Intestinal Explant Cultures from Gilthead Seabream (Sparus Aurata, L.) Allowed Determining the Mucosal Sensitivity to Bacterial Pathogens and the Impact of a Plant Protein Diet

doi:10.21203/rs.3.rs-54774/v1

Download PDF

Research

Intestinal Explant Cultures from Gilthead Seabream (Sparus Aurata, L.) Allowed Determining the Mucosal Sensitivity to Bacterial Pathogens and the Impact of a Plant Protein Diet

https://doi.org/10.21203/rs.3.rs-54774/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

Although high levels of fish meal replacement by alternative protein sources have been achieved without relevant alterations in terms of growth performance, negative effects on immune status were detected. The diet and fish immunity interactions at gut level have been widely discussed, although in vivo approaches have reported several limitations. In this sense, intestine explant culture system can be a valuable complementary tool to study the interactions between pathogenic bacteria and fish gut response, and the possible influence of environmental, breeding, rearing conditions or dietary components on the responsiveness of the innate immune system in fish.

The object of this study was to test the impact of total substitution of fish meal by plant protein on the intestinal health of seabream (12g) in two growth stages: phase I (90 days), up to 68 g, and phase II (305 days), up to 250g. In phase II, the effects of the long term and short exposure (15 days) to plant protein diet were determined. In order to determine the effect of plant protein feeding on the innate immune response to bacterial pathogens, and an ex vivo procedure of intestine explants culture was implemented.

Results

Fish showed less tolerance to dietary plant protein in phase I than in phase II, while the ex vivo assays indicated that the intestine from fish fed at short-term plant diets showed a higher immune response than at long term feeding.

In relation to the immune response to bacterial challenge, a significant expression in pro-inflammatory cytokines IL-1β and IL-6 after 6 hours of exposure to V. algynoliticus, while COX-2 expression was significantly induced by P. damselae subsp. pisicida, showing positive high correlation between them.

Conclusions

A differential health status was observed depending of growth stage, being stricter to the plant protein inclusion the younger fish. The new experimental system based on fish intestinal explants culture has been successfully implemented, becoming an effective methodology for ex vivo studies. Under ex vivo conditions, the bacterial challenge induced inflammatory and immune intestinal response, responding stronger those intestine of fish fed during a short-term with a total substitution of fish meal.

Animal Science

Biotechnology and Bioengineering

gilthead seabream

ex vivo

intestine explants culture

RT-qPCR

inflammation

plant protein

In addition to the digestion and absorption of nutrients, the fish intestine is a complex biological system that represents a major defence barrier against pathogens and plays a crucial role in osmoregulation, immune and inflammatory response [1]. Furthermore, the intestine participates in the modulation of gastrointestinal microbiota inducing inflammatory responses against pathogenic bacteria or developing immunotolerance to luminal bacteria.

The interactions between fish intestinal immunity, pathogen and commensal microbiota in the gut have been widely reviewed [2]. Bacterial challenges in vivo require specialized settings, expensive operating costs, and a high number of fish, and is difficult to perform and achieve the desired experimental working conditions [3]. In this regard, systems have been developed, based on the ex vivo maintenance of intestine fragments, to evaluate successfully the effect of different bacterial strains on the intestinal health and providing very reliable information on the interactions between the bacteria and the host. The ex vivo intestinal sack method [4] has been used to assess the histological and microbial changes in fish in response to bacteria exposure [3, 5–9]; however, this method is highly restricted by the tissue viability under experimental conditions [3, 4]. The development of new experimental models based on tissue explants culture has allowed maintaining the tissue lifespan, as well as immune and histological features [10–12]. These systems have been used to register responses to exposure to specific bacteria in human tissue explant cultures, also at gene expression level [12].

On the other hand, the necessity to replace fish meal by alternative protein sources in aquafeeds has led researchers to focus on the impact of the inclusion of alternative ingredients, such as plant protein sources. Although its use at high levels without impairing growth performance is feasible [13, 14], negative effects on immune capacity have been observed [15]. Previous findings revealed that during early growth stages the inclusion of plant protein has a great impact [16, 17]; at intestinal level, the inclusion of plant sources in diets has been related to morphological alterations, changes in the intestinal bacterial community, inflammatory events and lack of capacity to regulate the intestinal epithelial integrity [18]. Similar results have been reported in vivo at molecular level, with an altered gene expression pattern [19–21].

Research related to the impact of fish meal replacement becomes even more relevant for carnivorous species, such as gilthead seabream. In this species, previous studies with different levels of substitution and alternative ingredients, have been assayed to evaluate zootechnical parameters and survival [16, 22, 23], and the immune in vivo response to fish meal replacement [24–26] or bacterial infection [27–30].

The ex vivo response of intestinal tissue from fish feed with different protein sources to bacterial challenge has been previously addressed in other species [3]. However, to the best of our knowledge, this is the first study involving gene expression determination in fish intestinal explants after ex vivo bacterial exposure.

Therefore, in the current work, it was developed an intestine explant culture system to evaluate a possible differential inflammatory and immune response to ex vivo bacterial challenge in fish after a long-term of total fish meal replacement at different stages of growing. Additionally, the effect of a short-term of total fish meal replacement by a plant mixture in on growing fish was also assayed.

Ethics statement

The experiment was reviewed and approved by the Committee of Ethics and Animal Welfare of the Universitat Politècnica de València (UPV), following the Spanish Royal Decree 53/2013 on the protection of animals used for scientific purposes [31].

Fish, rearing system conditions, diets and feeding conditions

A total number of 240 juveniles of gilthead seabream (averagare weigth 7,5 g and 60 days) were obtained from the fish farm BERSOLAZ (Bersolaz Spain, S.L.U, Culmarex Group) located in Port de Sagunt (Valencia, Spain) and transported to the facilities at the Universitat Politècnica de València, where the growth trial was conducted after 15 days of adaptation to experimental conditions. Features of the system and water parameters set were described in previous growth trials carried out in these facilities [32,33]. Lighting conditions were determined by the natural photoperiod. Temperature, pH, oxygen, ammonia, nitrite and nitrate concentrations were monitored along the experiment. The fish were daily fed by hand to apparent satiation two times per day (9:00h and 17:00h). The pellets were slowly distributed, allowing fish to eat, in a weekly regime of six day of feeding and one day of fasting.

Diets were prepared by cooking extrusion process using a semi-industrial twin-screw extruder (CLEXTRAL BC-45, St. Etienne, France). A fish meal based control diet (FM), in which most of the protein was provided by fish meal (59%), and a plant protein based diet (PP), in which all the fish meal was replaced by plant sources and synthetic amino acid were added to meet the minimum amino acid requirement for gilthead seabream juveniles [34]. Ingredients and proximate composition are shown in Table 1. Prior to diet formulation, dry matter, crude protein, crude lipid, ashes and crude fibre (CF) of different sources and ingredients used were analysed according to AOAC procedures [35]. All analyses were performed in triplicate. Amino acids of raw diets were also analysed by reverse phase – high performance liquid chromatography [36]. Macronutrients and essential amino acid content were determined in the experimental diets, and they are shown in Table 1.

Table 1

Ingredients, proximal composition and essential amino acids profile of experimental diets
	FM	PP
Ingredients (g kg^-1)
Fish meal	589
Wheat meal	260
Wheat gluten		295
Broad bean meal		41
Soybean meal		182
Pea meal		41
Sunflower meal		158
Krill meal
Squid meal
Fish oil	38.1	90
Soybean oil	92.9	90
Soy Lecithin	10	10
Vitamin-mineral mix*	10	10
Calcium phosphate		38
Arginine		5
Lysine		10
Methionine		7
Taurine		20
Threonine		3
Proximate composition (% dry weight)
Dry matter	88.1	93.9
Ashes	10.1	7.4
Crude lipid	18.5	19.8
Crude fiber	0.8	4.3
Crude protein	44.2	45.0
Essential aminoacids (g 100 g^-1)
Arginine	3.39	3.30
Histidine	1.00	0.82
Isoleucine	1.47	1.17
Leucine	3.24	2.98
Lysine	3.68	2.26
Methionine	1.16	1.06
Phenylalanine	1.80	1.87
Threonine	1.98	1.44
Valine	2.01	1.47

Bacterial strains and growth conditions

Cultures of Pseudomonas anguilliseptica CECT 901, Vibrio algynoliticus CECT 521 and Photobacterium damselae subsp. piscicida CECT 7198 were obtained from the Colección Española de Cultivos Tipo (CECT, Valencia, Spain). The culture medium used for P. anguilliseptica was Tryptic Soy Broth (containing per litre of water, 15.0 g tryptone, 5.0 g soy peptone and 5.0 g NaCl, pH 7.3), and V. algynoliticus and P. damselae subsp. piscicida were grown on Marine Broth (containing per litre of water, 5.0 g Bacto peptone, 1.0 g yeast extract, 0.10 g Fe(III) citrate, 19.45 g NaCl, 0.16 g Na₂CO₃, 3.24 g NaSO₄, 1.80 g CaCl₂, 8.80 g MgCl₂, 0.55 g KCl, 0.08 g KBr, 34.00 mg SrCl₂, 22.00 mg H₃BO₃, 4.00 mg Na-silicate, 2.40 mg NaF, 1.60 mg (NH₄)NO₃ and 8.00 mg Na₂HPO₄, pH 7.6). Bacteria were grown under agitation at 26º C for 2 days (P. anguilliseptica and P. damselae subsp. piscicida) and at 30º C for 1 day (V. algynoliticus). Then, 1.5 g/L of bacteriological agar were added to these media to prepare solid medium in petri dishes. For the bacterial challenge, optical density (600 nm) of the bacterial cultures was determined and bacterial cell number was estimated using the standard curves established for each strain. Then, bacterial cultures were centrifuged at 4.000 g for 20 min, washed once with PBS, and re-suspended in CO₂-independent cell culture medium (Gibco, ThermoFisher) to a final concentration of 3·10⁷ ufc/mL in the case of V. algynoliticus, and 1·10⁷ ufc/mL of P. damselae subsp. piscicida and P. anguilliseptica.

Experimental design

The aim of this work was to evaluate the impact of dietary fish protein substitution by plant protein on the intestinal health status and its immune response capacity. For this purpose, fish were fed with fish meal (FM) or plant protein (PP) based diets, and animals were sacrificed and processed at two critical growth phases of sea bream [16,17]: Phase I (90 days; from 12g to~ 68g) and Phase II (305 days; up to 250g). Each diet was assayed in tanks per triplicate. Fig 1. illustrates the experimental design. At each sampling time intestine fragments were collected, part of them were used to determine basal expression of selected genetic markers and other fragments were used in the culture explant procedure (ex vivo assay) to test the immune competence of the intestinal mucosa when challenged with different bacterial pathogens.

Phase I: Up to 68 g

Fish were fed with FM or PP diets, in tanks per triplicated (40 fish per tank), up to 90 days, being scattering 2 fish per group to submit bacterial challenge (68±37.8g). For basal gene expression two fragments from foregut (FG) and hindgut (HG) from each fish were placed in an eppendorf tube containing 500 µl of RNA Later® (Qiagen, Valencia, CA) for subsequent total RNA (tRNA) extraction. Additionally, four fragments from of FG and HG fragments were used for the ex vivo assay and exposed to pathogens challenge (see below). Gene expression was determined in all samples to evaluate the inflammatory and immune status of the intestinal mucosa due to changes in the diet and the bacterial challenge.

Phase II: Up to 250 g

Fish, ~30 fish per tank, were fed with the same diets, FM and PP, up to 305 days when the mean weight was 252±70.1g (Fig 1). In this second phase, in addition to the impact of long-term feeding with 100% of PP diets, also a short-term exposure (15 days) of total fish meal substitution was evaluated. For this purpose, fish bred with FM diet (n=~15 fish per tank) were changed to a PP diet two weeks before the termination of the experiment (from day 290 to day 305) (PP* group). Three fish from the FM group and two from the PP and PP* were sacrificed to obtain FG and HG explants for ex vivo assays. As in the previous assay, for basal gene expression two fragments from each fish were placed in RNA Later® for subsequent total RNA (tRNA) extraction, and four pieces for ex vivo study.

Ex vivo assays and bacterial challenge

Before tissue preparation, fish were sacrificed by immersion in benzocaine (60 ppm) during 15 min. Then, they were dissected and the intestine was obtained and separated in two sections (foregut and hindgut). Each section was cut with a scalpel in small pieces (4 mm x mm), which were immediately placed in culture filter plates (15 mm diameter wells with 500 µm bottom-mesh, Netwell culture systems, Costar, Cambridge, MA) with the epithelial surface facing up. Filters were placed into wells containing 1 mL of the different bacterial solutions (one of them was preserved without bacteria as control; Ex vivo Unchallenged group) in CO₂-independent cell culture medium (Gibco, ThermoFisher). 100 µL of the corresponding bacterial solutions were finally added to epithelial surface to ensure that samples were completely submerged. At the end of the incubation time, samples were carefully collected from the culture filter plates and stored in 100 mM Tris-HCl at 4ºC or RNA later at -80º C for lactate dehydrogenase (LDH) activity evaluation or RNA isolation, respectively. Changes in pH of the explant culture medium due to different bacterial treatments were monitored. Explants of foregut (FG) and hindgut (HG) from two fish per group were incubated during 4 and 6 h at 22º C in independent CO₂ atmosphere, depending on the experiment. The bacterial species used in the pathogen challenge were: Photobacterium damselae subsp, Pseudomonas anguilliseptica and Vibrio algynoliticus. Pseudomonas anguilliseptica was discarded in phase II, because bacterial concentration could not be determined due to aggregate formation. After explant assay, the samples were placed into RNA Later (Qiagen, Valencia, CA) for subsequent tRNA extraction. All conditions (fish/section/stimuli) were assayed in duplicate and gene expression was determined in all samples to evaluate the intestinal inflammatory and immune status based on experimental diet and bacterial challenge.

LDH activity assay

In order to determine the tissue integrity, the LDH activity was determined [37] in the tissue (U/mg protein) and explant culture medium (U/L) at different times of the incubation (0, 4, 6 and 24 h). LDH activity was analysed measuring the nicotinamide adenine dinucleotide (NADH) absorbance at 340 nm using the commercial kit (BioSystems S. A., Barcelona, Spain). Tissue was weighed, homogenised in Tris-Hcl 100 mM while maintaining the tubes on ice, centrifuged at 12.000 rpm and 4º C for 15 min and supernatant was collected for LDH assessment. Total protein in tissue extracts was determined using Bradford [38].

Gene expression assay of intestinal inflammatory and immune markers

Based on the gene expression analysis used in previous studies in this species (Sparus aurata) to evaluate the intestinal inflammatory and immune status [32] tRNA was extracted from intestinal tissue samples using the phenol/chloroform method with Trizol Reagent (Invitrogen, Spain) and treated with DNAse I (Roche) to remove DNases. Total RNA concentration, quality and integrity were assessed using a NanoDrop 2000C Spectrophotometer (Fisher Scientific SL, Spain). The integrity of 28S/18S was also determined by gel electrophoresis. 1 µg of total RNA was used for cDNA synthesis reaction using the qScript cDNA synthesis kit (Quanta BioScience), according to the manufacturer’s instructions. An Applied Biosystems 2720 Thermal Cycler was used with the following cycling conditions: 22 ºC for 5 min, 42 ºC for 30 min, and 85 ºC for 5 min. cDNA samples were stored at -20º C until gene expression was analysed.

Four housekeeping candidate genes (Table 2) were tested to be used as reference genes, and for assessing RNA integrity along the assay. The Cq of the four genes was determined in six pooled samples from Experiment 1 (two dietary groups: FM and PP; three times: 0, 4 and 6 h). Relative gene expression of six genes was determined in the foregut and hindgut samples. The genetic markers monitored in this assay were three pro-inflammatory markers, IL1-β, IL-6 and COX-2, the main immunoglobulin, IgM, the main intestinal mucin, I-Muc, and the occludin gene, Ocl, with primers listed in Table 2.

Table 2

Primer sequences of candidate genes (reference and target genes) in the RT-qPCR assay
Gene	Abbreviation	GeneBank ID	Primer Forward	Primer Reverse	Lenght	Reference
REFERENCE GENES
Elongation Factor 1α	EF-1α	AF184170	CTGTCAAGGAAATCCGTCGT	TGACCTGAGCGTTGAAGTTG	87	[35, 36]
Glyceraldehide 3-phosphate dehydrogenase	GAPDH	DQ641630	CCAACGTGTCAGTGGTTGAC	AGCCTTGACGACCTTCTTGA	80	[37]
Ribosomal Protein S18	Rps18	AM490061	AGGGTGTTGGCAGACGTTAC	CGCTCAACCTCCTCATCAGT	97	[37]
β-Actin	β-Act	X89920	TCTGTCTGGATCGGAGGCTC	AAGCATTTGCGGTGGACG	113	[38]
TARGET GENES
Interleukin 1β	IL-1β	AJ277166	GCGACCTACCTGCCACCTACACC	TCGTCCACCGCCTCCAGATGC	131	[37]
Interleukin 6	IL-6	AM749958	AGGCAGGAGTTTGAAGCTGA	ATGCTGAAGTTGGTGGAAGG	101	[35]
Cyclooxygenase 2	COX-2	AM296029	GAGTACTGGAAGCCGAGCAC	GATATCACTGCCGCCTGAGT	192	[35, 36]
Intestinal Mucin	I-Muc	JQ277712	GTGTGACCTCTTCCGTTA	GCAATGACAGCAATGACA	102	[38]
Immunoglobulin M	IgM	JQ811851	TCAGCGTCCTTCAGTGTTTATGATGCC	CAGCGTCGTCGTCAACAAGCCAAGC	131	[39]
Occludin	Ocl	JK692876	GTGCGCTCAGTACCAGCAG	TGAGGCTCCACCACACAGTA	81	[35, 36]

All qPCR assays and expression analyses were performed using the Applied Biosystems 7500 Real-Time PCR with SYBR® Green PCR Master Mix (ThermoFisher Scientific, Waltham, Massachusetts, USA). After an initial Taq activation of polymerase at 95 ºC for 10 min, 42 cycles of PCR were performed with the following cycling conditions: 95 ºC for 10 s and 60 ºC for 30 s in all genes. In order to evaluate assay specificity, a melting curve analysis was directly performed after PCR cycles by slowly increasing the temperature (1º C/min) from 60 to 95 ºC, with continuous registration of changes in fluorescent emission intensity. The total volume for every PCR reaction was 20 μl, performed from diluted (1:20) cDNA template (5 μl), forward and reverse primers (10 μM, 1 μL), SYBR® Green PCR Master Mix (10 μl), ROX (2 μL, 10 nM) and nuclease-free water up to 20 μl. The analysis of the results was carried out using the 2^-∆∆Ct method. The target gene expression quantification was expressed relative to the expression of the selected reference gene. A cDNA pool from all the samples was included in each run and acted as a calibrator, and a non-template control for each primer pair, in which cDNA was replaced by water, was run on all plates. Reference and target genes in all samples were run in duplicate PCR reactions.

Statistics

Statistical data analysis were performed with Statgraphics© Centurion XVI software (Statistical Graphics Corp., Rockville, MO, USA).

LDH enzymatic activity in tissues and the supernatant was statistically analysed by one-way analysis of variance (ANOVA) using Newman-Keuls test to determine possible differences across the assay (0, 4, 6 and 24 hours) in FG and HG.

The expression stability of reference genes was assessed using the BestKeeper program, basing on the arithmetic means of the Cq values [39]. Lower deviation in the expression is related to better stability.

The evaluation of intestinal inflammatory and immune status was performed through the gene expression of the target genes both in vivo and ex vivo conditions. The relative gene expression was statistically analysed by ANOVA. Gene expression of cultured pieces was normalised with the expression of ex vivo unchallenged samples at 4 and 6 hours. Multifactorial analysis was used to determine the significance (p<0.05) of different factors considered (dietary treatment: FM/PP, intestinal section: FG/HG and bacterial stimuli: P. damselae subsp. piscicida/P. anguilliseptica/V. algynoliticus) at different times and to determine differences in normalised gene expression between dietary groups, sections and bacterial stimuli, using Newman-Keuls test. Data was expressed with the mean and the standard error of the normalised expression values, and differences were considered statistically significant when p<0.05.

Additionally, with the aim to evaluate if the bacterial challenge is individually inducing the target genes or a combination of a set of genes, a correlation analysis was carried out and the Pearson product-moment coefficient was obtained for each pair of genes.

Finally, in order to confirm the assay reproducibility, the gene expression of the biological replicate samples was randomly assigned to different variables (x and y). Data consistency was evaluated for each gene by simple regression analysis using the model y = ax. 95% confidence intervals for a (a±1.96σ) were obtained for each gene to validate the hypothesis a=1 (y=x).

With the aim to evaluate the effect of PP diet on inflammatory and immune gene expression in the gut, 240 fish were fed on FM and PP for 305 days. The effect of diet was investigated in a first stage at day 90 (phase I) and the experiment continued until day 305 (phase II). Two weeks before the end of the experiment, a group of animals from the FM group was introduced to the PP diet, in order to assess a possible short term effect of the PP diet in adult fish. Intestine fragments of fish harvested in phase I and phase II were used for the ex vivo pathogen challenge assay, but also basal gene expression was determined on intestinal samples.

Optimal conditions for intestinal explant culture were set up through different approaches. Tissue and cellular integrity were monitored by the release of LDH activity at 0, 4, 6 and 24 h of incubation. No relevant differences were observed at tissue level, but a significant increase was registered at 24 h of incubation in the explant culture medium (Additional file Fig. 1). Candidate housekeeping genes for real time qPCR were tested at different times, indicating also that 6 h was an appropriate time of incubation (Additional file Fig. 2). On the other hand, if the effect of ex vivo procedure is evaluated, significant differences were observed in most of the genetic markers analysed (Additional file Fig. 3). Therefore, in the following assays, gene expression was normalised based on the ex vivo unchallenged samples.

Phase I: Up to 68 g

With the aim of assessing the effect of a total fish meal substitution on intestinal inflammatory and immune status at early growth stages (68 g fish weight), basal gene expression was determined and ex vivo trials were carried out with 6 h of challenge of pathogen bacterial cultures.

Basal gene expression

After 90 days fed with PP and FM diets, fish intestines showed a significantly different gene expression profile, as the PP group had a higher expression level for IL-1β and lower for COX-2 (Fig. 2).

Ex vivo assay

The explant culture system was used to determine the immune response of intestinal fragments from on-growing seabream specimens fed with different diets (Fig. 3A). Additionally, the intestine was divided into two segments: FG and HG to evaluate a possible differential immune response (Fig. 3B). At 6 h, gene expression was statistically different between the PP and FM diets in most of the markers, and the induction of IL-1β and Ocl in fish under PP diet was particularly remarkable (Fig. 3A). Gene expression responses of the different intestinal sections were quite similar, with higher expression of IL-6 in FG at 4 h (Additional file Fig. 4) and at 6 h HG presented higher expression of Ocl (Fig. 3B).

After the bacterial challenge, fish belonging to PP group showed, in general, a greater response to the bacterial stimuli (Fig. 4), with significant differences for IL-1β and IL-6 genes. This tendency to a higher response in PP group was not observed at 4 h of incubation, not registering significant differences between diets or bacterial stimuli (Additional file Fig. 5).

If only the bacteria variable is considered, significant differences were only observed with V. alginolyticus after 6 h of incubation, specifically with a higher expression of COX-2 and notably of IL-1β (Additional file Fig. 6B), indicating that this bacterium elicited a great response in all conditions. Finally, if a multifactorial analysis of variance is performed taking into account all the factors, IL-6 and Ocl were significantly altered by the section and the diet at 4 hours of incubation, respectively. Nevertheless, it was necessary 6 h of exposition to register differences caused by bacterial stimulus (Additional file Table 1).

Phase II: Up to 250 g

This second assay tried to evaluate the impact of a total substitution of fish meal at longer term feeding, up to 252 g (305 day; PP) on intestinal gene expression. Additionally, the differential response of total fish meal substitution with plant protein (PP) during a short-term period (15 days; PP*) was evaluated.

Basal gene expression

No gene expression differences were observed between fish fed FM diet and plant based diets at long-term (PP) as well as at short term (PP*), except to IgM in PP* group (Fig. 5).

Ex vivo assay

The expression of pro-inflammatory genes (IL-6 and COX-2 genes) increased after 6 h of incubation in the ex vivo unchallenged group respect to the basal values, confirming the results of previous assay (Additional file Figure S7). Hence, expression results in samples incubated with the different bacteria were normalised with the expression of the control samples, for each experimental factor.

The consistency of ex vivo assay for the biological replicates was checked by a correlation analysis for each biological replicate pair (Additional file Figure S8). The adjustment to the lineal model is particularly good for pro-inflammatory genes (IL1-β, IL-6, COX-2). I-Muc expression reported a high variability between duplicates and no significant relationship can be established between x and y data, consequently, it was not considered in further analyses.

A multifactorial ANOVA of gene expression taking into consideration the diet, section and bacterial challenge (stimuli), underlined a significant linkage of PP diet with COX-2 and Ocl. As expected, the expression of pro-inflammatory genes (IL-1β, IL-6 and COX-2) was bound to the pathogen stimuli (Table 3), while again no differences were reported between sections. Therefore, due to the lack of statistical differences (p < 0.05) between intestinal sections, the following analyses were performed joining both sections.

Table 3

Effect of different factors on normalised gene expression values in phase II
	IL-1β	IL-6	COX-2	IgM	Ocl
Diet	0.533	0.601	0.025*	0.120	0.044*
Section	0.157	0.138	0.168	0.864	0.486
Stimuli	0.003*	0.036*	0.021*	0.218	0.163
p-values obtained for each factor in the multifactorial analysis. Significant values are indicated by *
The exposition to V. algynoliticus and P. damselae subsp. piscicida induced a remarkable increase of IL-1β and IL-6 expression respect to unchallenged samples (Fig. 6). Regarding the sensitivity to the pathogen as function of diet, the PP* group showed a remarkable tendency to have higher expression values for all tested genes in response to bacteria, but only COX-2 and Ocl showed significant differences with respect to groups FM and PP (Fig. 6D and Fig. 6F). Of note, V. algynoliticus induced significant IL-1β response in all diet groups (Fig. 6B). Finally as expected, there was a high correlation (Pearson’s coefficient) between the expression of IL-1β, a known master regulator of innate immune response and inflammation, and IL-6 and COX-2 (IL-1β / IL-6 = 0.74; IL-1β / COX-2 = 0.72) (Fig. 7).

It has been extensively proven that the inclusion of alternative plant proteins can lead to nutritional imbalances [23, 40] and immune dysfunctions [24, 41], particularly in carnivorous fish, increasing their susceptibility to pathogenic invasion, disease and finally death. Findings of present study suggest that the fish gut response to the total dietary substitution of fish meal by plant protein meals can differ at short term and long-term feeding and the fish size. Previous studies in seabream demonstrated that the use of plant proteins induced significant alterations of the gut microbiota, gut gene expression and gut proteomic profile [32, 42, 43]. Nonetheless, these alterations can be affected to different extent by the feeding period or fish stage. In this study, the effect of a total fish meal (FM) substitution by plant protein (PP) was evaluated in two stages of fish growth: from 12 to 68 g (phase I) and up to 252 g (phase II). In phase II, the effect on intestinal health status of FM substitution by PP throughout the whole period (305 days) was compared with that of a shorter term feeding (15 days).

An explant culture assay has been implemented in this work to evaluate the intestinal health status of fish exposed to PP diet. Ex vivo approaches based on explants culture proved to be useful to analyse pro-inflammatory responses [12]. In fish, several works have been attempted to evaluate the pathogen-host [44], especially by the intestinal sack method [3, 7–9]. In the present work, significant differences were clearly observed with incubations of the intestine explants of 6 h, and these experimental conditions showed to preserve tissue integrity. Furthermore, explants obtained from the same section of each fish demonstrated a sound consistency in the response to pathogens. Although a different immunological performance has been attributed to the foregut and hindgut [45], using this experimental set up no significant differences could be found between gene expression in both segments. This allowed increasing the number of explant fragments from each single intestine, then improving the experimental efficiency and reducing the number of fish and, hence, reducing individual variability.

In the present experiment, three pro-inflammatory markers have been monitored to assess the inflammatory status (IL-1β, IL-6, COX-2) [46, 47]. IgM is considered as the most abundant immunoglobulin in plasma, high levels in fish fed with plant sources based diets have been reported [48] and its expression was induced in mucosal tissues as response to pathogen infection [49]. I-Muc is the main intestinal mucin, and it is involved in epithelial protection, bacteria adhesion and growth, and has been suggested as a resilience biomarker to inflammation in fish [50]. Finally, Ocl is a key protein in the regulation of tight junctions between enterocytes, and therefore in the permeability of the epithelial barrier [51].

The stage of fish growth and the feeding period have a clear influence on the response of fish performance to dietary plant protein and previous studies reported that juvenile fish tolerates less dietary plant protein than commercial size fish [16, 52]. In phase I, intestine explants of seabream fed with plant protein for 90 days showed a high basal inflammatory response, particularly of pro-inflammatory genes IL-1β, IL-6 and also COX-2, as shown before. IL-1β is a known canonical master regulator of pro-inflammatory processes, it is secreted in response to gram negative bacteria and its release is followed by the production of IL-6 and other cytokines in the pro-inflammatory cascade [46, 53]. Modification in diet composition changed the expression of IL-1β, in agreement with previous studies, thus indicating that after plant protein diet rendered an already sensitized intestine to inflammatory/stress stimuli [32, 53–55].

During infection, IL-1β is induced, and increased expression of IL-1β has been reported in the intestine of different species, including gilthead seabream [29], after intraperitoneal challenge with gram negative bacteria. Increased expression of IL-1β and COX-2 has been reported before after in vitro challenge of gilthead seabream immune cells with bacteria or commercial pathogen associated molecular pattern (PAMP) solutions [56–59]. Although COX-2 is a typical oxidative stress marker, its expression is also induced by inflammatory mediators [58, 60], including IL-1β [61], as it takes part in the production of reactive oxygen species (ROS) and NO that have antibacterial activity and are also part of the innate immune system in higher vertebrates and carp macrophages [62, 63]. Also genes related to the maintenance of the epithelial tissue integrity, such as Ocl (expressing occludin), are influenced by inflammatory processes [64, 65], and its regulation depends on several cytoskeletal, scaffolding, signalling and polarity proteins [51] and it is definitely related to epithelial barrier functions in vivo and in vitro [65]. In mice, all these genes are possibly connected for the maintenance if intestinal barrier [66].

In phase II (up to 250 g), there were no significant differences between experimental groups (FM and PP), thus supporting that older fish are more tolerant to diet plant proteins than fish in earlier growth stages [16]. It is noteworthy the lack of inflammatory response in PP* group (short PP exposure), supporting that PP long term feeding has deeper alterations in fish gut and contributes to changes in the microbiota and an increase of fish mortality [32], in agreement with previous studies [33, 67, 68],

In so far as deficient diets could be considered a stress factor, long term feeding could determine suppressive or depressive effects on the immune mechanisms [24, 28, 32, 33]. The down-regulation of mRNA expression of some immune related genes with the increased plant proteins in the diet has also been reported in other species [69]. On the other hand, lower gene expression values reported in FM group might be related to a higher protection in host from bacterial adhesion and growth. Nevertheless, results should be analysed with caution since a wide individual variation of inflammatory and immune genes expression has been reported in other species [70] and level of expression before the ex vivo trial conditions the inflammatory and immune capacity registered after bacterial exposure [41].

Nevertheless, a longer stimulation with PP may lead to a degree of tolerance. This would explain why in the ex vivo challenges with bacterial pathogens, stimulation in seabream samples from PP* group was higher than in PP group.

Finally, bacterial pathogens have been selected for the challenge in the ex vivo assay due to their proven pathogenic activity in farmed gilthead seabream. Photobacterium damselae subsp. piscicida is the causal agent of pasteurellosis (Romalde, 2002), Pseudomonas anguilliseptica is related to ‘winter disease’ [71] and Vibrio algynoliticus has been described as the causal agent of vibriosis [72], also associated to other Vibrio species in high mortality outbreaks [73]. This work showed that Vibrio algynoliticus CECT 521 (ATCC 17749) had a very powerful inflammatory effect displaying a very high induction of IL-1β. This agrees with the fact that the published genome of this strain displayed a great toxigenic potential [74], with at least a gene encoding a pore forming RTX family toxin, among others (KEGG Genomes, toxin search on assembly GCA_000354175.2).

Plant protein diets showed to alter the mucosal immune homeostasis. In early stages of development, fish are very sensitive to plant diets, while adult fish seem to become tolerant to a constant PP diet, although maintaining a high threshold of inflammatory signals. The exposure to PP fed for short-term in adults led to a greater response to bacterial challenge. V. algynoliticus triggered the highest immune and inflammatory response. The successful evaluation of inflammatory and immune responses and pathogen challenge has been achieved by means of a new experimental system that implemented fish intestinal explants culture in gilthead seabream, a system that might be easily adapted to other teleost species. The use of such ex vivo methods constitutes an amenable technique that renders reliable results and it helps in reducing the number of animals per assay.

ANOVA: analysis of variance; AOAC: Association of Analytical Communities; β-Act: β-Actin; cDNA: complementary desoxiribonucleic acid; CECT: Colección Española de Cultivos Tipo; COX-2: cyclooxygenase 2; FM: fish meal based FM diet; DMEM: Dulbecco’s Modifed Eagle’s Medium; EF-1α: Elongation Factor 1α; FG: foregut; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; HG: hindgut; IgM: immunoglobulin M; IL-1β: interleuk¡ne 1β; IL-6: interleukine 6; I-Muc: intestinal mucin; LDH: lactate deshydrogenase; NADH: nicotinamide adenine dinucleotide; Ocl: ocludin; PP: plant protein based diet; PP*: plant protein based diet (short term); qPCR: quantitative polymerase chain reaction; RNA: ribonucleic acid; Rps18: ribosomal protein S18

Ethics approval and consent to participate

The experimental protocol was reviewed and approved by the Committee of Ethics and Animal Welfare of the Universitat Politècnica de València, following the Spanish Royal Decree 53/2013 and the European Directive 2010/63/UE on the protection of animals used for scientific purposes.

Consent for publication

Not applicable.

Availability of data and materials

The datasets during the current study are available from the corresponding authors on reasonable request

Competing interests

The authors declare that they have no competing interests that could influence the content of the paper.

Funding

The research was supported by a grant financed by the Spanish Ministerio de Economía y Competitividad AGL2015-70487-P. The funders had no role in study design, data collection and analysis, decision to publish or preparation of the manuscript.

Author’s contributions

CB, MJC, GPM, DSP and SML designed the assay. GE, CB and ATV carried out the experiments. GE analysed the data. GE, DSP, GPM and SML prepared the manuscript and discussed the results. All authors read and approved the final manuscript.

Acknowledgements

The first author was supported by a contract-grant (Contrato Pre-doctoral para la Formación de Profesorado Universitario) from Subprogramas de Formación y Movilidad within the Programa Estatal de Promoción del Talento y su Empleabilidad of the Ministerio de Educación, Cultura y Deporte of Spain.

Minghetti M, Drieschner C, Bramaz N, Schug H, Schirmer K. A fish intestinal epithelial barrier model established from the rainbow trout (Oncorhynchus mykiss) cell line, RTgutGC. Cell Biol Toxicol. 2017;33:539–55. doi:10.1007/s10565-017-9385-x.
Gómez GDG, Balcázar JLJ. A review on the interactions between gut microbiota and innate immunity of fish. FEMS Immunol Med Microbiol. 2008;52:145–54. doi:10.1111/j.1574-695X.2007.00343.x.
Hartviksen M, González Vecino JL, Kettunen A, Myklebust R, Ruohonen K, Wadsworth S, et al. Probiotic and Pathogen Ex-vivo Exposure of Atlantic Salmon (Salmo Salar L.) Intestine from Fish Fed Four Different Protein Sources. J Aquac Res Dev. 2015;6. doi:10.4172/2155-9546.1000340.
Nematollahi A, Decostere A, Ducatelle R, Haesebrouck F, Pasmans F. Development of a gut perfusion model as an alternative to the use of live fish. Lab Anim. 2005;39:194–9.
Lin Y-C, Chen J-C. Acute toxicity of ammonia on Litopenaeus vannamei Boone juveniles at different salinity levels. J Exp Mar Bio Ecol. 2001;259:109–19. doi:10.1016/S0022-0981(01)00227-1.
Nematollahi A, Pasmans F, Broeck W, Van Den, Ducatelle R, Haesebrouck F, Decostere A. Association of Flavobacterium psycrophilum strains with intestinal explants of rainbow trout Oncorhynchus mykiss. Dis Aquat Organ. 2005;67:67–72. doi:10.3354/dao067067.
Harper GM, Monfort M, Saoud IP, Emery MJ, Mustafa S, Rawling MD, et al. An ex vivo approach to studying the interactions of Pediococcus acidilactici and Vibrio (Listonella) anguillarum in the anterior intestine of rainbow trout Oncorhynchus mykiss. Aquac Res Dev. 2011; 4–9. doi:10.4172/2155-9546.S1-004.
Lövmo Martinsen L, Salma W, Myklebust R, Mayhew TM, Ringö E. Carnobacterium maltaromaticum vs. Vibrio (Listonella) anguillarum in the midgut of Atlantic cod (Gadus morhua L.): an ex vivo study. Aquac Res. 2011;42:1830–9. doi:10.1111/j.1365-2109.2010.02784.x.
Ren P, Xu L, Yang Y, He S, Liu W, Ringø E, et al. Lactobacillus planarum subsp. plantarum JCM 1149 vs. Aeromonas hydrophila NJ-1 in the anterior intestine and posterior intestine of hybrid tilapia Oreochromis niloticus ♀×Oreochromis aureus ♂: An exvivo study. Fish Shellfish Immunol. 2013;35:146–53. doi:10.1016/j.fsi.2013.04.023.
Resau JH, Sakamoto K, Cottrell JR, Hudson EA, Meltzer SJ. Explant organ culture: A review. Cytotechnology. 1991;7:137–49.
Dame MK, Bhagavathula N, Mankey C, Dasilva M, Paruchuri T, Aslam MN, et al. Human colon tissue in organ culture: Preservation of normal and neoplastic characteristics. Vitr Cell Dev Biol - Anim. 2010;46:114–22. doi:10.1007/s11626-009-9247-9.
Bäuerl C, Llopis M, Antolín M, Monedero V, Mata M, Zuñiga M, et al. Lactobacillus paracasei and Lactobacillus plantarum strains downregulate proinflammatory genes in an ex vivo system of cultured human colonic mucosa. Genes Nutr. 2013;8:165–80. doi:10.1007/s12263-012-0301-y.
10.1016/B978-0-08-100506-4.00008-8
Oliva-Teles A, Enes P, Peres H. Replacing fishmeal and fish oil in industrial aquafeeds for carnivorous fish. Feed and Feeding Practices in Aquaculture. Elsevier Ltd; 2015. pp. 203–233. doi:10.1016/B978-0-08-100506-4.00008-8.
Monge-Ortíz R, Martínez-Llorens S, Márquez L, Moyano FJ, Jover-Cerdá M, Tomás-Vidal A. Potential use of high levels of vegetal proteins in diets for market-sized gilthead sea bream (Sparus aurata). Arch Anim Nutr. 2016;70:155–72. doi:10.1080/1745039X.2016.1141743.
Oliva-Teles A. Review Article Nutrition and health of aquaculture fish. J Fish Dis. 2012;35:83–108. doi:10.1111/j.1365-2761.2011.01333.x.
Martínez-Llorens S, Moñino AV, Vidal AT, Salvador VJM, Pla Torres M, Jover Cerdá M. Soybean meal as a protein source in gilthead sea bream (Sparus aurata L.) diets: Effects on growth and nutrient utilization. Aquac Res. 2007;38. doi:10.1111/j.1365-2109.2006.01637.x.
Martínez-Llorens S, Vidal AT, Garcia IJ, Torres MP, CerdÁ MJ. Optimum dietary soybean meal level for maximizing growth and nutrient utilization of on-growing gilthead sea bream (Sparus aurata). Aquac Nutr. 2009;15. doi:10.1111/j.1365-2095.2008.00597.x.
Krogdahl Å, Penn M, Thorsen J, Refstie S, Bakke AM. Important antinutrients in plant feedstuffs for aquaculture: an update on recent findings regarding responses in salmonids. Aquac Res. 2010;41:333–44. doi:10.1111/j.1365-2109.2009.02426.x.
K Å, B AM. G. B. Effects of graded levels of standard soybean meal on intestinal structure, mucosal enzyme activities, and pancreatic response in Atlantic salmon (Salmo salar L.). Aquac Nutr. 2003;9:361–71. doi:10.1046/j.1365-2095.2003.00264.x.
Urán PA, Schrama JW, Jaafari S, Baardsen G, Rombout J, Koppe W, et al. Variation in commercial sources of soybean meal influences the severity of enteritis in Atlantic salmon (Salmo salar L.). Aquac Nutr. 2009;15:492–9.
Kokou F, Sarropoulou E, Cotou E, Rigos G, Henry M, Alexis M, et al. Effects of fish meal replacement by a soybean protein on growth, histology, selected immune and oxidative status markers of gilthead sea bream, Sparus aurata. J World Aquac Soc. 2015;46:115–28. doi:10.1111/jwas.12181.
Pereira TG, Oliva-Teles A. Evaluation of corn gluten meal as a protein source in diets for gilthead sea bream (Sparus aurata L.) juveniles. Aquac Res. 2003;34:1111–7.
Martínez-Llorens S, Baeza-Ariño R, Nogales-Mérida S, Jover-Cerdá M, Tomás-Vidal A. Carob seed germ meal as a partial substitute in gilthead sea bream (Sparus aurata) diets: Amino acid retention, digestibility, gut and liver histology. Aquaculture. 2012;338–41. doi:10.1016/j.aquaculture.2012.01.029.
Sitjá-Bobadilla A, Peña-Llopis S, Gómez-Requeni P, Médale F, Kaushik S, Pérez-Sánchez J. Effect of fish meal replacement by plant protein sources on non-specific defence mechanisms and oxidative stress in gilthead sea bream (Sparus aurata). Aquaculture. 2005;249:387–400. doi:10.1016/j.aquaculture.2005.03.031.
Estensoro I, Ballester-Lozano G, Benedito-Palos L, Grammes F, Martos-Sitcha JA, Mydland LT, et al. Dietary butyrate helps to restore the intestinal status of a marine teleost (Sparus aurata) fed extreme diets low in fish meal and fish oil. PLoS One. 2016;11. doi:10.1371/journal.pone.0166564.
Kokou F, Sarropoulou E, Cotou E, Kentouri M, Alexis M, Rigos G. Effects of graded dietary levels of soy protein concentrate supplemented with methionine and phosphate on the immune and antioxidant responses of gilthead sea bream (Sparus aurata L.). Fish Shellfish Immunol. 2017;64:111–21. doi:10.1016/j.fsi.2017.03.017.
Couso N, Castro R, Margariños B, Obach A, Lamas J. Effect of oral administration of glucans on the resistance of gilthead seabream to pasteurellosis. Aquaculture. 2003;219:99–109. doi:10.1016/S0044-8486(03)00019-X.
Mauri I, Romero A, Acerete L, MacKenzie S, Roher N, Callol A, et al. Changes in complement responses in Gilthead seabream (Sparus aurata) and European seabass (Dicentrarchus labrax) under crowding stress, plus viral and bacterial challenges. Fish Shellfish Immunol. 2011;30:182–8. doi:10.1016/j.fsi.2010.10.006.
Reyes-becerril M, López-medina T, Ascencio-valle F, Ángeles M. Fish & Shell fi sh Immunology Immune response of gilthead seabream (Sparus aurata) following experimental infection with Aeromonas hydrophila. Fish Shellfish Immunol. 2011;31:564–70. doi:10.1016/j.fsi.2011.07.006.
Piazzon MC, Galindo-Villegas J, Pereiro P, Estensoro I, Calduch-Giner JA, Gómez-Casado E, et al. Differential Modulation of igT and igM upon Parasitic, Bacterial, Viral, and Dietary Challenges in a Perciform Fish. Front Immunol. 2016;7:1–16. doi:10.3389/fimmu.2016.00637.
Ministerio de la Presidencia. Rd 53/2013. Boe. 2013;34:11370–421.
Estruch G, Collado MC, Monge-Ortiz R, Tomás-Vidal A, Jover-Cerdá M, Peñaranda DS, et al. Long-term feeding with high plant protein based diets in gilthead seabream (Sparus aurata, L.) leads to changes in the inflammatory and immune related gene expression at intestinal level. BMC Vet Res. 2018;14:302. doi:10.1186/s12917-018-1626-6.
Estruch G, Martínez-Llorens S, Tomás-Vidal A, Monge-Ortiz R, Jover-Cerdá M, Brown PB, et al. Impact of high dietary plant protein with or without marine ingredients in gut mucosa proteome of gilthead seabream (Sparus aurata, L.). J Proteomics. 2020;216:103672. doi:10.1016/J.JPROT.2020.103672.
Peres H, Oliva-Teles A. The optimum dietary essential amino acid profile for gilthead seabream (Sparus aurata) juveniles. Aquaculture. 2009;296:81–6. doi:10.1016/j.aquaculture.2009.04.046.
Chemists) A (Association of OA. Official methods of analysis of the Association of Analytical Chemists International. AOAC Gaithersburg, MD; 2005.
Bosch L, Alegría A, Farré R. Application of the 6-aminoquinolyl-N-hydroxysccinimidyl carbamate (AQC) reagent to the RP-HPLC determination of amino acids in infant foods. J Chromatogr B. 2006;831:176–83. doi:10.1016/J.JCHROMB.2005.12.002.
Sima CM, Sibley CP, Jones P, Turner CJ, Greenwood MA. SL. The functional regeneration of syncytiotrophoblast in cultured explants of term placenta Downloaded from. Am J Physiol Regul Integr Comp Physiol. 2001;280:1116–22. doi:10.220.33.1.
biochemistry MB-A. 1976 undefined. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Elsevier. [cited 2 May 2018]. Available: https://www.sciencedirect.com/science/article/pii/0003269776905273.
Pfaffl MW, Tichopad A, Prgomet C, Neuvians TP. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper-Excel-based tool using pair-wise correlations. Biotechnol Lett. 2004;26:509–15. doi:10.1023/B:BILE.0000019559.84305.47.
Monge-Ortiz R, Tomás-Vidal A, Gallardo-Álvarez FJ, Estruch G, Godoy-Olmos S, Jover-Cerdá M, et al. Partial and total replacement of fishmeal by a blend of animal and plant proteins in diets for Seriola dumerili: Effects on performance and nutrient efficiency. Aquac Nutr. 2018;24. doi:10.1111/anu.12655.
Torrecillas S, Caballero MJ, Mompel D, Montero D, Zamorano MJ, Robaina L, et al. Disease resistance and response against Vibrio anguillarum intestinal infection in European seabass (Dicentrarchus labrax) fed low fish meal and fish oil diets. Fish Shellfish Immunol. 2017;67:302–11. doi:10.1016/j.fsi.2017.06.022.
Estruch G, Collado MC, Peñaranda DS, Tomás Vidal A, Jover Cerdá M, Pérez Martínez G, et al. Impact of fishmeal replacement in diets for gilthead sea bream (Sparus aurata) on the gastrointestinal microbiota determined by pyrosequencing the 16S rRNA gene. PLoS One. 2015;10. doi:10.1371/journal.pone.0136389.
Estruch G, Martínez-Llorens S, Tomás-Vidal A, Monge-Ortiz R, Jover-Cerdá M, Brown PB, et al. Impact of high dietary plant protein with or without marine ingredients in gut mucosa proteome of gilthead seabream (Sparus aurata, L.). J Proteomics. 2020;216:103672. doi:10.1016/j.jprot.2020.103672.
Kristiansen M, Merrifield DL, Vecino JLG, Myklebust R, Ringø E. Evaluation of Prebiotic and Probiotic Effects on the Intestinal Gut Microbiota and Histology of Atlantic salmon (Salmo salar L.). J Aquac Res Dev. 2011;31:1–8. doi:10.4172/2155-9546.S1-009.
Løkka G, Koppang EO. Antigen sampling in the fish intestine. Dev Comp Immunol. 2016;64:138–49. doi:10.1016/j.dci.2016.02.014.
Secombes CJ, Wang T, Hong S, Peddie S, Crampe M, Laing KJ. Cytokines and innate immunity of fish. Biol Reprod. 2001;25:713–23.
Gomez D, Sunyer JO, Salinas I. The mucosal immune system of fish: the evolution of tolerating commensals while fighting pathogens. Fish Shellfish Immunol. 2013;35:1729–39. doi:10.1016/j.fsi.2013.09.032.
Krogdahl A, Bakke-McKellep AM, Roed KH, Baeverfjord G. Feeding Atlantic salmon Salmo salar L. soybean products: effects on disease resistance (furunculosis), and lysozyme and IgM levels in the intestinal mucosa. Aquac Nutr. 2000;6:77–84.
Salinas I, Zhang Y-A, Sunyer JO. Mucosal immunoglobulins and B cells of teleost fish. Dev Comp Immunol. 2011;35:1346–65. doi:10.1016/j.dci.2011.11.009.
Pérez-Sánchez J, Estensoro I, Redondo MJ, Calduch-Giner JA, Kaushik S, Sitjà-Bobadilla A. Mucins as Diagnostic and Prognostic Biomarkers in a Fish-Parasite Model: Transcriptional and Functional Analysis. PLoS One. 2013;8. doi:10.1371/journal.pone.0065457.
Chasiotis H, Effendi JC, Kelly SP. Occludin expression in goldfish held in ion-poor water. J Comp Physiol B Biochem Syst Environ Physiol. 2009;179:145–54. doi:10.1007/s00360-008-0297-1.
Sánchez-Lozano NB, Martínez-Llorens S, Tomás-Vidal A, Cerdá MJ. Effect of high-level fish meal replacement by pea and rice concentrate protein on growth, nutrient utilization and fillet quality in gilthead seabream (Sparus aurata, L.). Aquaculture. 2009;298. doi:10.1016/j.aquaculture.2009.09.028.
Savan R, Sakai M. Genomics of fish cytokines. Comp Biochem Physiol Part D. 2006;1:89–101. doi:10.1016/j.cbd.2005.08.005.
Torrecillas S, Montero D, Caballero MJ, Robaina L, Zamorano MJ, Sweetman J, et al. Effects of dietary concentrated mannan oligosaccharides supplementation on growth, gut mucosal immune system and liver lipid metabolism of European sea bass (Dicentrarchus labrax) juveniles. Fish Shellfish Immunol. 2015;42:508–16.
Kono T, Bird S, Sonoda K, Savan R, Secombes CJ, Sakai M. Characterization and expression analysis of an interleukin-7 homologue in the Japanese pufferfish, Takifugu rubripes. FEBS J. 2008;275:1213–26. doi:10.1111/j.1742-4658.2008.06281.x.
Pelegrín P, García-Castillo J, Mulero V, Meseguer J. Interleukine-1B isolated from a marine fish reveals uo-regulated expression in macrophages following activation with lipopolysaccharide and lymphokines. Cytokine. 2001;16:67–72. doi:10.1006/cyto.2001.0949.
Chaves-Pozo E, Pelegrín P, García-Castillo J, García-Ayala A, Mulero V, Meseguer J. Acidophilic granulocytes of the marine fish gilthead seabream (Sparus aurata L.) produce interleukin-1b following infection with Vibrio anguillarum. Cell Tissue Res. 2004;316:189–95. doi:10.1007/s00441-004-0875-9.
Sepulcre MP, López-Castejón G, Meseguer J, Mulero V. The activation of gilthead seabream professional phagocytes by different PAMPs underlines the behavioural diversity of the main innate immune cells of bony fish. Mol Immunol. 2007;44:2009–16. doi:10.1016/j.molimm.2006.09.022.
Boltaña S, Tridico R, Teles M, Mackenzie S, Tort L. Lipopolysaccharides isolated from Aeromonas salmonicida and Vibrio anguillarum show quantitative but not qualitative differences in inflammatory outcome in Sparus aurata (Gilthead seabream). 2014;39: 475–482. doi:10.1016/j.fsi.2014.06.003.
Ramsay R, Ciznadija D, Vanevski M, Mantamadiotis T. Transcriptional regulation of cyclo-oxygenase expression: Three pillars of control. Int J Immunopathol Pharmacol. 2003;16:19–28.
Newton R, Seybold J, Liu SF, Barnes PJ. Alternate COX-2 Transcripts Are Differentially Regulated: Implications for Post-Transcriptional Control. Biochem Biophys Res Commun. 1997;234:85–9.
10.1016/S0952-7915(99)00052-7
Bogdan C, Röllinghoff M, Diefenbach A. Reactive oxygen and reactive nitrogen intermediates in innate and specific immunity. Current Opinion in Immunology. Current Biology Ltd; 2000. pp. 64–76. doi:10.1016/S0952-7915(99)00052-7.
Petit J, Embregts CWE, Forlenza M, Wiegertjes GF. Evidence of Trained Immunity in a Fish: Conserved Features in Carp Macrophages. J Immunol. 2019;203:216–24. doi:10.4049/jimmunol.1900137.
Cerezuela R, Meseguer J, Esteban M. Effects of dietary inulin, Bacillus subtilis and microalgae on intestinal gene expression in gilthead seabream (Sparus aurata L.). Fish Shellfish Immunol. 2013;34:843–8. doi:10.1016/j.fsi.2012.12.026.
10.1038/s12276-018-0126-x
Chelakkot C, Ghim J, Ryu SH. Mechanisms regulating intestinal barrier integrity and its pathological implications. Experimental and Molecular Medicine. Nature Publishing Group; 2018. pp. 1–9. doi:10.1038/s12276-018-0126-x.
Fredenburgh LE, Suárez Velandia MM, Ma J, Olszak T, Cernadas M, Englert JA, et al. Cyclooxygenase-2 Deficiency Leads to Intestinal Barrier Dysfunction and Increased Mortality during Polymicrobial Sepsis. J Immunol. 2011;187:5255–67. doi:10.4049/jimmunol.1101186.
De Francesco M, Parisi G, Médale F, Lupi P, Kaushik SJ, Poli BM. Effect of long-term feeding with a plant protein mixture based diet on growth and body/fillet quality traits of large rainbow trout (Oncorhynchus mykiss). Aquaculture. 2004;236:413–29. doi:10.1016/j.aquaculture.2004.01.006.
Lazzarotto V, Médale F, Larroquet L, Corraze G. Long-term dietary replacement of fishmeal and fish oil in diets for rainbow trout (Oncorhynchus mykiss): Effects on growth, whole body fatty acids and intestinal and hepatic gene expression. PLoS One. 2018;13.
Ye G, Dong X, Yang Q, Chi S, Liu H, Zhang H, et al. Dietary replacement of fish meal with peanut meal in juvenile hybrid grouper (Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂): Growth performance, immune response and intestinal microbiota. Aquac Reports. 2020;17:100327. doi:10.1016/j.aqrep.2020.100327.
Rojo I, Martínez de Ilárduya Ó, Estonba A, Pardo MA. Innate immune gene expression in individual zebrafish after Listonella anguillarum inoculation. Fish Shellfish Immunol. 2007;23:1285–93. doi:10.1016/j.fsi.2007.07.002.
Doménech A, Fernández-Garayzábal JF, Lawson P, García JA, Cutuli MT, Blanco M, et al. Winter disease outbreak in sea-bream (Sparus aurata) associated with Pseudomonas anguilliseptica infection. Aquaculture. 1997;156:317–26. doi:10.1016/S0044-8486(97)00069-0.
Colorni A, Paperna I, Gordin H. Bacterial infections in gilt-head sea bream Sparus aurata cultured at Elat. Aquaculture. 1981;23:257–67. doi:10.1016/0044-8486(81)90019-3.
Balebona MC, Andreu MJ, Bordas MA, Zorilla I, Moriñgo MA, Borrego JJ. Pathogenicity of Vibrio alginolyticus for cultured gilt-head sea bream (Sparus aurata L.). Appl Environ Microbiol. 1998;64:4269–75. doi:10.1128/aem.64.11.4269-4275.1998.
Liu X-F, Cao Y, Zhang H-L, Chen Y-J, Hu C-J, Liu X-FC, et al. Complete genome sequence of Vibrio alginolyticus ATCC 17749 T. Genome Announc. 2015;3:1500–14. doi:10.1128/genomeA.01500-14.
Reyes-Becerril M, Guardiola F, Rojas M, Ascencio-Valle F, Esteban M. Dietary administration of microalgae Navicula sp. affects immune status and gene expression of gilthead seabream (Sparus aurata). Fish Shellfish Immunol. 2013;35:883–9. doi:10.1016/j.fsi.2013.06.026.
Couto A, Kortner TM, Penn M, Bakke AM, Krogdahl, Oliva-Teles A. Effects of dietary soy saponins and phytosterols on gilthead sea bream (Sparus aurata) during the on-growing period. Anim Feed Sci Technol. 2014;198:203–14. doi:10.1016/j.anifeedsci.2014.09.005.
Estensoro I, Calduch-Giner JA, Kaushik S, Pérez-Sánchez J, Sitjá-Bobadilla A. Modulation of the IgM gene expression and IgM immunoreactive cell distribution by the nutritional background in gilthead sea bream (Sparus aurata) challenged with Enteromyxum leei (Myxozoa). Fish Shellfish Immunol. 2012;33:401–10. doi:10.1016/j.fsi.2012.05.029.

Download PDF

Version 1

posted

You are reading this latest preprint version

Intestinal Explant Cultures from Gilthead Seabream (Sparus Aurata, L.) Allowed Determining the Mucosal Sensitivity to Bacterial Pathogens and the Impact of a Plant Protein Diet

Status:

Version 1

Abstract

Figures

Background

Materials And Methods

Ethics statement

Fish, rearing system conditions, diets and feeding conditions

Bacterial strains and growth conditions

Experimental design

Phase I: Up to 68 g

Phase II: Up to 250 g

Ex vivo assays and bacterial challenge

LDH activity assay

Gene expression assay of intestinal inflammatory and immune markers

Statistics

Results

Phase I: Up to 68 g

Phase II: Up to 250 g

Discussion

Conclusion

Abbreviations

Declarations

Ethics approval and consent to participate

Consent for publication

Availability of data and materials

Competing interests

Funding

Author’s contributions

Acknowledgements

References

Supplementary Files

Status:

Version 1