Experimental Animals
Male C57BL/6J mice were from the Department of Experimental Animals, Fudan University (Shanghai, China). The study was approved by Institutional Ethical Committee of Animal Experimentation, and all experiments were performed according to the governmental and international guidelines on animal experimentation.
Synthesis of pPB Cyclic Peptide and its derivatives
As we described previously,11 the linear octapeptide CSRNLIDC was synthesized by the Boc-protected solid-phase peptide synthesis method and cyclized by the linkage of two cysteine residues to gain cyclic peptide (pPB). Then pPB was incubated with FITC for 2 hours in the presence of triethylamine to gain FITC-labeled pPB cyclic peptide (pPB-FITC).
pPB was labeled with Gd through 1,4,7,10-Tetraazacyclododecane-1,4,7,10-tetraacetic acid (DOTA). Firstly, pPB-DOTA was prepared. Briefly, 20 mg of pPB was dissolved in 4.0 mL PBS (0.1 mol/L, pH 7.4). Maleimido-mono-amide-DOTA (20 mg) was dissolved in 1.0 mL N,N-Dimethylformamide and then added into pPB solution. After stirred for 2 hours at room temperature, the mixed solution was filtered, purified and freeze-dried to gain pPB-DOTA. Next, pPB-DOTA (60 mg) was dissolved in 20.0 mL pure water, and 32 mg of GdCl3·6H2O was dissolved in 4.0 mL pure water. Then the two kinds of solutions were mixed, and the mixed solution was raised to a PH of about 6.0 by NaOH. After being vibrated overnight at 37 °C, the mixed solution was filtered, purified and freeze-dried to gain Gd-labeled pPB cyclic peptide (pPB-DOTA-Gd).
The purity of pPB and its derivatives was examined by analytical reverse phase high performance liquid chromatography, and their molecular weight was examined by electrospray ionization mass spectrometry.
Expression of PDGFR-β on Human HSCs
Human HSC-LX2 (from Cell Bank of Chinese Academy of Sciences, Shanghai, China) were cultured in the cell medium supplemented with 5% heat-inactivated fetal bovine serum (FBS) and 1% penicillin/streptomycin in 5% CO2 humidified atmosphere at 37 °C. After cultured for 24 hours, most of the cells were verified to be activated by examining α-SMA expression with immunofluorescent cytochemistry.
After cultured for 24 hours, HSC-LX2 were fixed with 4% paraformaldehyde and permeabilized with PBS containing 0.1% Triton X-100 and 0.1 mg/mL RNase A when appropriate. Subsequently, HSC-LX2 were incubated with primary antibodies against PDGFR-β and α-SMA (both 1:200 in blocking solution, Abcam, UK) at 4 °C for overnight. After incubated with secondary antibodies (Molecular Probes, Eugene, OR) and 6-diamidino-2-phenylindole (DAPI) at room temperature for 1 hour, the slides were then photographed with a fluorescence microscope (Olympus, Japan).
Binding Characteristics of pPB Cyclic Peptide to Human HSCs
Human HSC-LX2 were incubated with the primary antibodies against α-SMA at 4 °C overnight. After the cells were incubated with Texas red-conjugated secondary antibodies (Molecular Probes), they were incubated with 1 µmol/L of pPB-FITC solution for 24 hours at 37 °C in the dark. Then the cells were rinsed and stained the nuclei with DAPI. After mounted, they were observed with a fluorescence microscope.
In order to assess the binding efficiency of pPB cyclic peptide at different concentrations and different incubation durations to HSCs, human HSC-LX2 were incubated respectively with pPB-FITC solution at concentrations of 0, 0.04, 0.2, 1, 5, 25 and 125 µmol/L for 1 hour, or with 1 µmol/L solution for 0, 15, 30, 60, 90, 120 minutes and 24 hours at 37 °C in the dark. After incubation, these cells were washed by centrifugation at 1100 rpm in 4 °C, fixed with 4% paraformaldehyde and immediately analyzed for the up-take rate by a FACS scan flow cytometer (FACSCalibur, USA) with CellQuest software (BD Biosciences).
Mice Model of Liver Fibrosis Induced by Bile Duct Ligation (BDL)
Liver fibrosis was induced in C57BL/6J mice by the ligation of common bile duct.13 One week or four weeks after the treatment, treated mice were used for further experiments (referred to as BDL-1W and BDL-4W mice). And the mice subjected to sham were used as the control group.
Mice Model of Liver Fibrosis Induced by CCl4 Treatment
Liver fibrosis was also induced in C57BL/6J mice by carbon tetrachloride (CCl4) treatment (CCl4 in olive oil, 1:9 (v/v), 2 ml/kg by intraperitoneal injection twice weekly).14 Eight weeks or twelve weeks after the treatment, treated mice were used for further experiments (referred to as CCl4-8W and CCl4-12W mice). Additionally, eight CCl4-8W mice were randomly selected to discontinue CCl4-treatment for another 4 weeks for the spontaneous regression of fibrosis (referred to as CCl4-8W + S4W mice). Mice treated with the same dosage of olive oil for 12 weeks served as the control group.
Histological Analysis of Hepatic Fibrosis
After fixed in neutralized formalin, liver sections were stained with hematoxylin and eosin or Masson. Extent of liver fibrosis was semi-quantitatively scored according to the Isake staging criteria.15 For a morphometric analysis of liver fibrosis, the Masson staining (fibrotic) areas were measured as previously described.16
In addition, serum alanine aminotransferase (ALT) levels and liver hydroxyproline content were determined using assay kits (JianCheng, Nanjing, China).
Quantitative real-time PCR (qRT-PCR) analysis
The hepatic mRNA level of PDGFR-β was quantitated using qRT-PCR analysis as described.16 The forward primer for PDGFR-β was AATATAAGAGGAAGAGTTG, and the reverse primer was TATACCCAAGGATTTCTA. GAPDH was used as the control, and its forward primer was TCCCTCAAGATTGTCAGCAA, and the reverse primer was AGATCCACAACGGATACATT.
Immunohistochemistry Analysis
After washed by PBS, liver sections were performed heat mediated antigen retrieval in sodium citrate buffer (pH 6.0) by using microwave. After cooled and blocked with 10% serum for 1 hour, the sections were incubated with rabbit anti-mouse PDGFR-β antibody (1:100 in blocking solution, Millipore, Massachusetts, USA) overnight at 4 °C. A Biotin conjugated goat polyclonal anti-rabbit IgG (1:100 in blocking solution, Abcam) was used as secondary antibody. Ten fields (200×) from each section were randomly selected and recorded. The PDGFR-β positive-staining areas were respectively quantified with NIN Image 1.62 software, and the percentage of positive-staining areas in each field was calculated.
Immunofluorescent Co-localization of PDGFR-β in Various Cells of Fibrotic Livers
Immunofluorescent staining was performed to reveal the co-localization of PDGFR-β with α-SMA (activated HSCs), CD31 (vascular endothelial cells), CD68 (macrophages) and CD163 (Kupffer cells) in the liver sections as previously described.16 Primary antibodies against PDGFR-β (1:100; Abcam), monoclonal anti-SMA (1:200; Abcam), monoclonal anti-CD31 (1:100; Abcam), monoclonal anti-CD68 (1:00; Abcam) and monoclonal anti-CD163 (1:00; Abcam) were used. Secondary antibodies included Alexa Fluor 594-conjugated IgG (1:200, Jackson, Pennsylvania, USA) and Alexa Fluor 488-conjugated IgG (1:200, Jackson). Multicolored fluorescent staining of liver sections was analyzed, and the percentage of the merged yellow color region to the total PDGFR-β-stained green region in each section was calculated. Ten randomly selected amplifying fields (400×) in each section were assessed.
In Vivo MRI Studies
MR imaging was performed by using a Biospec 70/20 MRI scanner (7.0 T) to assess the accumulation of pPB-DOTA-Gd in livers after the control mice and CCl4-treated mice (n = 3 per group) were injected intravenously with pPB-DOTA-Gd at a dose of 0.05 mmol/kg [Gd3+] in a total of 0.25 mL PBS solution, as previously described.17 Briefly, dynamic T1-weighed MR images of the liver were collected prior to and 30, 60, 90 and 120minutes after pPB-DOTA-Gd was injection. Coronal section images of the liver were acquired with a fast low-angle shot (FLASH) sequence. Hepatic signal intensity (T1 (liver)) and muscle signal intensity (T1 (muscle)) were measured from the region of interest and the relative hepatic signal intensity was denoted as T1 (liver) / T1 (muscle).
Statistical Analysis
Data were presented as the mean ± standard deviation (SD) and analyzed by a one-way analysis of variance followed with least significant difference (LSD) test. SPSS 16.0 statistical software (Chicago, USA) was used. A p value less than 0.05 was considered statistically significant.