Animals
Adult male Wistar rats (3–4) months old (220–310 g) were procured from the Animal Breeding House of Faculty of Pharmacy of TUMS. Animals were kept according to the animal standard care facility under controlled temperature (23 ± 10C), 12 h light/dark cycle, 55± 10% humidity and ad libitum feed. The protocol of the study was approved by the institute ethical committee under code number IR.TUMS.VCR.REC.1396.2341 and Reporting of in Vivo Experiments (ARRIVE) Guideline.
Reagents
For High mobility group box 1 (HMGB1) and TNF-α, ELISA kits were procured from ZellBio GmbH (Ulm, Germany) and Diaclone (France), respectively. Lactate isolation kit we used was produced from ZellBio GmbH (Ulm, Germany). RNase solution, iScript cDNA synthesis kit, and propidium iodide were manufactured by Sigma-Aldrich GmbH (Munich, Germany). Other chemicals not specifically mentioned were all purchased from Sigma-Aldrich GmbH ( Munich, Germany).
Animal groups
Eighteen rats were randomly allocated into 3 groups consisting of:
Group 1 (n=6); Sham group (which underwent exactly the same operation without the CLP procedure)
Group 2 (n=6); CLP group with G-18 (which underwent CLP procedure and two punctured with gauge 18)
Group 3 (n=6); CLP group with G-21 (which underwent CLP procedure and two punctured with gauge 21)
The procedure
Adult male Wistar rats first underwent CLP as described in details elsewhere (14). Rats were anesthetized with an intra-peritoneal dose of ketamine (80 mg/kg) and xylazine (10 mg/kg). Then, a 3-cm midline laparotomy was performed in order to expose the cecum and adjoining intestine. The cecum was ligated with a 3.0 silk suture at its base right below the ileocecal valve, and was perforated two times using 18- or 21-gauge according to the group animals were assigned to. Dimensions of the needles are as follows: Gauge 18=1.270mm, Gauge 21=0.8192mm. Next, the cecum was replaced in the peritoneal cavity and the incision was closed using 4.0 silk sutures. Following the operation, animals were hydrated though intravenous administration of an isotonic saline solution (50 mL/kg s.c.), returned to a cage in a period of 24 hours (15). CLP procedure was assessed with Murine Sepsis Score (MSS) by an experienced technician (16) .
Sample preparation
24 hours following the procedure, the animals were anesthetized with overdoses of ketamine and xylazine (80- 100 mg/kg and 5-10 mg/kg IP), and were sacrificed. Blood specimens were then collected from the hearts of the rats and subsequently divided into serum separator and ethylenediaminetetraacetic acid (EDTA) tubes for analysis of related blood markers. The tissues were harvested and washed with saline then put into two parts for further histopathological and biochemical assessments. Biochemical samples were stored as frozen samples at -80 °C refrigerator, and pathological specimens were deposited and fixed in 10 mL of 10% formalin.
Determination of oxidative stress biomarkers
ROS assay
Tissue samples were all homogenized and centrifuged accordingly. Subsequently, they were stored in 75 μL extraction buffer, mixed with 80 μL of assay buffer, and kept for 30 min at 37 °C. Production of ROS was absorbed by 2′, 7′-dichlorofluorescein diacetate (DCF-DA) as fluorogenic reagent. Identification of the absorbance change of DCF-DA was identified by means of ELISA fluorometer (Biotec, Tecan U.S.) with maximum excitation (488 nm) and emission (529 nm) spectra for an hour.
LPO assay
Malondialdehyde (MDA) is generally considered as the final by-product of lipid peroxidation (LPO) during generation process of ROS. In the current study, Thiobarbituric acid reactive substances (TBARS) assay were employed for detection of the complex of MDA and Thiobarbituric Acid (TBA). MDA concentration were reported at 532 nm with spectrophotometer. As described in details elsewhere, the amount of MDA formed by tissue samples was reported as μM/mg protein (17).
Total antioxidant power (TAP) assay
FRAP test is widely used for measurement of antioxidant potential of samples. Accordingly, for deoxidizing the Fe3+ -TPTZ (2, 4, 6-tris-(2-pyridyl)-s-triazin) to Fe2+ , 1 mL of Tris-EDTA buffer was added to 50 μL of samples, and, consequently, the absorbance was measured at 593 nm (18).
Assay of total thiol molecules (TTM)
Total thiol molecules is defined as antioxidant content of samples (19). For thiol assessment, interaction of TTM with Ellman's reagent was estimated in maximum peak at 412 nm (20).
Myeloperoxidase (MPO) activity
The homogenization of tissue samples were carried out in 50 mM potassium buffer (pH 6.0) containing 0.5% hexadecyltrimethylammonium bromide (HTAB). Subsequently, the samples were centrifuged (30000 g, 15 min, 4 °C) and 100 μl of the supernatant was mixed with phosphate buffer (pH 6, 50 mM) containing 0.167 mg/ml of o-dianisidine dihydrochloride and 0.0005% H2O2. Change of absorbance was recorded through spectrophotometric analysis at 460 nm five minutes later. The expression of MPO activity was defined as the change of enzyme absorbance during conversion of 1 μmol of H2O2 to H2O/ 1 min at 370c, as described in details elsewhere (21). Unit per mg of tissue protein was considered as the index of MPO activity.
Caspase-3 and −9 activation in the cardiac and lung tissues
Colorimetric assays were utilized for measurement of the caspases-3 and −9 through specific identification of particular amino acid sequences. Briefly, the application of chromophore r-nitroaniline (qNA) produces a yellow color which can be detected by spectrophotometry at 405 nm. For this purpose, tissue samples were degraded by lyses buffer and incubated for 10 min on ice. Moreover, the caspase buffer which consisted of 100 mM of caspase-3 and −9 specific substrate along with total cell lysates were incubated at 37 °C for 4 h. The standard absorbance of caspase-3 and −9 was detected at 405 nm (22).
Lactate levels in tissue and serum samples
Tissue samples
According to the Manufacture’s protocol lactate assay was performed for analysis of all samples. In short, tissue samples (100 mg) were homogenized in 8% perchloric acid and lactate level evaluated with using a standard curve.
Serum samples
After allowing the serum separator tube to clot for 10 minutes at 370c, samples centrifuged (at 3000 g for 20 minutes), then supernatants were collected. The lactate levels of serum samples were determined using a standard curve and reported as mmol/L of serum protein.
Assessment of pro-inflammatory cytokines
Measurement of TNF-α levels
The quantity of TNF-α in test samples was examined by a rat-specific TNF-α ELISA kit (Diaclone, France). According to instruction of the kit, test samples and standards were added to the wells containing antibodies. After washing, biotinylated anti-rat TNF-α antibody and HRP conjugated streptavidin were added to each well, samples were rewashed, and TMB and stop solutions were mixed to the wells respectively. The conversion of blue to yellow color, which is demonstrated to be proportional to the TNF-α level, was estimated at 450 nm.
Assessment of HMGB1 levels
The quantity of HMGB1 in test samples was examined by means of a rat-specific HMGB1 ELISA kit. Test and standards samples were added to the wells containing immobilized antibodies. Following washing, biotinylated anti-rat HMGB1 antibody and HRP conjugated streptavidin were added to the wells. Then samples were rewashed and chromogen and stop solutions were added to the wells. A color change (from blue to yellow) in proportion with the HMGB1 levels was assessed at 450 nm.
Gene expression evaluation
For Quantitative Real-time PCR (qRT-PCR), 1 μg of total RNA was reverse transcribed to cDNA using a Primescript RT reagent kit (TAKARA, Japan). qRT-PCR was performed using the Step one plus ABI system (Applied Biosystems). qRT-PCR was carried out under the following conditions: 30 s at 95 °C for 1 cycle, 40 cycles of 95 °C for 5 s, 60 °C for 34 s and 72 °C for 45 s. One cycle of 30 s 72 °C was done finally to allow final extension (23). The sequences of primers used for qRT-PCR are presented below;
For Glyceraldehyde-3-phosphate dehydrogenase (gene symbol: GAPDH)
sense primer (5′- AGTCTACTGGCGTCTTCACC -3′)
antisense primer (5′- CCACGATGCCAAAGTTGTCA -3′)
For AMP-activated catalytic subunit alpha 1 (AMPK) (gene symbol: Prkaa1)
sense primer (5′- CCGTCTTATAGTTCAACCAT-3′)
antisense primer (5′- TTCGTTCATTATTCTCCTGTT-3′)
For Microtubule-associated protein 1 light chain 3 beta (LC3IIb) (gene symbol: Map1lc3b)
sense primer (5′- CAGTGATTATAGAGCGATACA-3′)
antisense primer (5′- GCCTTCTAATTATCTTGATGAG -3′)
Blood samples parameters
Whole blood assessment
Peripheral blood samples were collected for complete blood count (CBC). The CBC blood samples were collected into EDTA tubes. Hematologic parameters were analyzed 30 mins following sample collection using a hematology analyzer (Sysmex). The counts for lymphocyte (103/μL) and platelets (103/μL) and mean platelet volume (MPV) (fL) were recorded and platelet to lymphocyte ratio (PLR) were calculated, using the results.
Blood glucose levels
24 hours after the CLP procedure, blood samples were collected by skilled personnel using the routine technique of tail-tip amputation. Then the ACCU-CHECK Compact Plus® (Roche Diagnostics, Japan) glucometer were employed for measurement of blood glucose levels in 5 seconds.
Histopathological studies
The animals were euthanized 24 hours after the procedure, and heart and lung tissues were isolated and fixed in the 10% neutral buffered formalin (NBF, pH 7.26) for 48 hours, and then were embedded in paraffin. The 5-μm thick sections were then made ready for staining with hematoxylin and eosin (H&E). Then the histological slides were observed using light microscope (Olympus BX51, Japan). Any suspected changes such as acute or chronic inflammatory response, congestion, hemorrhage or hyperemia, necrosis was investigated in different samples.
Statistical analysis
The results were presented as the mean ± standard error of the mean (SEM). One-way analysis of variance (ANOVA) and Tukey's multi-comparison tests were applied with the degree of significance set at (P< 0.05).