Animals
Eighteen male New Zealand white rabbits were used in this study (2.5–3kg, 3–4 months old). Before the study, all rabbits were examined for general health. AMSCs and BMSCs were collected from six rabbits. The rest rabbits were randomly allocated to either the scramble group or the short hair RNA (shRNA) group. In the following experiment, a commercial animal cage (49 cm×35 cm×32 cm) with free access to water and food was used for each rabbit which was housed in an animal room kept at room temperature and a 12 h:12 h light-dark cycle. This study was conducted according to the Guideline of Animal Care and Use Committee of the Fourth Military Medical University and was approved by the Ethics Committees of the Fourth Military Medical University. All efforts were made to minimize the number and the discomfort of the rabbits.
Isolation and culture of AMSCs and BMSCs
AMSCs and BMSCs were isolated and cultured according to our previous study [15]. Briefly, AMSCs from the inguinal adipose tissue were collected and digested by type I collagenase (0.2%, Sigma, USA), filtered by 200-mesh sieve, centrifuged at 350 x g for 5 min, resuspended in DME/F12 complete medium containing 15% fetal bovine serum (FBS, Gibco, USA) and 1% penicillin/streptomycin/amphotericin B (Cellmaxin plus, Gendepot, USA), and plated onto 10-cm cell culture dishes at 37 °C with 5% CO2. BMSCs were isolated from bone marrow of the femora which was flushed out with the DME/F12 complete medium. After repetitively pipetting, the bone marrow was plated onto 10-cm cell culture dishes at 37 °C with 5% CO2. The medium was changed every 2 days and the cells (passage 0, P0) were subcultured when 80-90% confluence was reached. The P3 cells were used in the experiment.
In hypoxic condition described in our previous study [15], MSCs were cultured in DME/F12 complete medium for 7 consecutive days in a tri-gas incubator maintained 1% O2, 5% CO2, and 94% N2 (MCO-5M, SANYO, Japan). Whereas in Tgf-β1 induction, MSCs were cultured in complete medium containing 10ng/ml Tgf-β1 (Sigma, USA) for 7 consecutive days. The complete medium was changed every 2 days.
Flow Cytometry
To confirm surface marker of MSCs, flow cytometry analysis was applied according to the manufacturer’s instructions. 1×106 cells at P3 in the logarithm growth period were collected. After washing with 1% pre-cooled FBS/PBS and centrifuging at 350 x g for 5 min, these cells were incubated with anti-CD45-APC (Invitrogen, USA), anti-CD29-FITC (Invitrogen, USA), and anti-CD44-APC (Novus Biologicals, USA) in the dark at 4 °C for 30 min, respectively. Labeled cells were washed twice and examined using the FACScan flow cytometry system (BD, Franklin Lakes, USA). FlowJo software (TreeStar, Ashland, OR, USA) was used to analyze the data. PBS solution was used as negative control.
Immunofluorescence staining
3.5-cm laser confocal dishes were used to culture and fix MSCs when cells reached 60% confluence. After blocking with Immunol Staining Blocking Buffer (containing Triton X‑100 for permeabilization; Beyotime, China) for 1 h, the cells were incubated with Mkx (1:200, Aviva Systems Biology, San Diego, USA) and Tnmd (1:400, Bioss, Beijing, China) primary antibodies solution overnight at 4°C. After washing 3 times with PBS, the cells were incubated with Cy3-goat anti-rabbit IgG (Beijing ComWin Biotech Co., Ltd. China) at room temperature for 1 h in dark place. For counterstaining, DAPI was used for 5 min to visualize cell nuclei. The prepared samples were examined under laser scanning confocal microscope (Nikon A1R, Japan). The images (each sample for at least 3 fields) were analyzed with Image Pro Plus version 6.0 (Media Cybernetics, Inc) as described previously [15]. The average optical density (AOD) was equal to integrated optical density over area. For CD molecular identification, the cells were blocked with normal goat serum and incubated with the following antibodies: CD45-APC (Invitrogen, USA), CD29-FITC (Invitrogen, USA) and CD90-FITC (BioLegend, USA) overnight at 4 °C in dark place.
Multipotent Differentiation
The differentiation potential of AMSCs and BMSCs towards the chondrogenic, adipogenic and osteogenic lineages was assessed as described previously [15]. Briefly, 3×105 MSCs were collected and centrifuged to be a pellet which was cultured in chondrogenic induction medium in the 15-mL tube for 28 days. 2×104 cells/cm2 were seeded in 6-well plates, first cultured in DME/F12 complete medium and then cultured in adipogenic induction medium A for 72 h and finally cultured in adipogenic induction medium B for 24 h. The cells were cultured in turn in adipogenic induction medium A and B and were stained after repeating 5 times. For osteogenic differentiation, 2×104 cells/cm2 were seeded and cultured in DME/F12 complete medium in 6-well plates which were covered by 0.1% gelatin. The culture medium was changed with osteogenic induction medium after the cells were reached 70% confluence. Alcian Blue 8GX solution, Oil Red O solution and Alizarin Red solution were used for chondrogenic, adipogenic and osteogenic staining, respectively.
Cell counting kit‑8 (CCK-8) assay
AMSCs and BMSCs were seeded in 96-well plates at a density of 2×103 cells/well, respectively, and cultured in the DME/F12 complete medium at 37˚C for 7 consecutive days under normoxia condition and hypoxia condition. The culture medium was changed every 2 days. After the addition of 10μl CCK-8 assay solution (Dojindo, Japan) in each well and the incubation for 1 h, the optical density (OD) value was measured using an Infinite M200 Pro Multifunctional microplate reader (Tecan (Shanghai) Trading Co., Ltd., China) at a wavelength of 450 nm.
Colony formation unit assay
AMSCs (500 cells/well) and BMSCs (1000 cells/well) were seeded into 6-well plates, respectively, and cultured at 37˚C under normoxia condition and hypoxia condition. The culture medium was changed every 3 days. After 7 days, the cells were washed twice with PBS, fixed in 4% methanol for 15 min, stained with 1% crystal violet dye (Sigma, USA) for 30 min at room temperature and washed with PBS. The images of 6-well plates were captured to count the colonies.
Quantitative real-time polymerase chain reaction (qRT-PCR)
The mRNA levels of Mkx and other tendon-specific genes were measured with qRT-PCR using the same condition as described previously [15]. Total RNA was extracted according to the manufacturer's protocol using RNAiso plus (TaKaRa, Japan). qRT-PCR analysis was conducted using the CFX96 Real-Time PCR Detection System (Rotor-Gene Q 2plex, Germany). The primer sequences of Mkx synthesized by Sangon Biotech Co., Ltd. (Shanghai, China) were: forward: CCAGAGTGCGTGTGCTACAG; reverse: AAATGCTACCACAGGGCTGC. Other primer sequences of tendon-specific genes were same to our previous report [15]. Specificity of primers was examined by the melting curve. Data were collected from at least five independent samples and were tested at least three times. The expression levels of tendon-specific genes relative to β-actin were determined using the 2−ΔΔCT method.
Western blot
The protein expression of Mkx and other tendon-specific genes were measured with Western blot using the same condition as described previously [15]. Proteins were extracted using RIPA Lysis Buffer (Shanghai Weiao Biotechnology Co., Ltd., China). BCA protein reagent kit (Beijing Solarbio Science & Technology Co., Ltd., China) was used to measure the concentration. 30 μg proteins were run on SDS-PAGE gels (8%) and transferred onto a polyvinylidene difluoride (PVDF) membrane. The PVDF membranes were blocked with 10% skim milk at room temperature for 1 h and were incubated with anti-Mkx (1:200, Aviva Systems Biology, San Diego, USA), anti- Col-1a1 (1:400, Bioss, Beijing, China), anti-Collagen type III (Col-3a1, 1:400, Bioss, Beijing, China), anti-Dcn (1:400, Bioss, Beijing, China), and anti-Tnmd (1:400, Bioss, Beijing, China) primary antibodies solution and anti-β-Actin (1:1000, BOSTER Biological Technology Co., Ltd, China) primary antibody solution overnight at 4 °C. After reacting with horseradish peroxidase-conjugated goat anti-rabbit secondary antibody or goat anti‑mouse secondary antibody (BOSTER Biological Technology Co., Ltd, China) for 1 h at room temperature, proteins were detected with ECL hypersensitive chemiluminescence kit (Shanghai Weiao Biotechnology Co., Ltd., China) according to the manufacturer’s recommendations.
RNA interference
After culturing in 6-well plates for 24 h, BMSCs were transfected with 100 nmol/L Mkx-specific small interfering RNA (siRNA, Guangzhou RiboBio Co., Ltd., China) or scrambled siRNA (negative control) using lipofectamine 3000 reagent (Invitrogen, USA) according to the manufacturer's instruction. The siRNA sequence was 5'‑GCAGCTTGTTGAACCGCTA‑3'. Cells were collected 72 h after transfection and analyzed for mRNA expression by qRT-PCR and protein expression by Western blot.
Construction of lentiviral vectors and stable infection
To stably knock down the expression of Mkx, a specific lentiviral vector (Hanbio Biotechnology Co., Ltd., Shanghai, China) containing green fluorescent protein (GFP) and stably expressed Mkx-specific shRNA was constructed with the same sequence used in siRNA. The scramble sequence was 5'‑TTCTCCGAACGTGTCACGTAA‑3' (Hanbio Biotechnology Co., Ltd., Shanghai, China). BMSCs were cultured in 6-well plates for 24 h and were transduced with lentiviral particles using 8 μg/ml polybrene at a multiplicity of infection of 50 according to the manufacturer’s instructions. The expression of GFP was observed at 72 h after transduction using a fluorescence microscope (Olympus, Japan). Cells were cultured in complete medium containing 2 μg/ml puromycin (Solarbio, China) for selection.
Tendon Injury Model
Bilateral patellar tendon injury model was established in the scramble group or the shRNA group following a protocol previously described [15]. Briefly, after making a longitudinal skin incision over the patellar tendon and the removal of subcutaneous fascia, the middle part of the patellar tendon was transversely severed. 50 μl PBS containing hypoxic BMSCs (1×106) transduced with Mkx-scramble or Mkx-shRNA was injected into the wound gap followed by suturing the subcutaneous fascia and the skin. The rabbits were replaced to their own cages with plaster casts on bilateral legs after the operation, and were given an intramuscular injection of cefazolin sodium (0.1 g/kg, q.d) for 3 consecutive days. The plaster casts were removed after 3 weeks of immobilization.
Histological analysis
Rabbits were suffocated at 4 weeks after surgery for histological analysis. According to our previously described protocol [15], after the repaired patellar tendons were harvested, the staining of hematoxylin and eosin (H&E), masson’s trichrome and immunohistochemistry (IHC) for Col-1a1 and Tnmd were performed and the histological scores of H&E and IHC were evaluated. For frozen sections, the repaired patellar tendons were fixed and embedded with OCT compound and were sectioned using thermostatic freezing slicer (CryoStar NX50, Thermo).
Biomechanical Testing
Rabbits were suffocated at 4 weeks after surgery for biomechanical analysis as described in our previous study [15]. The patella-patellar tendon-tibial tubercle was harvested. After measuring the length and width of the patellar tendon, the patella and the tibial tubercle were fixed on aluminum clamps of a biomechanical testing machine (SPL-10 KN, Shimadzu, Japan). The patellar tendon was loaded until failure along the vertical axis at a displacement rate of 10 cm/min. The maximum load to failure, stiffness at failure, maximum stress, cross-sectional area, and elastic modulus were calculated.
Transmission electron microscopy (TEM) analysis
The preparation of samples and the analysis of TEM sections were conducted following our previous protocol [15]. Briefly, after fixing, the samples were dehydrated, infiltrated and embedded with absolute embedding medium. Three sections, obtained using ultramicrotome (Leica Leica UC7, Germany) from each sample with a thickness of 60 μm, were stained. The cleanest section was chose for TEM analysis (Hitachi HT7700, Japan). The software-Image Pro Plus version 6.0 (Media Cybernetics, Inc) was applied to measure the fiber diameter.
Statistical analysis
SPSS version 16.0 was applied in this study. Homogenous variances and normal distribution of data were examined using the Levene’s test and the Shapiro-Wilk test, respectively. All data were presented as the mean ± standard deviation (SD). Independent-samples t-test was used and P < 0.05 was considered to be statistically significant.