See the published version of this preprint at Rice.
This is a preprint, a preliminary version of a manuscript that has not completed peer review at a journal. Research Square does not conduct peer review prior to posting preprints. The posting of a preprint on this server should not be interpreted as an endorsement of its validity or suitability for dissemination as established information or for guiding clinical practice.
Learn more about In Review
A new preprint design is coming!
We have improved readability, clarity, accessibility, and opportunities for engagement.
Original article
Zhongming Fang
Wuhan Institute of Bioengineering
Corresponding Author
ORCiD: https://orcid.org/0000-0002-5478-8978
License:
This work is licensed under a CC BY 4.0 License. Read Full License
Background: Amino acids, which are transported by amino acid transporters, are the major forms of organic nitrogen utilized by higher plants. Among the 19 Amino Acid Permease transporters (AAPs) in rice, only a small number of these genes have been reported to influence rice growth and development. However, whether other OsAAPs are responsible for rice growth and development is unclear.
Results: In this study, we demonstrate that OsAAP4 promoter sequences are divergent between Indica and Japonica, with higher expression in the former, which produces more tillers and higher grain yield than does Japonica. Overexpression of two different splicing variants of OsAAP4 in Japonica ZH11 significantly increased rice tillering and grain yield as result of enhancing the neutral amino acid concentrations of Val, Pro, Thr and Leu. OsAAP4 RNA interference (RNAi) and mutant lines displayed opposite trends compared with overexpresing (OE) lines. In addition, exogenous Val or Pro at 0.5 mM significantly promoted the bud outgrowth of lines overexpressing an OsAAP4a splicing variant compared with ZH11, and exogenous Val or Pro at 2.0 mM significantly enhanced the bud outgrowth of lines overexpressing splicing variant OsAAP4b compared with ZH11. Of note, the results of a protoplast amino acid-uptake assay showed that Val or Pro at different concentrations was specifically transported and accumulated in these overexpressing lines. Transcriptome analysis further demonstrated that OsAAP4 may affect nitrogen transport and metabolism, and auxin, cytokinin signaling in regulating rice tillering.
Conclusion: Our results suggested that OsAAP4 contributes to rice tiller and grain yield by regulating neutral amino acid allocation through two different splicing variants and that OsAAP4 might have potential applications in rice breeding.
Keywords
amino acid, transporter, rice, tiller, outgrowth bud, grain yield, splicing variants
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
This is a list of supplementary files associated with this preprint. Click to download.
- Supplementaryfile1FigureS1.tif
Additional file 1: Figure S1. Expression levels of OsAAP4 in young seedling root (a), basal part (b), old leaf (c), young leaf (d) between Hap2 and Hap5 of five individual varieties. The primers used for quantifying OsAAP4 expression was F: GACATCGTCCACAACCTCAAGGCT, and R: GCCACAGCTCTAGCTAGGCAGC. Values are means ± s.d. (n=3).
- Supplementaryfile2FigureS2.docx
Additional file 2: Figure S2. Sequencing of two different types of promoter sequences of OsAAP4. NIP indicates Nipponbare, C172 indicates the Hap5 type in Japonica. W144 indicates the Hap2 type in Indica.
- Supplementaryfile3FigureS3.tif
Additional file 3: Figure S3. Expression levels of OsAAP4a (a) and OsAAP4b (b) in young seedling basal part between Hap2 and Hap5 of five individual varieties. The primers used for quantifying OsAAP4a expression was F: TGGCACTCACCCTTGCACAC, and R: CCGTCCACACCGTCCCTTGT, for quantifying OsAAP4b expression was ACTTGAGCTCTCTGCATTGGGT, and R: AGCGGTAGCAATTGGCGAGGA. Values are means ± s.d. (n=3).
- Supplementaryfile4FigureS4.tif
Additional file 4: Figure S4. Subcellular localization of OsAAP4. (a-e) Localization of the 35S promoter-driven GFP as the control in rice protoplasts. (f-j) Localization of the OsAAP4a-GFP in rice protoplasts. (k-o) Localization of the OsAAP4b-GFP in rice protoplasts. (p-s) Localization of OsAAP4a-GFP in tobacco pavement cells. (t-w) Localization of OsAAP4b-GFP in tobacco pavement cells. Green, GFP signal. Blue, DAPI (a nuclear marker) signal. Red, FM4-64 (a lipophilic membrane marker) signal. DIC, bright field. Scale bars represent 5 μm in (a-o) and 25 μm (p-w).
- Supplementaryfile5FigureS5.tif
Additional file 5: Figure S5. Knockout of OsAAP4 significantly decreased NUtE in rice Japonica ZH11 using CRISPR technology. a Sequencing results of the base addition of OsAAP4-CRISPR in Japonica ZH11 with CRISPR technology. Whole-plant phenotype (b) and grain yield per plant (c) of ZH11 and OsAAP4-CRISPR lines in the ZH11 background. Quantification of tiller number per plant (d), filled grain yield per plant (e), grain yield per plant (f), and NUtE (g) of ZH11 and OsAAP4-CRISPR lines. The letters above the error bars are ranked by the T test, “***” indicates a significant difference at p<0.001. Scale bars, 5.0 cm (b), 3.0 cm (c). Values are means ± s.d. (n>20).
- Supplementaryfile6FigureS6.tif
Additional file 6: Figure S6. Total free amino acid concentration of basal parts at seedlings stage and straw at filling stage. OEa, OEb, and Ri indicated that mixed equal-amount which extracted from each three OEa, OEb, and Ri lines, respectively. The letters above the error bars are ranked by the T test, “*” indicates a significant difference at p<0.05, and “**” indicates a significant difference at p<0.01. Values are means ± s.d. (n=3).
- Supplementaryfile7FigureS7.tif
Additional file 7: Figure S7. Effect of different concentrations of Val and Pro on the growth of ZH11, OEa, OEb, and Ri lines grown in hydroponic culture. Phenotypes of seedlings among ZH11, OEa, OEb, and Ri lines grown with 1.0 mM NH4NO3 and Val 0.5 mM (a), Val 2.0 mM (b), Pro 0.5 mM (c), and Pro 2.0 mM (d). Quantification of plant height (e) and biomass (f) under Val 0.5 mM and Val 2.0 mM treatment. Quantification of plant height (g) and biomass (h) under Pro 0.5 mM and Pro 2.0 mM treatment. The letters above the error bars are ranked by the T test, “*” indicates a significant difference at p<0.05, “**” indicates a significant difference at p<0.01, and “***” indicates a significant difference at p<0.001. Scale bar, 10.0 cm (a-d). Values are means ± s.d. (n>15).
- Supplementaryfile8FigureS8.tif
Additional file 8: Figure S8. Protoplast amino acid-uptake assay among ZH11, OEa, OEb, and Ri lines. Fluorescence was detected after culturing protoplasts with FITC-labeled amino acids for four hours. Green fluorescence images of ZH11 and OEa, OEb and Ri lines under treatment with 0.5 mM Arg-FITC (a), 0.5 mM Lys-FITC (b), 0.5 mM Thr-FITC (c), and 0.5 mM Leu-FITC (d). e Detection of cell fluorescence signal intensity in (a-d). Fluorescence intensities were normalized to the area of the respective cell by ImageJ software, and a total of 100 cells were statistically analyzed. Scale bars, 5.0 μm (a-d). The letters above the error bars are ranked by the T test, “*” indicates a significant difference at p<0.05, “**” indicates a significant difference at p<0.01, and “***” indicates a significant difference at p<0.001. Values are means ± s.d. (n=3).
- Supplementaryfile9FigureS9.tif
Additional file 9: Figure S9. KEGG enrichment analysis of the DEGs in the axillary buds of genes that are respectively regulated by OEa lines (a), OEb lines (b) compared with the wild-type ZH11. Gene ratio indicates that the ratio of the DEG number and the number of genes has been annotated in this pathway.
- Supplementaryfile10FigureS10.tif
Additional file 10: Figure S10. KEGG enrichment analysis of the DEGs in the axillary buds of genes that are jointly regulated by OEa and OEb lines compared with the wild-type ZH11. Gene ratio indicates that the ratio of the DEG number and the number of genes has been annotated in this pathway.
- Supplementaryfile11FigureS11.tif
Additional file 11: Figure S11. Heatmap visualization of expression profiles of DEGs in OsAAPs regulated by OsAAP4 OEa and OEb lines compared with the wild-type ZH11. Red boxes show up-regulation, and green boxes show down-regulation. “*” indicates a significant difference at P-value <0.05 and fold change >2.
- Supplementaryfile12FigureS12.tif
Additional file 12: Figure S12. The expression of OsAAP4 in basal part of OsAAP3 and OsAAP5 transgenic plants. The primers used for quantifying OsAAP4 expression was F: GACATCGTCCACAACCTCAAGGCT, and R: GCCACAGCTCTAGCTAGGCAGC. The letters above the error bars are ranked by the T test, “***” indicates a significant difference at p<0.001. Values are means ±SD (n=3).
- Supplementaryfile13TableS1.docx
Additional file 13: Table S1. List of the primers in this study.
Loading...
Badges
Prescreen
This manuscript passed our Prescreen assessment
Complete author information
Appropriate declaration statements
Potential risks to human health
Prescreen
Peer Review Timeline
CURRENT STATUS: Published
View the published article at Rice.
No community comments so far
Editorial decision: Accept
On 01 Dec, 2020
Editor assigned
On 30 Nov, 2020
Submission checks complete
On 30 Nov, 2020
Editor invited
On 30 Nov, 2020
Version 2
Posted 05 Nov, 2020
No comments provided
Editorial decision: Minor revision
On 11 Nov, 2020
Review #2 received
Received 08 Nov, 2020
Review #1 received
Received 08 Nov, 2020
Reviewer #2 agreed
On 27 Oct, 2020
Editor assigned
On 27 Oct, 2020
Reviewers invited
Invitations sent on 27 Oct, 2020
Reviewer #1 agreed
On 27 Oct, 2020
Submission checks complete
On 27 Oct, 2020
Editor invited
On 27 Oct, 2020
No comments provided
Editorial decision: Major revision
On 01 Sep, 2020
Review #1 received
Received 30 Aug, 2020
Review #2 received
Received 30 Aug, 2020
Reviewer #2 agreed
On 09 Aug, 2020
Reviewers invited
Invitations sent on 08 Aug, 2020
Reviewer #1 agreed
On 08 Aug, 2020
Editor assigned
On 07 Aug, 2020
First submitted
On 06 Aug, 2020
Submission checks complete
On 06 Aug, 2020
Editor invited
On 06 Aug, 2020
Metrics
Comments: 0
PDF Downloads: ...
HTML Views: ...
Learn more about our company.
A new preprint design is coming!
We have improved readability, clarity, accessibility, and opportunities for engagement.
See the published version of this preprint at Rice.
This is a preprint, a preliminary version of a manuscript that has not completed peer review at a journal. Research Square does not conduct peer review prior to posting preprints. The posting of a preprint on this server should not be interpreted as an endorsement of its validity or suitability for dissemination as established information or for guiding clinical practice.
Learn more about In Review
Original article
Zhongming Fang
Wuhan Institute of Bioengineering
Corresponding Author
ORCiD: https://orcid.org/0000-0002-5478-8978
Badges
Prescreen
This manuscript passed our Prescreen assessment
Complete author information
Appropriate declaration statements
Potential risks to human health
Prescreen
Peer Review Timeline
CURRENT STATUS: Published
View the published article at Rice.
No community comments so far
Editorial decision: Accept
On 01 Dec, 2020
Editor assigned
On 30 Nov, 2020
Submission checks complete
On 30 Nov, 2020
Editor invited
On 30 Nov, 2020
Version 2
Posted 05 Nov, 2020
No comments provided
Editorial decision: Minor revision
On 11 Nov, 2020
Review #2 received
Received 08 Nov, 2020
Review #1 received
Received 08 Nov, 2020
Reviewer #2 agreed
On 27 Oct, 2020
Editor assigned
On 27 Oct, 2020
Reviewers invited
Invitations sent on 27 Oct, 2020
Reviewer #1 agreed
On 27 Oct, 2020
Submission checks complete
On 27 Oct, 2020
Editor invited
On 27 Oct, 2020
No comments provided
Editorial decision: Major revision
On 01 Sep, 2020
Review #1 received
Received 30 Aug, 2020
Review #2 received
Received 30 Aug, 2020
Reviewer #2 agreed
On 09 Aug, 2020
Reviewers invited
Invitations sent on 08 Aug, 2020
Reviewer #1 agreed
On 08 Aug, 2020
Editor assigned
On 07 Aug, 2020
First submitted
On 06 Aug, 2020
Submission checks complete
On 06 Aug, 2020
Editor invited
On 06 Aug, 2020
Metrics
Comments: 0
PDF Downloads: ...
HTML Views: ...
License:
This work is licensed under a CC BY 4.0 License. Read Full License
View the published article at Rice.
Background: Amino acids, which are transported by amino acid transporters, are the major forms of organic nitrogen utilized by higher plants. Among the 19 Amino Acid Permease transporters (AAPs) in rice, only a small number of these genes have been reported to influence rice growth and development. However, whether other OsAAPs are responsible for rice growth and development is unclear.
Results: In this study, we demonstrate that OsAAP4 promoter sequences are divergent between Indica and Japonica, with higher expression in the former, which produces more tillers and higher grain yield than does Japonica. Overexpression of two different splicing variants of OsAAP4 in Japonica ZH11 significantly increased rice tillering and grain yield as result of enhancing the neutral amino acid concentrations of Val, Pro, Thr and Leu. OsAAP4 RNA interference (RNAi) and mutant lines displayed opposite trends compared with overexpresing (OE) lines. In addition, exogenous Val or Pro at 0.5 mM significantly promoted the bud outgrowth of lines overexpressing an OsAAP4a splicing variant compared with ZH11, and exogenous Val or Pro at 2.0 mM significantly enhanced the bud outgrowth of lines overexpressing splicing variant OsAAP4b compared with ZH11. Of note, the results of a protoplast amino acid-uptake assay showed that Val or Pro at different concentrations was specifically transported and accumulated in these overexpressing lines. Transcriptome analysis further demonstrated that OsAAP4 may affect nitrogen transport and metabolism, and auxin, cytokinin signaling in regulating rice tillering.
Conclusion: Our results suggested that OsAAP4 contributes to rice tiller and grain yield by regulating neutral amino acid allocation through two different splicing variants and that OsAAP4 might have potential applications in rice breeding.
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
This is a list of supplementary files associated with this preprint. Click to download.
- Supplementaryfile1FigureS1.tif
Additional file 1: Figure S1. Expression levels of OsAAP4 in young seedling root (a), basal part (b), old leaf (c), young leaf (d) between Hap2 and Hap5 of five individual varieties. The primers used for quantifying OsAAP4 expression was F: GACATCGTCCACAACCTCAAGGCT, and R: GCCACAGCTCTAGCTAGGCAGC. Values are means ± s.d. (n=3).
- Supplementaryfile2FigureS2.docx
Additional file 2: Figure S2. Sequencing of two different types of promoter sequences of OsAAP4. NIP indicates Nipponbare, C172 indicates the Hap5 type in Japonica. W144 indicates the Hap2 type in Indica.
- Supplementaryfile3FigureS3.tif
Additional file 3: Figure S3. Expression levels of OsAAP4a (a) and OsAAP4b (b) in young seedling basal part between Hap2 and Hap5 of five individual varieties. The primers used for quantifying OsAAP4a expression was F: TGGCACTCACCCTTGCACAC, and R: CCGTCCACACCGTCCCTTGT, for quantifying OsAAP4b expression was ACTTGAGCTCTCTGCATTGGGT, and R: AGCGGTAGCAATTGGCGAGGA. Values are means ± s.d. (n=3).
- Supplementaryfile4FigureS4.tif
Additional file 4: Figure S4. Subcellular localization of OsAAP4. (a-e) Localization of the 35S promoter-driven GFP as the control in rice protoplasts. (f-j) Localization of the OsAAP4a-GFP in rice protoplasts. (k-o) Localization of the OsAAP4b-GFP in rice protoplasts. (p-s) Localization of OsAAP4a-GFP in tobacco pavement cells. (t-w) Localization of OsAAP4b-GFP in tobacco pavement cells. Green, GFP signal. Blue, DAPI (a nuclear marker) signal. Red, FM4-64 (a lipophilic membrane marker) signal. DIC, bright field. Scale bars represent 5 μm in (a-o) and 25 μm (p-w).
- Supplementaryfile5FigureS5.tif
Additional file 5: Figure S5. Knockout of OsAAP4 significantly decreased NUtE in rice Japonica ZH11 using CRISPR technology. a Sequencing results of the base addition of OsAAP4-CRISPR in Japonica ZH11 with CRISPR technology. Whole-plant phenotype (b) and grain yield per plant (c) of ZH11 and OsAAP4-CRISPR lines in the ZH11 background. Quantification of tiller number per plant (d), filled grain yield per plant (e), grain yield per plant (f), and NUtE (g) of ZH11 and OsAAP4-CRISPR lines. The letters above the error bars are ranked by the T test, “***” indicates a significant difference at p<0.001. Scale bars, 5.0 cm (b), 3.0 cm (c). Values are means ± s.d. (n>20).
- Supplementaryfile6FigureS6.tif
Additional file 6: Figure S6. Total free amino acid concentration of basal parts at seedlings stage and straw at filling stage. OEa, OEb, and Ri indicated that mixed equal-amount which extracted from each three OEa, OEb, and Ri lines, respectively. The letters above the error bars are ranked by the T test, “*” indicates a significant difference at p<0.05, and “**” indicates a significant difference at p<0.01. Values are means ± s.d. (n=3).
- Supplementaryfile7FigureS7.tif
Additional file 7: Figure S7. Effect of different concentrations of Val and Pro on the growth of ZH11, OEa, OEb, and Ri lines grown in hydroponic culture. Phenotypes of seedlings among ZH11, OEa, OEb, and Ri lines grown with 1.0 mM NH4NO3 and Val 0.5 mM (a), Val 2.0 mM (b), Pro 0.5 mM (c), and Pro 2.0 mM (d). Quantification of plant height (e) and biomass (f) under Val 0.5 mM and Val 2.0 mM treatment. Quantification of plant height (g) and biomass (h) under Pro 0.5 mM and Pro 2.0 mM treatment. The letters above the error bars are ranked by the T test, “*” indicates a significant difference at p<0.05, “**” indicates a significant difference at p<0.01, and “***” indicates a significant difference at p<0.001. Scale bar, 10.0 cm (a-d). Values are means ± s.d. (n>15).
- Supplementaryfile8FigureS8.tif
Additional file 8: Figure S8. Protoplast amino acid-uptake assay among ZH11, OEa, OEb, and Ri lines. Fluorescence was detected after culturing protoplasts with FITC-labeled amino acids for four hours. Green fluorescence images of ZH11 and OEa, OEb and Ri lines under treatment with 0.5 mM Arg-FITC (a), 0.5 mM Lys-FITC (b), 0.5 mM Thr-FITC (c), and 0.5 mM Leu-FITC (d). e Detection of cell fluorescence signal intensity in (a-d). Fluorescence intensities were normalized to the area of the respective cell by ImageJ software, and a total of 100 cells were statistically analyzed. Scale bars, 5.0 μm (a-d). The letters above the error bars are ranked by the T test, “*” indicates a significant difference at p<0.05, “**” indicates a significant difference at p<0.01, and “***” indicates a significant difference at p<0.001. Values are means ± s.d. (n=3).
- Supplementaryfile9FigureS9.tif
Additional file 9: Figure S9. KEGG enrichment analysis of the DEGs in the axillary buds of genes that are respectively regulated by OEa lines (a), OEb lines (b) compared with the wild-type ZH11. Gene ratio indicates that the ratio of the DEG number and the number of genes has been annotated in this pathway.
- Supplementaryfile10FigureS10.tif
Additional file 10: Figure S10. KEGG enrichment analysis of the DEGs in the axillary buds of genes that are jointly regulated by OEa and OEb lines compared with the wild-type ZH11. Gene ratio indicates that the ratio of the DEG number and the number of genes has been annotated in this pathway.
- Supplementaryfile11FigureS11.tif
Additional file 11: Figure S11. Heatmap visualization of expression profiles of DEGs in OsAAPs regulated by OsAAP4 OEa and OEb lines compared with the wild-type ZH11. Red boxes show up-regulation, and green boxes show down-regulation. “*” indicates a significant difference at P-value <0.05 and fold change >2.
- Supplementaryfile12FigureS12.tif
Additional file 12: Figure S12. The expression of OsAAP4 in basal part of OsAAP3 and OsAAP5 transgenic plants. The primers used for quantifying OsAAP4 expression was F: GACATCGTCCACAACCTCAAGGCT, and R: GCCACAGCTCTAGCTAGGCAGC. The letters above the error bars are ranked by the T test, “***” indicates a significant difference at p<0.001. Values are means ±SD (n=3).
- Supplementaryfile13TableS1.docx
Additional file 13: Table S1. List of the primers in this study.
Loading...