoWqar8Z/CLeENcPgrwm3hK1vFeOaN9TuYTeXRn1MrMV+0hkwiqoQACtj9nz/gn/wCJvAvj/wAFeJPiF8S7Lxpd/Czw3L4Z8E2ejeFxoOn6NHLFHBLeSxNc3TXF40MMce/ekSp5gWFfMY19QUUAfHPg3/gmD4v8F/sZ/Cb4Xx/F2xvdX+EPiXS9f0zV7vweGsb2OwVljguLNbtZJGdj9oeY3W77T84CoBCGav8A8Ep9Z1X4H/HrwTJ8V5LqD4267/wkb3d74cSaS2u2SwWX7Xi4U3cTCwEYiiNsiQzNEFwqMv2TRQB8h/tUf8EyNY/a2i+FmteMPF3w+8W+NfhrPqsjf8JZ8OY9a8K6kuoCMOBpH2yJo3g8iH7PK11JIm19zSeYxr6V+DPw/m+FXwt0Tw7cX8GpzaTbCB7mDTYNNhc5JxHbQKI4YxnaqLnCqMsxyx6eigD5i/ZY/YB8R/s+/s/XXwi1b4mL4j+Gdrot/wCH9Gs7Tw//AGdqsVrdPIfMvb5rmY3NzGsjKssMdsCWLOjNgil+zJ/wTn1/4VeKfhZfePfiRY+ObH4F6I2heAtL0rwuNBtdOVrNbE3l0Dc3DXN59kDQh0MMSrNLthBfI+qqKAPifwl/wSc8WeFoPhlH/wALmjkT4U+O9a8ZaSF8IqBcjVV1T7Q1yrXTJLfo2qyvHdlfLUxLm1bdJv6z4s/8E1b/AOI3w5+Ndha+PoLHxH8ZPHOl+L59UutA+2W9pa6cdNW20qW3+0o09v5WnbHKyxFvtMpG3OD9WUUAfPPgz9jfxn4K/bC1X4nQ/E+2ubHxRoeiaR4gsbjwvG2pX50sXZj8q8E4ht4JXvJXkiW1LbsbJU5z6z8e/h9/wtr4F+NPCoVX/wCEm0G+0naxwrefbvFg8jj5/UfWutooA+dv+CRvjhviF/wS9+AOoTGQ3sPgPSdOvvMXa63drax2tyrDAwwmhkBGOCCK+ia8F/Zc+Furfsv/ABb8c+BI7G5m+HniTVLzxn4Tu4ICbfRpLybztS0uUjIjxeSyXUOQqsl5JGo/0c57/wDak/5Nl+Iv/Ysan/6SS0Ad3XkPwB/bC079oX44fFjwNp/hLxjo9x8H9Xg0TVNV1JbH+zdRuZrdLpVtGguZZGxBNBI3mRxlRMikBwyr8R/sieNdY8R/tCfsdeL4/hx8Wbbw34Z+Cmo+DdUv7rwdfQR2WqMmiOYn3R5EQjtZnW4x9nn27YJZpDsrv/8Agmp+05e6JYQ6NP8ACz4zL8QPjT8SPEHifxLJrHw713QNM8MWs01zJbSXN/eWcdu5j0+1sbZESRmeQxpkDkAH33XyX8XrFviD/wAFpvgnbQY2/Dj4YeK9cvWB+7/aV9pFnbo3X732W4ZemfJfnjB+r727Wws5Z3EjJChkYRxtI5AGTtVQWY+gAJPYV4T+x38KtZvfHXj74y+MNMm0jxX8UprWCx0u5XFxoHh+yWRdPs5R1WdmmubqZc/JLetHz5QJAPS/jX+z34B/aU8K2+hfEXwP4P8AH+iWl2t/Bp/iTRrbVbWG4VHRZlinR0EgSSRQwGQJGGcMa4j4f/8ABOH9nn4TeM9P8R+FfgN8GPDPiHSZfPsdU0rwTptle2UmCN8U0cKujYJGVIPJr2eigAoor8q/+Cef7Mfin4y/tLeEfiB8bNM8YR/F/wAMa9qniXV7pfhnqGjvpc7C7t49Nk8RXs7x6hpixzKILfSUSFhHC0iYEhYA+s/in/wU9h+GnxW+KHhm2+Cnxm8VW3wetrW+8T65oo0FtPtbe4tmukljWfVIrmXESOzRpAZV2j5MPGX+h/hv8QNM+LHw70HxTokz3GjeJdOt9VsJXjaNpbeeJZY2KsAVJR1OCMjvX5I/En4X6h+1Jo3xbvtF+H37Rj/HD4o/E57my0zWNG8U6J4KTRLS8ttPtZNWgvVh0S6tpNLs1leNkmndZxGBuUBPVv8Agpp8IPGfx1/bP1Hwv4q0HV9Q+D0PgmzsfCWk2fwqvvHNlqmpXE10t9MrJPHpmm38CpZLDNqkckSoxaIxnzSwB+mVFfmr+0T8Bbq2+NuueCfE3wk8cfGLwV8L/g5plj8JNG1fTJ9b0TVtWjjvEvrrUbko1r/aKLBpyq05MpUyNbq0kjBqWifCW+1DRf2Uvhx44+G/xR8bfBjRvAN9NqunXvhu7uF8WeLU+wpbnXLZ1/cQyLJqVwv9peXEZnBlAZI8AH2z+y5+0frvx98YfFzTNX8J2Hhy3+GvjSfwpY3lprTaimvRJa210LoqbeEwNtukR4v3gSRJFEjhQx9er5Z/4I7+B7j4cfsVafpV/wCDtc8Faq+tatqWo6fqWny2IguLrULi4NvAkqpI0FukkdvHJ5ao8cKGPcmDXk37NfwF8NfHf9qLxbqvxx+EPjDXvjHpXxLvtW0LxBqugXv9leEdIsLtpNDbTNUkCW3kPDb2zyRWcjSST3En2iEKX2AH3/RX5Q/s/wD7O/iL4yeOfhHeap8M/HunftG2PxKbxj8UfiTrfh2609NH0+3uriRtIsNTuI0S7sZ4jb2cVtYs8HkF5JAjDLN8afCbXfDHw1+OHgDRPhP8SrTR/H/x60c+Jhb+GtQuYY/C1vNpFtJdWsmxzqMl9DYvJPKjSbftdzJcOjrhwD9YK5fx78aPDHww8U+ENE1zVYrHVvHmpvo+gWnlvJLqN0lrPduihFO0LBbzOzthBtALAsoP53/th/slTfEPx9+1/wDEGD4O+IPECxfCuw0zRfDl3pct5/wm/iGSG/vTPIhLrfmzNzZQxIjSxwtHIsYDxR7dL4tfs7+B/iT+03+zMvjz4DeIPiV4L8K/DbUNGsrjWvhq+r3WpagLiwtbOPUWmiZLGNbZb27Vb54QGnO4LMNlAH6TUV5J+2BovhTXfgdJ4P8AEfgTWPH+k+KHXSbfw1pumzz21/IEZ44rl418i2tv3fzS3TJAMKpJZkRvEP8AgjX8KrrwH8ArW28b+DvFlp8XfBloPBfiDxR4msJPtGrxWM0ltbxWV3MiPPY/Z7e2uFaJRA5ut5LXBudoB9lUV8AfEn4C+Gv2ov28fiz4e/aD+EPjD4iaVd3Gk6P8N4n0C9vfDul6M1lA15qMV+AtnZXv22W681zLHeCO3iWIOAu/yu7/AGYfFX7V/wC314v/AOFyaZ4ve8sfibFdeFTZfDS/mfQtB064gmsJrHxRPP8A2bZ21wkIe5itIkvWee4Qsx2bQD7kh/an8R3/AO138SvhfbeEdBNn4G8E6b4stNem8SPHDdzX0t9DDZ3cYtD9kw+nzs0ivPiIxvsJYou9+xP+0Lf/ALWn7JHw6+J+peGv+EPufH+g2uvjR/txvvsMVygliXzjFFvzGyNny1+9jtk/HPxd1T4in4V/t9ahpPgL4lf8J34nuJtG8PTQeHLiSM6XFpFlp1nLp/G6+ffLqF4FtxJhiyNtfar/AHJ8H9E0q6+A2g6Rp+k65oWgx6RHplnY36PY39vaJH5MW5VIkhcxqpAO2RMjcEcFQAdnRX5vfsLfsXR/Ej4c+ENJ1f4Xar4T/wCFe/FHxJ4+aXWdPn0m2025bxDeXmn2OlW7hSE2LZl7tIzF9nEkUbSC4kEfC/si/s5+IPir41/Z/wBWvPht490T4/6J4pl8YfGX4leIfDl1pU0SLFd+dodrfXKKL20mnnghigsmltUt4S5KuFyAffnwF/aU1n4vftEfGfwRf+FtO0iw+FOqadplrq1prTXx1lruwjviJITbxfZpI4p7fKb5c+cDuAxu9fr8vPib8Lde+On/AAS6/aitdd+FXxFm8a+LvHPiDU59OuPD115xFzqEukWlxZ2w+fUWtNFhs7tGjjkjMiwtDumixH13jltS8fftCfHfxTr/AMHfiTr3hbQfg7p2k+B9Kn8OXrDxDbQvqGoXUUybVLzXVzBp8Daf88rxLEJ4QssiKAforRX5k/BH/gmZa/Dj4k/Abw/rXgjWvEFp8MvgXdxeNNUltnb/AITW+lGnW9toE1wy7ZbWMWt7ILIvtUGLcpWWTzOBuvAPxLs/+CfP7JPgeHwt4y8LfDmGG8ufiHYXvwy1vxGEvfsqXFtpk+hWMkGoNpourm8iUShYQ1hb745IHQuAfpP+0p+0V/wzDodp4o1vR/P+H9q4XxHrcV4BN4cjd0RLqS3KfvLVSxM0iybolG7y3UOU9MRxKgZSGVhkEHIIr4fuvgd4Z/ZF/wCCHfxd0hbfVtI0O48E+LNaubLWtMg002ZvYbyZreLT4C0VpADKEitEyUQojAyF8/UP7J+kax4e/Za+Gth4i8z/AISCx8K6Xb6n5n3vtSWkSzZ4HO8N2oA5f4y/sS+G/wBpb4vw638Sni8b+EdJ05rXRvBmo2aPo1ndSpLHc380ZyLq4eGTyozINsCGTYu6RnrqP2bfgne/s9fDtvCsvivWPFmkafdyDQpNW/e32maeQvlWUtwWLXXkneqzSfvDH5auXdWlf0CigD5u/wCCg3/BPaz/AG5b/wCHepvdeC/7R+HGpXd9a6d408Ir4s8OaktzbGCRbrTjcW290+V4pFmUxsp4IYiqPxn/AGFPG/jn4MfCTwx4a+I3g/Qrz4YeJoPFEsuoeARc6Zq0tv57WtutjZ3tktvbwyTK6KsjPm2g3OxDtJ9P0UAfKlr/AMEypPG/w/8Aj9F8RviFf+J/Gn7RXhxPCniDWtI0tdGtNK06K1ure3gsLQyztGqfbLl286aZpGlIZioCjH+Gv/BKNPDX7JXxP+E2o678PtD0r4k+FZ/Csh+HPw5tfB1vAk1vLC95NGLi4kuLlhJ82ZliI3DyxuJr7DooA+U/DX/BPLxjL8U/DXivxR8WbfVL7S/A154Evk0rwsNNQ2k72r5sN11N9i3G1QzFvPkk+XbJCI4wuN8Cf+CYvjH4PWfwDgufjDbanD8A9Kl8O6ZFb+EVtIrnTjax2qOEa7kVNQ8mII904kRlklCQQmRmr7FooA8b/bQ/ZYv/ANqPwx4L/sTxPB4S8TfDzxbZeMtEvbvTG1TT3u7aOeIRXdqs8DTQtHcSfKs0bK4jcNlBnlfjV+xl46+KU3wq8U2vxP0e2+Knwq1LUNRs9a1Lwj9t0a6+3WstrPCdOivIHVVil2xN9qMiBfmeTc+76OooA+WLP/gmPar8KdH8O3/jS81m9vPifZ/FPxvql7psZfxjf20sc6Q+UjoltCsttYKigSBYbJIyGJLjJ+K3/BLnVfi3pv7Qen3/AMUZotO+N2u2HiS0WLw+n2jQryyj0tbZJpTNm7tozpUQEKiAFLm5V2curp9e0UAfL37T37AHiX9sr9mm38H/ABH8eeFvEHiGx8T2Hii3lk8EK3hd3tGBWyuNIku3kubOQb/MjlvGYs+VdQqqHan/AME67jxN+x8nwjv/ABL4V0zSrzxLpesanB4Y8E2+haOdPtb60uptKtLGOZjBDOtqYzJLNcSATyZLrtRfp+igD5k+I/8AwT81z4h+Pv2itQ/4WXLp2kfHzwknhlLW30GP7b4dZNNlsUlW7MuZoo2nmuEiCRkSzyZkZSFWa4/YU8TeN/gT8PPBPjT4h6VrNv4J8YaL4kuE0zwqNM0+7s9J8qS002G3NzK8MYube3naSWa4JKyKAEZFj+laKAPEf2uP2TdX/aG8dfCfxZ4b8X2vhHxL8JfEU+u2D3+jHV7C9W4sLmwniltxcQHf5N1IY5BJ+7cA7XGVPkviL/gln4j1T4I+PPCEPxbWaXxZ8QrH4iWt5qfhgXam6ttTtNR8rUY0uomvVZ7OKHEUlqiwrGioCgY/ZFFAHz54q/ZA8b+MPjb8HPHF58VlfUfhta6rbaun/CMQ7dd+3y2sjtbjzdtmUS1NupZbhvInlG7zT59efab/AMErtTOoal4Y1P4lx3nwX1P4iXXxLuvCsHh3ydV1O/m1I6qLS81NrlxNZJe7JAi20crLGiPMy5B+xKKAPlf41f8ABNm7+Lvgb9oezXx5DY698edY0u8/tCbQBdW+j6fYQWMMWmSW/nqbmB/s115hEkRYX8oAUjcfpfwlpt9o3hmxtdU1JtY1GGFVur426W/2qTHzOI1+VATnC84GASTydGigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAqh4p8M2XjTwxqOj6nD9p03VrWWyu4d7J5sUiFHXcpDDKkjIIIzwav0UAZXgXwTpfw08EaP4c0O0Ww0XQLGDTdPtVdnFtbwxrHFGCxLHaiqMkk8ck1q0UUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQAUUUUAFFFFABRRRQBw/xj+AOjfHm50SHxLcale6Do15HqMmgiRF07VbmKSOW3kul2eZKIZIw6xbxEWwXRyqbe4oooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKACiiigAooooAKKKKAP//Z)